Use of luc7l2 in the diagnosis and treatment of acute kidney injury

By detecting and silencing LUC7L2 expression, the diagnostic and treatment challenges of AKI have been solved. LUC7L2 has become an ideal target for AKI, significantly improving cisplatin-induced renal tubular epithelial cell damage and renal function decline.

CN116377059BActive Publication Date: 2026-05-15XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310474849.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-28
Publication Date
2026-05-15
Estimated Expiration
2043-04-28

AI Technical Summary

Technical Problem

There is a lack of effective methods in the current technology for diagnosing and treating acute kidney injury (AKI), especially cisplatin-induced AKI, and the role of LUC7L2 in this process is unclear.

Method used

By using specific primers to detect the expression level of LUC7L2 and silencing its expression using CRISPR and RNAi technologies, LUC7L2 inhibitors were developed for the preparation of therapeutic drugs.

Benefits of technology

LUC7L2 can be used as a diagnostic marker for AKI. Downregulating its expression can reduce the death and oxidative stress of renal tubular epithelial cells, improve renal function, and reduce renal tissue damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to the use of LUC7L2 in the diagnosis and treatment of acute kidney injury (AKI). LUC7L2 is significantly up-regulated in cisplatin-induced AKI model, and knocking down LUC7L2 can rescue cell death caused by different concentrations of cisplatin, and improve the accumulation of MDA and ROS caused by cisplatin; knocking down LUC7L2 can reduce the swelling degree of the kidney of cisplatin-induced AKI model, and thus reduce the kidney specific gravity; knocking down LUC7L2 improves the decline of renal function and renal pathological injury caused by cisplatin, and LUC7L2 has the potential to be used as a diagnostic and therapeutic target for AKI.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically involving the application of LUC7L2 as a novel target for the diagnosis and treatment of acute kidney injury. Background Technology

[0002] Acute kidney injury (AKI) is a clinical syndrome characterized by a rapid decline in renal function, leading to the accumulation of metabolic waste products. AKI has a high morbidity and mortality rate and is prone to progressing to chronic kidney disease (CKD) or end-stage renal disease (ESRD). Drug toxicity, ischemia, acute infection, and acute glomerulonephritis are all causes of AKI. The pathophysiology of AKI is complex and multifactorial. Potential pathophysiological mechanisms include hemodynamic changes, microcirculatory obstruction, microvascular thrombosis, endothelial dysfunction, renal inflammation, mitochondrial dysfunction, and renal tubular cell damage. Currently, there are few effective treatments for AKI; therefore, there is an urgent need to explore new targets or better strategies for its prevention and treatment.

[0003] LUC7-like 2 (pre-mRNA splicing factor 2) is a human homologue of yeast Luc7p. It is a cofactor of yeast U1 small nuclear ribonucleoprotein (U1 snRNP) and was the first protein discovered from differentially expressed proteins in cisplatin-resistant cell lines. As a nuclear protein playing a role in pre-mRNA splicing, it participates in the interaction between U1 snRNP and the nuclear cap complex, as well as the recognition of the 5p splice site. LUC7L2 expression has been reported in myeloid leukemia. Currently, the expression, function, and impact on cisplatin nephrotoxicity of LUC7L2 in acute kidney injury (AKI) are unknown. Summary of the Invention

[0004] To address the aforementioned technical problems, one objective of this invention is to provide the application of reagents for detecting LUC7L2 in the preparation of acute kidney injury kits.

[0005] Furthermore, the reagent for detecting LUC7L2 is a primer for detecting LUCL2. Preferably, the primer comprises an upstream primer and a downstream primer.

[0006] Preferably, the upstream and downstream primers are GGTGTTGAAGGCGAGAGCTT and ACGTGTACGTGGAAGACGAC, respectively.

[0007] Preferably, the upstream and downstream primers are TTAGGGTGGGACCCTTCGT and CCTAGAGAGTGAGCCCTGGT, respectively.

[0008] Preferably, the upstream and downstream primers are GCGAGAGTCGGCTTAGTCTG and TGGACGTGGAAGATGGCAAC, respectively.

[0009] Furthermore, the acute injury is cisplatin-induced acute kidney injury.

[0010] The second objective of this invention is to provide the application of LUC7L2 inhibitors in the preparation of drugs for treating acute kidney injury.

