An engineered strain for synthesizing resveratrol using p-coumaric acid as a substrate, construction and application thereof

By constructing an engineered strain of Yersinia lipolytica containing mutants of 4-coumaryl-CoA ligase and resveratrol synthase, the problem of low resveratrol yield in existing technologies has been solved, and the industrial production of resveratrol with high efficiency has been realized.

CN116426492BActive Publication Date: 2026-02-10HEBEI WEIDAKANG BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310164664.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-25
Publication Date
2026-02-10
Estimated Expiration
2043-02-25

AI Technical Summary

Technical Problem

Existing engineered strains produce low yields of resveratrol when synthesizing it using p-coumaric acid as a substrate, which cannot meet the needs of industrial production.

Method used

We constructed mutants of 4-coumaryl-CoA ligase and resveratrol synthase, and obtained a highly efficient engineered strain of Yersinia lipolytica by plasmid amplification mutagenesis. We then used this strain to synthesize resveratrol using p-coumaric acid as a substrate.

Benefits of technology

The efficient synthesis of resveratrol was achieved, with a catalytic conversion rate of 92.3% and a yield of up to 35.8 g/L, making it suitable for large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116426492B_ABST
    Figure CN116426492B_ABST
Patent Text Reader

Abstract

The application discloses an engineered strain for synthesizing resveratrol by using p-coumaric acid as a substrate, construction and application thereof, and belongs to the technical field of biotechnology. The active sites of 4-coumaroyl-CoA ligase and resveratrol synthase are semi-rationally designed and modified, the optimal mutants 4CL1 (M4) and VST1 (N3) are expressed in a Yarrowia lipolytica strain, and the obtained engineered strain can efficiently convert p-coumaric acid into resveratrol. The yield of resveratrol in a shake flask fermentation reaches 724.6 mg / L. Then, the two mutants are fused and expressed by using a rigid linker, and the Yarrowia lipolytica engineered strain for producing resveratrol by using p-coumaric acid as a substrate is obtained. In a 5-L fermenter, batch feeding fermentation is carried out, the substrate conversion rate reaches 92.3%, and the yield of resveratrol reaches 35.8 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an engineered strain for synthesizing resveratrol using p-coumaric acid as a substrate, its construction, and its application. Background Technology

[0002] Resveratrol, also known as stilbene triol, is a non-flavonoid polyphenolic organic compound. It is an antitoxin produced by many plants in response to stimulation and can be synthesized in grape leaves and skins. It is a bioactive component in wine and grape juice. It is easily absorbed orally and excreted in urine and feces after metabolism. As a plant secondary metabolite, resveratrol has been shown to have regulatory effects in antioxidation, anti-inflammation, anti-cancer, estrogen production, neuroprotection, cardioprotection, anti-atherosclerosis, anti-aging, anti-diabetic, anti-osteoporosis, and weight loss, making it highly sought after and with broad application prospects in medicine, health products, and cosmetics. In recent years, in particular, its significant inhibitory effects on various tumor cells, including carcinoma, breast cancer, colon cancer, gastric cancer, and leukemia, have made it a hot research topic. Currently, relying solely on natural plant extraction methods for resveratrol is insufficient to meet demand, while chemical synthesis methods face difficulties in widespread adoption due to severe pollution and safety concerns. With advancements in microbial metabolic engineering and synthetic biology, designing and constructing efficient heterologous synthetic pathways in hosts such as *E. coli* and *Saccharomyces cerevisiae*, combined with large-scale fermentation using engineered strains, is a crucial method for the industrial production of rare plant-derived natural products like resveratrol. However, current engineered strains, whether using simple carbon sources for de novo synthesis or precursor feeding, exhibit low resveratrol yields, making them unsuitable for industrial production.

[0003] This invention provides a 4-coumaryl-CoA ligase mutant and a resveratrol synthase mutant, and a high-yield resveratrol-producing Yersinia lipolytica engineered strain based on these two mutants. The catalytic conversion rate of coumaric acid to resveratrol reaches 92.3%, with a yield as high as 35.8 g / L, providing support for the large-scale industrial production of resveratrol. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides an engineered strain of Yersinia lipolytica that can efficiently synthesize resveratrol using p-coumaric acid as a substrate, its construction, and its application. This strain can be used for the efficient synthesis of resveratrol using p-coumaric acid as a substrate.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a 4-coumaroyl-CoA ligase mutant and a resveratrol synthase mutant. The 4-coumaroyl-CoA ligase mutant and the resveratrol synthase mutant can be used for the efficient synthesis of resveratrol using p-coumaric acid as a substrate.

