Molecular markers and methods for distinguishing between camellia reticulata and camellia vietnamensis
By developing a molecular marker method using characteristic nucleotide sequences ATGGTAATCCAT and primer pairs, the problem of identifying Camellia oleifera and Camellia oleifera from Vietnam has been solved, enabling rapid and accurate germplasm identification, simplifying equipment requirements, and improving the accuracy of breeding and cultivation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
- Filing Date
- 2022-08-24
- Publication Date
- 2026-07-03
AI Technical Summary
Existing technologies make it difficult to quickly and accurately distinguish between Camellia oleifera and Camellia tangutica, especially in breeding and cultivation, which can easily lead to confusion and affect breeding objectives and forestry production benefits.
A molecular marker method was developed, using the characteristic nucleotide sequence ATGGTAATCCAT as a marker to distinguish between Camellia oleifera and Camellia tangutica. Primer pairs were designed for PCR amplification, and the size of the amplified products was detected by agarose gel electrophoresis to differentiate between the two.
It enables rapid and accurate identification of Camellia oleifera and Camellia oleifera from Vietnam. The operation is simple, the equipment requirements are low, the repeatability is good, and it is suitable for general molecular laboratories, simplifying the identification process.
Smart Images

Figure BDA0003813895730000071 
Figure BDA0003813895730000072 
Figure BDA0003813895730000081
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular marker technology, and specifically to molecular markers and methods for distinguishing and identifying Camellia oleifera and Camellia tangutica. Background Technology
[0002] Camellia oleifera, belonging to the genus Camellia in the family Theaceae, is an evergreen shrub or small tree, and is considered one of the world's four major woody oilseed tree species, along with olive, oil palm, and coconut. Camellia oleifera not only possesses aesthetic value for landscaping but is also increasingly valued for the beneficial health benefits of its compounds and edible oil. Camellia oil, extracted from the kernels of the seeds, is rich in unsaturated fatty acids and various secondary metabolites beneficial to human health. Due to its high oleic acid content and antioxidant activity, it is known as "Oriental olive oil" and is a key healthy edible oil promoted by the Food and Agriculture Organization of the United Nations. Camellia oil and its byproducts are also widely used in the pharmaceutical and cosmetic industries; the fruit shells and seed shells, as processing residues, are used to produce activated carbon and cultivation substrates. The Camellia oleifera tree is a traditional woody oilseed tree species in East and Southeast Asia, with a long history of cultivation and utilization in China, exceeding 2000 years.
[0003] High-quality seedlings are a fundamental prerequisite for the sustainable and healthy development of the camellia oleifera industry, and variety identification is the basis for screening and utilizing high-quality camellia oleifera germplasm resources. In particular, given the current context of large-scale camellia oleifera planting and low-yield forest transformation, conducting germplasm genetic background control and seedling identification before implementing camellia oleifera breeding programs and during afforestation work is of great significance in avoiding losses to breeding objectives and forestry production caused by confused or unreliable inferior seedlings.
[0004] Camellia oleifera is a general term for various Camellia species, encompassing abundant wild species, natural variations, and locally cultivated varieties, resulting in a wide variety and making species (varieties) identification challenging. Camellia vietnamensis (Vietnamese Camellia) exhibits broad ecological adaptability, tall stature, and lush foliage, making it suitable for afforestation of barren mountains, soil and water conservation, and water source protection. Furthermore, its seeds have a high oil content, resulting in high yields per plant, and high productivity can be achieved under suitable ecological conditions. Camellia osmantha (fragrant camellia), a new species of Camellia discovered in Nanning, Guangxi, China in 2012, possesses fragrant flowers, a well-developed root system, rapid growth, early maturity, high seed yield, and a high oil content in its seeds. It also exhibits excellent resistance traits, such as drought and waterlogging tolerance, and is adaptable to various soil fertility and site conditions, making it a promising candidate for development. Camellia osmantha and Camellia vietnamensis are closely related, significantly increasing the difficulty of molecular-level identification between the two. To ensure the successful planting of Camellia oleifera and Camellia tangutica in suitable locations for different breeding or cultivation objectives and to guarantee forest management benefits, it is urgent to develop a simple and efficient method for identifying young seedlings. Summary of the Invention
[0005] The purpose of this invention is to provide molecular markers and methods for distinguishing between Camellia oleifera and Camellia tangutica.