[0011] Further, the LUC7L2 inhibitor is a reagent for silencing LUC7L2. Preferably, the silencing method is selected from CRISPR or RNAi. Preferably, the silencing method is RNAi.

[0012] Further, the LUC7L2 inhibitor is selected from siRNA, shRNA, dsRNA, or miRNA. Preferably, the inhibitor is siRNA or shRNA.

[0013] Preferably, the siRNA contains GAGGAAGTTTATCGGAATT or GGTCCTATGAGAGTGCTAA.

[0014] Preferably, the shRNA contains GAGCGGTGTTCATGAGTTAA.

[0015] Furthermore, the acute injury is cisplatin-induced acute kidney injury.

[0016] The beneficial effects of this invention are as follows: LUC7L2 expression is upregulated in cisplatin-induced AKI models and cisplatin-stimulated renal tubular epithelial cells, indicating that LUC7L2 may be involved in the damage process of renal tubular epithelial cells in AKI, and LUC7L2 can serve as a disease biomarker for diagnosing AKI. Overexpression of LUC7L2 aggravates the accumulation of MDA and ROS in cisplatin-induced renal tubular epithelial cells; downregulation of LUC7L2 expression reduces renal tubular epithelial cell death, inhibits the increase of lipid peroxidation and ROS levels, and downregulation of LUC7L2 expression can significantly improve the decline in renal function and alleviate renal tissue damage in cisplatin-induced AKI model mice. These results suggest that LUC7L2 may be an ideal target for the treatment of cisplatin-induced AKI. Attached Figure Description

[0017] Figure 1LUC7L2 expression levels in a cisplatin-induced AKI model. (A) IHC representations of LUC7L2 expression in kidney tissues of the control group (Ctrl) and the AKI model group (Cis) (200× and 400×); (B) Western blot representations of LUC7L2 expression in the renal cortex of the Ctrl and Cis groups and corresponding grayscale analysis statistics (n=6); (C) Western blot representations of LUC7L2 protein expression in NRK-52E cells, the control group (Ctrl), and the 20 μM cisplatin-stimulated group (Cis) and corresponding grayscale analysis statistics (n=4).

[0018] Figure 2 Overexpression of LUC7L2 exacerbates cisplatin-induced renal tubular epithelial cell death. (A) PCR statistics of LUC7L2 expression in NRK-52E and HK-2 cells after 48 h transfection with empty vector plasmid (NC-OE) and LUC7L2 overexpression plasmid (OE-LUC7L2) (n=3); (B) Western blot images representing LUC7L2 expression in NC-OE and OE-LUC7L2 groups in NRK-52E and HK-2 cells; (C) NRK-52E and HK- 2. Statistical graph of cell viability changes after 24 h of stimulation with different concentrations of cisplatin for plasmid transfection; Statistical graph of MDA and ROS content in (DE)NRK-52E and HK-2 cells in NC-OE group, OE-LUC7L2 group, group stimulated with empty vector plasmid + 20 μM cisplatin (NC-OE+Cis), and group stimulated with LUC7L2 overexpression plasmid + 20 μM cisplatin (OE-LUC7L2+Cis) (n=3).

[0019] Figure 3 Knocking down LUC7L2 inhibits cisplatin-induced renal tubular epithelial cell death. (A) PCR statistics of LUC7L2 expression in NRK-52E and HK-2 cells after 48 h of transfection with negative control siRNA (Scra) and LUC7L2 siRNA (si-LUC7L2) (n=3); (B) Western blot images of LUC7L2 expression in NRK-52E and HK-2 cells in the Scra and si-LUC7L2 groups; (C) Statistical graph of cell viability changes in NRK-52E and HK-2 cells after 24 h of stimulation with different concentrations of cisplatin following siRNA transfection; (DE) Statistical graph of MDA and ROS content in NRK-52E and HK-2 cells in the Scra, si-LUC7L2, negative control siRNA + 20 μM cisplatin transfection group (Scra+Cis), and LUC7L2 siRNA + 20 μM cisplatin transfection group (si-LUC7L2+Cis) groups (n=3).