[0007] The 4-coumaroyl-CoA ligase mutant provided by this invention has an amino acid sequence derived from the sequence shown in SEQ ID NO:1 by mutation at one or more amino acid residue sites selected from the following group: 260, 328, 330, 333, 338, 351, 353, 363, 364, 378, 381, 442, 451, 452, 453, 457, 460, 492, and 498, that is, one or more of these sites are mutated to any amino acid other than the original amino acid;

[0008] Preferably, the mutation modes at each site in the 4-coumaroyl-CoA ligase mutant are: Y260F, S328V, A330S, L333M, E338R, G351S, G353C, L363A, A364S, S378P, C381V, I442V, L451F, F452D, I453V, L457M, L460M, K492P, and E498Q.

[0009] The resveratrol synthase mutant provided by this invention has an amino acid sequence derived from the sequence shown in SEQ ID NO:2, with mutations occurring at one or more amino acid residue sites selected from the following group: positions 51, 54, 57, 59, 61, 62, 203, 204, 205, 208, 252, 254, 265, 266, 267, 268, 269, 270, 273, 276, 307, 312, 313, and 315.

[0010] Preferably, the mutation modes at each site in the resveratrol synthase mutant are: E51D, K54E, N57K, I59M, D61Q, K62S, E203Q, D204T, A205H, S208C, G252C, I254V, F265C, H266D, L267M, W268L, P269K, N270D, T273G, S276D, P307H, A312Q, V313I, A315S.

[0011] The 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant in this invention can be obtained by plasmid amplification and mutagenesis.

[0012] This invention also provides coding genes for 4-coumaroyl-CoA ligase mutants and resveratrol synthase mutants. The coding genes in this invention can be inserted into recombinant expression vectors or genomes. The term "expression vector" refers to bacterial plasmids, yeast plasmids, or other vectors well known in the art. Those skilled in the art can use well-known methods to construct expression vectors containing the coding genes for "4-coumaroyl-CoA ligase mutants and resveratrol synthase mutants," such as enzyme digestion and ligation, and seamless cloning.

[0013] The aforementioned coding genes and expression vectors can be used to transform host cells to enable them to express 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant proteins. The host cells described in this invention include those containing the aforementioned expression vectors or those whose genomes integrate the coding sequences of the 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant of this invention. The host cells or strains of this invention can efficiently express 4-coumaroyl-CoA ligase and / or resveratrol synthase mutant enzymes with high catalytic performance.

[0014] The host cell of the present invention can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell. Specifically, the host cell can be a bacterium or a yeast; preferably, the host cell is *Escherichia coli*, *Saccharomyces cerevisiae*, *Pichia pastoris*, *Hansenula polymorpha*, or *Yarrowia lipolytica*; more preferably, the host cell is *Yarrowia lipolytica*.

[0015] Secondly, the present invention provides a coding gene for the above-mentioned 4-coumaroyl-CoA ligase mutant and a coding gene for the resveratrol synthase mutant. The coding genes for the above-mentioned 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant can be further optimized by codons.

[0016] Thirdly, the present invention provides an expression vector comprising the encoding gene of the above-mentioned 4-coumaroyl-CoA ligase mutant and the encoding gene of the above-mentioned resveratrol synthase mutant.

[0017] Fourthly, the present invention provides a recombinant genetically engineered bacterium containing an expression vector for the coding gene of a 4-coumaroyl-CoA ligase mutant and / or an expression vector for the coding gene of a resveratrol synthase mutant, or having the coding gene of a 4-coumaroyl-CoA ligase mutant and / or the coding gene of a resveratrol synthase mutant integrated into its genome. The two genes can be expressed individually or fused together to form a fusion protein.

[0018] Preferably, the recombinant genetically engineered bacteria is a high-resveratrol-producing Yersinia lipolytica engineered bacteria that fused and expressed the above-mentioned 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant.

[0019] Fifthly, the present invention provides a method for obtaining recombinant genetically engineered bacteria: by transferring the above-mentioned expression vector into host cells. When the recombinant genetically engineered bacteria contain both the coding gene for a 4-coumaroyl-CoA ligase mutant and the coding gene for a resveratrol synthase mutant, the two genes can be expressed individually or by constructing a fusion protein through fusion expression.

[0020] In a sixth aspect, the present invention provides a fusion protein obtained by linking a 4-coumaroyl-CoA ligase mutant and a resveratrol synthase mutant via a linker peptide.

[0021] Preferably, the linker peptide is GPGPGPGP or GPGPGPGPGPGPGPGPGP.