[0006] Specifically, the present invention provides the following technical solutions:
[0007] The present invention provides a molecular marker for distinguishing between Camellia oleifera and Camellia tangutica, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] The 12bp DNA fragment (SEQ ID NO.1: ATGGTAATCCAT) described above can be used as a characteristic sequence to distinguish between Camellia oleifera and Camellia tangutica. Camellia tangutica contains two of the above characteristic sequences in its genome in the form of tandem repeats, while Camellia oleifera contains only one of the above characteristic sequences.
[0009] Preferably, if the Camellia oleifera genome contains a tandem repeat sequence consisting of two molecular markers such as SEQ ID NO.1, it is identified as Vietnamese Camellia oleifera; if the Camellia oleifera genome contains only one molecular marker such as SEQ ID NO.1, it is identified as Camellia oleifera var. semperflorens.
[0010] Specifically, if the Camellia oleifera genome contains the following sequence: ATGGTAATCCATATGGTAATCCAT (SEQ ID NO. 7), it is identified as Vietnamese Camellia oleifera. If the Camellia oleifera genome contains ATGGTAATCCAT but does not contain ATGGTAATCCATATGGTAATCCAT, it is identified as Camellia oleifera var. odorata.
[0011] To achieve efficient detection of the aforementioned molecular markers, this invention has developed primer pairs for detecting the molecular markers described above. The nucleotide sequences of the primer pairs are shown in SEQ ID NO. 2-3, or the nucleotide sequences of the primer pairs are shown in SEQ ID NO. 4-3.
[0012] The DNA fragments amplified by the above primer pairs can also be used as molecular markers to distinguish between Camellia oleifera and Camellia tangutica.
[0013] In some embodiments of the present invention, for Vietnamese camellia oil, the nucleotide sequence of the DNA fragment amplified by the primer pairs shown in SEQ ID NO.2-3 is shown in SEQ ID NO.5, and the nucleotide sequence of the DNA fragment amplified by the primer pairs shown in SEQ ID NO.4-3 is shown in SEQ ID NO.6.
[0014] If the DNA fragment shown in SEQ ID NO.2-3 is obtained by amplification using the primer pair shown in SEQ ID NO.5, it is identified as Vietnamese Camellia oleifera. If the DNA fragment lacking ATGGTAATCCAT compared with the sequence shown in SEQ ID NO.5 is obtained by amplification, it is identified as Camellia oleifera var. semperflorens.
[0015] If the DNA fragment shown in SEQ ID NO. 6 is obtained by amplifying the primer pair shown in SEQ ID NO. 4-3, it is identified as Vietnamese Camellia oleifera. If the DNA fragment lacking ATGGTAATCCAT compared with the sequence shown in SEQ ID NO. 6 is obtained by amplification, it is identified as Camellia oleifera var. semperflorens.
[0016] The present invention also provides a molecular marker for distinguishing between Camellia oleifera and Camellia tangutica, the nucleotide sequence of which is shown in SEQ ID NO.5 or 6.
[0017] Furthermore, the present invention provides a primer set for distinguishing between Camellia oleifera and Camellia tangutica, the primer set comprising one or both of the following primer pairs: primer pairs with nucleotide sequences as shown in SEQ ID NO. 2-3 and primer pairs with nucleotide sequences as shown in SEQ ID NO. 4-3.
[0018] Based on the size of the DNA fragments amplified by the above primer pairs, it is possible to distinguish between Camellia oleifera and Camellia tangutica with relatively high accuracy.
[0019] The present invention also provides a kit comprising the primer set described above for distinguishing and differentiating between Camellia oleifera and Camellia tangutica.
[0020] The present invention provides the molecular markers described above for distinguishing and identifying Camellia oleifera and Camellia tangutica, or the primer sets or kits described above for distinguishing and identifying Camellia oleifera and Camellia tangutica, and their application in the identification of Camellia oleifera and Camellia tangutica.
[0021] This invention provides the application of the molecular markers described above for distinguishing between Camellia oleifera and Camellia tangutica, or the primer sets or kits described above for distinguishing between Camellia oleifera and Camellia tangutica, in molecular marker-assisted breeding of Camellia oleifera or Camellia tangutica.
[0022] The present invention also provides a method for distinguishing between Camellia oleifera and Camellia tangutica, the method comprising the step of detecting the tandem number of the molecular markers described above for distinguishing between Camellia oleifera and Camellia tangutica in the genomic DNA of the Camellia oleifera to be identified.