[0020] Figure 4 AAV-mediated LUC7L2 knockdown improves cisplatin-induced AKI. (A) Representative IHC images of LUC7L2 expression in kidney tissue from the following groups: renal cortical injection of negative control virus (NC-AAV), renal cortical injection of LUC7L2 knockdown virus (RNAi-LUC7L2), renal cortical injection of negative control virus + cisplatin-induced AKI model group (NC-AAV+Cis), and renal cortical injection of LUC7L2 knockdown virus + cisplatin-induced AKI model group (RNAi-LUC7L2+Cis) (200× and 4×). (00×); (B,C) Statistical graphs of serum Scr, BUN and kidney / body weight in the NC-AAV group, RNAi-LUC7L2 group, NC-AAV+Cis group, and RNAi-LUC7L2+Cis group (n=7); (D) Representative images showing changes in renal tubular damage in HE staining of the NC-AAV group, RNAi-LUC7L2 group, NC-AAV+Cis group, and RNAi-LUC7L2+Cis group (200× and 400×). Detailed Implementation

[0021] Unless otherwise stated, the terms used herein have the meanings commonly understood by those skilled in the art, and the raw materials and equipment used are all known products obtained by purchasing commercially available products.

[0022] The technical solution of the present invention will be described in detail below with reference to the embodiments.

[0023] Example 1: Upregulation of LUC7L2 expression in a cisplatin-induced AKI model

[0024] The cell experiments were divided into two groups: a blank control group (Ctrl) and a cisplatin-stimulated group (Cis). Male C57BL / 6J mice weighing 20-25g from the same batch were randomly divided into a control group (Ctrl) and a cisplatin-treated group (Cis). Mice in the Cis group were injected intraperitoneally with 25mg / kg of cisplatin solution once according to their body weight, while mice in the Ctrl group were injected with an equal volume of physiological saline.

[0025] To observe the expression of LUC7L2 in a cisplatin-induced AKI model, kidney tissues from C57BL / 6J mice in the Ctrl and Cis groups were first subjected to IHC to detect LUC7L2. Compared with the Ctrl group, cisplatin treatment significantly increased the expression of LUC7L2 in renal tubular epithelial cells. Figure 1 A); Western blot analysis of renal cortical tissue from mice in the Ctrl and Cis groups showed that LUC7L2 expression was significantly upregulated after cisplatin treatment. Figure 1B). Subsequently, in vitro experiments were performed. After 24 hours of stimulation with 20 μM cisplatin in NRK-52E and HK-2 cells, LUC7L2 expression was detected by Western blot. The results showed that LUC7L2 expression significantly increased after cisplatin stimulation in both NRK-52E and HK-2 cells. Figure 1 C). The above experimental results suggest that LUC7L2 expression was upregulated in the cisplatin-induced AKI model, and LUC7L2 may be involved in cisplatin-induced AKI.

[0026] Example 2: Overexpression of LUC7L2 exacerbates cisplatin-induced renal tubular epithelial cell death.

[0027] After transfecting NRK-52E and HK-2 cells with the empty vector overexpression plasmid (NC-OE) and the LUC7L2 overexpression plasmid (OE-LUC7L2) for 48 h, RNA and protein were extracted from NRK-52E and HK-2 cells. Transfection efficiency was assessed by qRT-PCR and Western blot. The results showed that plasmid transfection could overexpress LUC7L2 at both RNA and protein levels. Figure 2 A, B).

[0028] Similarly, NRK-52E and HK-2 cells in the NC-OE and OE-LUC7L2 groups were first stimulated with different concentrations of cisplatin (5μM, 10μM, 15μM, 20μM, 25μM, 30μM) for 24 h, and then cell viability was measured. Overexpression of LUC7L2 could aggravate the growth restriction of NRK-52E and HK-2 cells induced by different concentrations of cisplatin. Figure 2 C). Subsequently, NRK-52E and HK-2 cells in the NC-OE and OE-LUC7L2 groups were stimulated with cisplatin (20 μM) for 24 h, and the intracellular MDA and ROS levels were measured. Cisplatin induced the accumulation of MDA and ROS in renal tubular epithelial cells, while overexpression of LUC7L2 exacerbated the above changes induced by cisplatin. Figure 2 DE).

[0029] Example 3: Knocking down LUC7L2 inhibits cisplatin-induced renal tubular epithelial cell death

[0030] First, NRK-52E and HK-2 cells were transfected with negative control siRNA (Scra) and LUC7L2 siRNA (si-LUC7L2) for 48 h. The expression of LUC7L2 at both RNA and protein levels was then assessed to evaluate transfection efficiency. LUC7L2 expression at both RNA and protein levels was decreased. Figure 3 A, B) suggests that siRNA can interfere with the expression of LUC7L2.