[0022] In a seventh aspect, the present invention provides the above-mentioned 4-coumaroyl-CoA ligase mutant and / or resveratrol synthase mutant, the coding gene of the 4-coumaroyl-CoA ligase mutant and / or the coding gene of the resveratrol synthase mutant, or the application of the aforementioned recombinant genetically engineered bacteria in the production of resveratrol.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] The 4-coumaroyl-CoA ligase mutant and resveratrol synthase mutant provided by this invention significantly improve the catalytic activities of 4-coumaroyl-CoA ligase and resveratrol synthase, respectively, effectively solving the problem of low catalytic efficiency of 4-coumaroyl-CoA ligase and resveratrol synthase in current research. Furthermore, based on these two mutants, this invention constructs a high-yield resveratrol-producing engineered strain, achieving a batch fermentation yield of 35.8 g / L in a 5L fermenter with no accumulation of intermediate by-products. Attached Figure Description

[0025] Figure 1 The figure shows the results of whole-cell catalytic production of resveratrol by the 4CL1 mutant strain.

[0026] Figure 2 The image shows the results of whole-cell catalytic production of resveratrol by the VST1 mutant strain.

[0027] Figure 3 This is a diagram of the pINA1312-4CL1(M4)-8GP-VST1(N3) plasmid vector.

[0028] Figure 4 Figure showing the results of fermentation of resveratrol using engineered Yeast strains. Detailed implementation method:

[0029] Example 1 Construction of a high-efficiency mutant of 4-coumaryl-CoA ligase (4CL1)

[0030] (1) Using pRSFDuet-1 vector as a template, PCR amplification was performed using primers P1-F and P1-R. The primer sequences are shown in Table 1. The pRSFDuet-1 vector is a commercially available vector purchased from Novagen. After recovery of the PCR product, the linearized vector pRSFDuet-1 was obtained, and the size of the linearized vector fragment was 3471 bp.

[0031] (2) Using the codon-optimized, artificially synthesized 4CL1 gene as a template, PCR amplification was performed using primers 4CL1-F and 4CL1-R. The primer sequences are shown in Table 1. The amplification product was recovered to obtain the target fragment of the 4CL1 gene, which has a size of 1716 bp. The nucleotide sequence of the 4CL1 gene is shown in SEQ ID NO.3.

[0032] (3) Using the codon-optimized artificially synthesized VST1 gene as a template, PCR amplification was performed using primers VST1-F and VST1-R. The primer sequences are shown in Table 1. The amplification product was recovered to obtain the target fragment of the VST1 gene, which has a size of 1209 bp. The nucleotide sequence of the VST1 gene is shown in SEQ ID NO.4.

[0033] (4) Using the pRSFDuet-1 vector as a template, PCR amplification was performed using primers P2-F and P2-R. The primer sequences are shown in Table 1. After recovery of the PCR product, the target fragment T7pro was obtained, with a fragment size of 171 bp.

[0034] (5) The above-mentioned 4CL1, VST1, T7pro target fragments and linearized vector pRSFDuet-1 were ligated using the ClonExpress II one-step cloning kit to obtain the recombinant plasmid pRSFDuet-4CL1-VST1. Sequencing confirmed that the recombinant plasmid was successfully constructed.

[0035] (6) The plasmid pRSFDuet-4CL1-VST1 was transformed into the Escherichia coli expression host strain BL21(DE3) by electroporation and plated onto LB solid medium containing kanamycin. The LB plates were incubated at 37°C until transformants grew. Positive transformants were picked to obtain wild-type engineered bacteria (WT).

[0036] (7) Using the constructed pRSFDuet-4CL1-VST1 plasmid as a template, primers were designed for plasmid amplification and mutagenesis to obtain a linearized plasmid vector with base mutations. This vector was then transformed into E. coli BL21(DE3), and after in vivo repair and circularization, a plasmid with base mutations was obtained. Specifically, PCR amplification was performed using primers 4CL1-M1-F and 4CL1-M1-R. The primer sequences are shown in Table 1, and the mutant sequence was obtained. The mutation mode is: Y260F / S328V / A330S / L333M / E338R. The resulting plasmid expressing the mutant was named pRSFDuet1-4CL1(M1)-VST1, and the resulting mutant engineered bacteria was named M1.