[0023] Preferably, the method includes: using the genomic DNA of the camellia oleifera to be identified as a template, performing PCR amplification with primer pairs whose nucleotide sequences are shown in SEQ ID NO. 2-3 or SEQ ID NO. 4-3, and detecting the PCR amplification products.
[0024] Preferably, PCR amplification is performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3. If a product of 120bp can be amplified, the tea to be identified is Camellia oleifera. If a product of 132bp can be amplified, the tea to be identified is Camellia oleifera from Vietnam.
[0025] Alternatively, PCR amplification can be performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.4-3. If a product of 269 bp can be amplified, the tea plant to be identified is Camellia oleifera var. semperflorens. If a product of 281 bp can be amplified, the tea plant to be identified is Camellia oleifera var. semperflorens.
[0026] Preferably, the PCR amplification reaction program is as follows: 98°C, 10 sec, 57°C, 5 sec, 72°C, 5 sec, 32 cycles.
[0027] The 25 μl reaction system for PCR amplification is as follows: 100 ng genomic DNA, 12.5 μl of 2×Flash Hot Start MasterMix (Dye), 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, and ddH2O to make up to 25 μl.
[0028] As a preferred embodiment of the present invention, the method for distinguishing and identifying Camellia oleifera and Camellia tangutica includes the following steps:
[0029] (1) DNA extraction from tea leaves to be identified;
[0030] (2) Using the DNA from step (1) as a template, perform PCR amplification using primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3 or primer pairs with nucleotide sequences as shown in SEQ ID NO.4-3;
[0031] (3) The PCR amplification products obtained in step (2) are detected by agarose gel electrophoresis; PCR amplification is performed using primers with nucleotide sequences as shown in SEQ ID NO.2-3. If a product of 120bp can be amplified, the tea to be identified is Camellia oleifera. If a product of 132bp can be amplified, the tea to be identified is Camellia oleifera from Vietnam.
[0032] Alternatively, PCR amplification can be performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.4-3. If a product of 269 bp can be amplified, the tea plant to be identified is Camellia oleifera var. semperflorens. If a product of 281 bp can be amplified, the tea plant to be identified is Camellia oleifera var. semperflorens.
[0033] In this invention, the camellia oil to be identified is Vietnamese camellia oil or fragrant camellia oil.
[0034] The beneficial effects of this invention are as follows: The molecular marker provided by this invention for distinguishing between Camellia oleifera and Camellia vinifera can rapidly and accurately identify the two species. The identification method based on this molecular marker for Camellia oleifera and Camellia vinifera is simple in operation and requires minimal equipment. It utilizes ordinary molecular laboratory equipment platforms (agarose gel electrophoresis), eliminating the need for specialized equipment such as capillary electrophoresis and toxic polyacrylamide gels. This method achieves the identification of closely related species Camellia oleifera and Camellia vinifera, offering advantages such as simplicity, accuracy, efficiency, and good repeatability, and thus possesses significant practical value. Attached Figure Description
[0035] Figure 1 This is a comparison diagram of the chloroplast genome sequences of Camellia oleifera and Camellia oleifera from Vietnam in Example 1 of the present invention.
[0036] Figure 2 This is a diagram showing the PCR amplification results of the 120 primer pairs designed for the 12bp base difference sites on the chloroplast genome sequences of Camellia oleifera and Camellia tangutica in Example 2 of the present invention.
[0037] Figure 3 This is a diagram showing the PCR amplification results of primer pair 269 designed for the 12bp base difference site on the chloroplast genome sequence of Camellia oleifera and Camellia tangutica in Example 3 of the present invention. Detailed Implementation
[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.
[0039] Example 1: Development of molecular markers for distinguishing between Vietnamese Camellia oleifera and Camellia odorata.
[0040] Camellia oleifera (Vietnamese) and Camellia odorata (fragrant flower) are closely related species, and their chloroplast genes are highly conserved, making the development of molecular markers quite difficult. This invention analyzes and compares the chloroplast genome sequences of a large sample of different Camellia oleifera (Vietnamese) and Camellia odorata individuals. It was found that the 24bp sequence ATGGTAATCCAT in the chloroplast genome of Camellia oleifera (Vietnamese) is a tandem repeat of 2 copies, with each repeat unit being 12bp and the repeat sequence being ATGGTAATCCAT. Correspondingly, Camellia odorata (fragrant flower) contains only one of the above repeat units (ATGGTAATCCAT), meaning that compared to Camellia oleifera (Vietnamese), the chloroplast genome sequence of Camellia odorata (fragrant flower) lacks this 12bp sequence (e.g., ATGGTAATCCAT). Figure 1 (As shown). Verification by different individuals of Vietnamese Camellia oleifera and Camellia aralia elata showed that the above 12bp DNA fragment can serve as a molecular marker for distinguishing between Vietnamese Camellia oleifera and Camellia aralia elata.