[0031] NRK-52E and HK-2 cells from the Scra and si-LUC7L2 groups were stimulated with different concentrations of cisplatin (5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 30 μM) for 24 h, and cell viability was then assessed. The results showed that knockdown of LUC7L2 could rescue NRK-52E and HK-2 cell death induced by different concentrations of cisplatin. Figure 3 C).

[0032] After 24 hours of stimulation with cisplatin (20 μM) in Scra, si-LUC7L2, and HK-2 cells, the expression of intracellular MDA and ROS was detected. The results showed that cisplatin treatment significantly increased the levels of MDA and ROS in both cell types. Knockdown of LUC7L2 cells could alleviate cisplatin-induced MDA and ROS accumulation. Figure 3 DE).

[0033] Example 4: AAV-mediated LUC7L2 knockdown improves cisplatin-induced AKI

[0034] To verify the role of LUC7L2 in AKI in in vivo experiments, we specifically knocked down LUC7L2 in mouse kidneys by injecting AAV9-packaged LUC7L2 shRNA into the renal cortex, followed by intraperitoneal injection of 25 mg / kg cisplatin to induce AKI.

[0035] First, IHC was performed on mice in each group. Treatment with LUC7L2-shRNA AAV virus significantly reduced LUC7L2 expression in the renal cortex, indicating that the virus injection was effective. Figure 4 A) Subsequently, serum samples from each group of mice were collected to detect Scr and BUN levels to verify the success of AKI modeling. Compared with the NC-AAV group, Scr and BUN were significantly increased in the NC-AAV+Cis group, and Scr and BUN were also significantly increased in the RNAi-LUC7L2+Cis group compared with the RNAi-LUC7L2 group. This indicates that AKI modeling was successful, and treatment with LUC7L2-shRNAAAV virus can significantly reduce cisplatin-induced renal function decline ( Figure 4 B); AKI causes kidney swelling, so the kidney-to-body weight ratio in mice was also measured. The results showed that cisplatin treatment significantly increased the kidney specific gravity in mice, while knocking down LUC7L2 reduced the degree of kidney swelling and thus reduced the kidney specific gravity. Figure 4 C).

[0036] Subsequently, the kidney tissues of mice in each group were stained with hematoxylin and eosin (HE) to observe the pathological damage to the kidneys. Compared with the NC-AAV group, the NC-AAV+Cis group showed extensive renal tubular cell death, severe cell shedding, interstitial edema, and destruction of the brush border of the renal cortex. Treatment with AAV virus containing LUC7L2-shRNA could partially reverse cisplatin-induced renal tubular damage. Figure 4 D). These results indicate that knocking down LUC7L2 improves cisplatin-induced renal function decline and renal pathological damage.

[0037] The LUC7L2 detection primers used in this example are:

[0038]

[0039] The si-LUC7L2 sequence used in the embodiment is:

[0040] GAGGAAGTTTATCGGAATT (mouse LUC7L2)

[0041] GGTCCTATGAGAGTGCTAA (human LUC7L2)

[0042] The LUC7L2-shRNA sequence used in this example is: GAGCGGTGTTCATGAGTTAA

[0043] Those skilled in the art will appreciate that various modifications to the above embodiments can be made without departing from the overall spirit and concept of the present invention. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.

Claims

1. Application of reagents for detecting LUC7L2 in the preparation of diagnostic kits for acute kidney injury.

2. The application according to claim 1, wherein the reagent is a primer for detecting LUC7L2.

3. The application according to claim 2, wherein the primer comprises an upstream primer and a downstream primer, wherein the upstream and downstream primers are GGTGTTGAAGGCGAGAGCTT and ACGTGTACGTGGAAGACGAC, respectively.

4. The application according to any one of claims 1-3, wherein the acute kidney injury is cisplatin-induced acute kidney injury.

5. The application of LUC7L2 inhibitors in the preparation of drugs for treating acute kidney injury, wherein the inhibitor is siRNA, and the siRNA is GAGGAAGTTTATCGGAATT or GGTCCTATGAGAGTGCTAA.

6. The application according to claim 5, wherein the acute kidney injury is cisplatin-induced acute kidney injury.