[0041] Example 2: Identification of Vietnamese Camellia oleifera and Camellia odorata (1)
[0042] Based on the molecular marker developed in Example 1 for distinguishing between Vietnamese Camellia oleifera and Camellia odorata, this example designs primer pairs for detecting the molecular marker and provides a method for distinguishing between Vietnamese Camellia oleifera and Camellia odorata, as follows:
[0043] (1) Extraction of total DNA
[0044] Leaves of Camellia oleifera and Camellia tangutica were collected, frozen in liquid nitrogen, and stored at -80°C for later use. DNA was extracted from the leaves using the CTAB method.
[0045] (2) Primer design
[0046] Specific primer pair 120 was designed for the 12bp differential site in the chloroplast genome sequences of Camellia oleifera and Camellia tangutica obtained in Example 1. The sequences of the primer pair are as follows:
[0047] The upstream primer (5'→3') for primer pair 120 is: GGTGTTCCTAACCATCCACTCT;
[0048] The downstream primer (5'→3') for primer pair 120 is: TAGTCATCATGGCTTGAAGCGG.
[0049] (3) PCR amplification and gel electrophoresis detection
[0050] Using the DNA from step (1) as a template, PCR amplification was performed using primer pair 120. The PCR amplification products were then detected by gel electrophoresis. If a smaller fragment (120bp) was amplified, the DNA to be tested was from Camellia oleifera. If a larger fragment (132bp) was amplified, the DNA to be tested was from Camellia oleifera in Vietnam.
[0051] The PCR system and reaction procedure used in the above PCR amplification process are as follows:
[0052] The PCR reaction system is as follows:
[0053]
[0054] The PCR reaction procedure is as follows:
[0055]
[0056] Some test results are as follows Figure 2 As shown, primer pairs were used to amplify leaf DNA from 120 random samples of *Camellia oleifera* and *Camellia tangutica*. The PCR products were then interpreted after 3% agarose gel electrophoresis. *Camellia tangutica* DNA amplified a specific 132bp product, while *Camellia oleifera* amplified a specific 120bp product. This demonstrates that specific primers designed for the 12bp differential sequence in the chloroplast genomes of *Camellia oleifera* and *Camellia tangutica* can amplify products with a size difference of 12bp. Amplifying the smaller fragment indicates the DNA originates from *Camellia oleifera*, while amplifying the larger fragment indicates the DNA originates from *Camellia tangutica*.
[0057] Example 3: Identification of Vietnamese Camellia oleifera and Camellia odorata (2)
[0058] Based on the molecular marker developed in Example 1 for distinguishing between Vietnamese Camellia oleifera and Camellia odorata, this example designs primer pairs for detecting the molecular marker and provides a method for distinguishing between Vietnamese Camellia oleifera and Camellia odorata, as follows:
[0059] (1) Extraction of total DNA
[0060] Leaves of Camellia oleifera and Camellia tangutica were collected, frozen in liquid nitrogen, and stored at -80°C for later use. DNA was extracted from the leaves using the CTAB method.
[0061] (2) Primer design
[0062] Specific primer pair 269 was designed for the 12bp differential site in the chloroplast genome sequences of Camellia oleifera and Camellia tangutica obtained in Example 1. The sequences of the primer pair are as follows:
[0063] The upstream primer (5'→3') for primer pair 269 is: TCGGTGGATAGGAGCATACTCT;
[0064] The downstream primer (5'→3') for primer pair 269 is: TAGTCATCATGGCTTGAAGCGG (the same as the downstream primer for primer pair 120).
[0065] (3) PCR amplification and gel electrophoresis detection
[0066] Using the DNA from step (1) as a template, PCR amplification was performed using primer pair 269. The PCR amplification products were then detected by gel electrophoresis. If a smaller fragment (269bp) was amplified, the DNA to be tested originated from Camellia oleifera. If a larger fragment (281bp) was amplified, the DNA to be tested originated from Camellia oleifera in Vietnam.
[0067] The PCR system and reaction procedure used in the above PCR amplification process are as follows:
[0068] The PCR reaction system is as follows:
[0069]
[0070] The PCR reaction procedure is as follows:
[0071]
[0072] Some test results are as follows Figure 3 As shown, each lane represents the amplified product obtained using leaf genomic DNA from random samples of *Camellia oleifera* and *Camellia tangutica* as templates. After amplification with primer pair 269, *Camellia tangutica* amplified a specific 281 bp product, while *Camellia oleifera* amplified a specific 269 bp product. This demonstrates that specific primers designed for the 12 bp differential sequence in the chloroplast genomes of *Camellia oleifera* and *Camellia tangutica* can amplify products with a size difference of 12 bp. Amplifying the smaller fragment indicates the DNA originates from *Camellia oleifera*, while amplifying the larger fragment indicates the DNA originates from *Camellia tangutica*.
[0073] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. Molecular markers for distinguishing between Camellia semipervii and Camellia vietnamensis, characterized in that, The amplification primer pair for the molecular marker is SEQ ID NO.2-3 or SEQ ID NO.4-3; Using the genomic DNA of the Camellia oleifera to be identified as a template, the DNA fragment shown in SEQ ID NO.2-3 is amplified using the primer pair shown in SEQ ID NO.
5. If the amplified DNA fragment is missing ATGGTAATCCAT compared with the sequence shown in SEQ ID NO.5, it is identified as Camellia oleifera. Using the genomic DNA of the Camellia oleifera to be identified as a template, the DNA fragment shown in SEQ ID NO.4-3 is amplified using the primer pair shown in SEQ ID NO.
6. If the amplified DNA fragment is missing ATGGTAATCCAT compared with the sequence shown in SEQ ID NO.6, it is identified as Camellia oleifera var. praecox.
2. The use of the molecular marker of claim 1 or the primer set or kit for differentiating and identifying Camellia semipetala and Camellia vietnamensis in differentiating and identifying Camellia semipetala and Camellia vietnamensis, characterized in that, The primer set comprises one or both of the following primer pairs: primer pairs with nucleotide sequences as shown in SEQ ID NO. 2-3 and primer pairs with nucleotide sequences as shown in SEQ ID NO. 4-3; The kit contains the primer set.
3. The application of the molecular markers for distinguishing between Camellia oleifera and Camellia tangutica, or the primer sets or kits for distinguishing between Camellia oleifera and Camellia tangutica, as described in claim 1, in marker-assisted breeding of Camellia oleifera or Camellia tangutica, characterized in that... The primer set comprises one or both of the following primer pairs: primer pairs with nucleotide sequences as shown in SEQ ID NO. 2-3 and primer pairs with nucleotide sequences as shown in SEQ ID NO. 4-3; The kit contains the primer set.
4. A method for distinguishing between Camellia oleifera and Camellia oleifera from Vietnam, characterized in that, The method includes: using the genomic DNA of the camellia oleifera to be identified as a template, performing PCR amplification with primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3 or primer pairs with nucleotide sequences as shown in SEQ ID NO.4-3, and detecting the PCR amplification products; If the DNA fragment shown in SEQ ID NO.2-3 is obtained by amplification using the primer pair shown in SEQ ID NO.5, it is identified as Vietnamese Camellia oleifera. If the DNA fragment lacking ATGGTAATCCAT compared with the sequence shown in SEQ ID NO.5 is obtained by amplification, it is identified as Camellia oleifera var. semperflorens. If the DNA fragment shown in SEQ ID NO. 6 is obtained by amplifying the primer pair shown in SEQ ID NO. 4-3, it is identified as Vietnamese Camellia oleifera. If the DNA fragment lacking ATGGTAATCCAT compared with the sequence shown in SEQ ID NO. 6 is obtained by amplification, it is identified as Camellia oleifera var. semperflorens.
5. The method for distinguishing and differentiating between Camellia oleifera and Camellia oleifera according to claim 4, characterized in that, PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3. If a product of 120 bp could be amplified, the tea plant to be identified was determined to be Camellia oleifera var. semperflorens. If a product of 132 bp could be amplified, the tea plant to be identified was determined to be Camellia oleifera var. semperflorens.
6. The method for distinguishing and identifying Camellia oleifera and Camellia oleifera according to claim 4, characterized in that, PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.4-3. If a product of 269 bp was amplified, the tea plant to be identified was determined to be Camellia oleifera var. semperflorens. If a product of 281 bp was amplified, the tea plant to be identified was determined to be Camellia oleifera var. semperflorens.