[0037] (8) Using the constructed pRSFDuet1-4CL1(M1)-VST1 plasmid as a template, PCR amplification was performed using primers 4CL1-M2-F and 4CL1-M2-R. The primer sequences are shown in Table 1. The mutant sequence was obtained. The mutation mode is as follows:

[0038] L363A / A364S / S378P / C381V. The resulting expression mutant plasmid was named pRSFDuet1-4CL1(M2)-VST1, and the resulting mutant engineered bacteria was named M2;

[0039] (9) Following step 8, using the constructed pRSFDuet1-4CL1(M2)-VST1 plasmid as a template, PCR amplification was performed using primers 4CL1-M3-F and 4CL1-M3-R. The mutation mode was as follows:

[0040] G351S / G353C / L451F / F452D / I453V / L457M / L460M. The mutant plasmid pRSFDuet1-4CL1(M3)-VST1 was obtained, resulting in the mutant engineered bacterium M3.

[0041] (10) Following step 8, using the constructed pRSFDuet1-4CL1(M3)-VST1 plasmid as a template, PCR amplification was performed using primers 4CL1-M4-F and 4CL1-M4-R. The mutation mode was: I442V / K492P / E498Q. The mutant plasmid pRSFDuet1-4CL1(M4)-VST1 and the mutant engineered bacterium M4 were obtained. The amino acid sequence of 4CL1(M4) is shown in SEQ ID NO.5;

[0042] (11) Wild-type and mutant engineered bacteria were cultured overnight in a seed culture medium containing 50 μg / mL kanamycin to obtain a seed solution. The seed culture medium (mass percentage) consisted of 1% tryptone, 1% sodium chloride and 0.5% yeast extract. The culture conditions for the seed solution were 37°C and 220 rpm.

[0043] (12) The above seed culture was inoculated at 2% into a protein expression medium (mass percentage) containing 1.2% tryptone, 2.4% yeast extract, 0.4% glycerol, 0.231% KH2PO4 and 1.254% K2HPO4. The culture conditions were 37℃ and 220 rpm. After culturing for 3 h, IPTG was added to a final concentration of 0.5 mM for induction expression. The induction conditions were 25℃ and 220 rpm for 16 h.

[0044] (13) After protein induction expression was completed, the bacterial cells were collected by centrifugation at 4000 rpm for 20 min at room temperature, washed with sterile 0.9% physiological saline, and centrifuged again; the bacterial cells were resuspended in a certain volume of transformation buffer until the OD of the resuspended solution was reached. 600 The value was 10. 10 mL of the system was used for whole-cell catalysis. The reaction conditions were 30℃, 150 rpm, and 3 h. The conversion solution consisted of: 10 g / L glucose, 10 g / L glycerol, 6 g / L Na₂HPO₄, 0.5 g / L NaCl, 3 g / L KH₂PO₄, 1 g / L NH₄Cl, 246.5 mg / L MgSO₄·7H₂O, 14.7 mg / L CaCl₂·2H₂O, 27.8 mg / L FeSO₄·7H₂O, and 200 mg / L p-coumaric acid.

[0045] (14) After the reaction is complete, take 0.5 mL of the reaction solution and mix it thoroughly with 1 mL of methanol. Centrifuge at 12000 rpm for 2 min and filter it into a liquid phase bottle using a 0.22 μm filter membrane for high performance liquid chromatography detection.

[0046] (15) High performance liquid chromatography for the determination of resveratrol: The chromatographic column is a C18 (250mm*4.6mm, 5μm) or equivalent column, the mobile phase is acetonitrile and 1% acetic acid solution (gradient elution conditions: 5% acetonitrile for 5min, 5-50% acetonitrile for 15min, 50% acetonitrile for 5min, 50-5% acetonitrile for 2min), the flow rate is 1mL / min, the injection volume is 10μL, the column temperature is 25℃, and resveratrol is detected at a wavelength of 305nm. The content is determined by external standard method.

[0047] (16) The result is as follows Figure 1 As shown, compared with the wild-type (WT) strain, the 4CL1 mutant engineered strain has a 249.6% higher resveratrol production capacity, reaching a yield of 81.1 mg / L;

[0048] The aforementioned single mutants of 4-coumaroyl-CoA ligases are not limited to any of the mutations at positions 260, 328, 330, 333, 338, 351, 353, 363, 364, 378, 381, 442, 451, 452, 453, 457, 460, 492, and 498; mutations at any of these positions can enhance enzyme activity. The aforementioned multiple mutants of 4-coumaroyl-CoA ligases are not limited to mutants M1, M2, M3, M4, or the multiple mutants of 4-coumaroyl-CoA ligases listed in Table 3. Multiple mutant engineered strains of 4-coumaroyl-CoA ligases constructed based on the aforementioned sites can also enhance catalytic activity.

[0049] Table 1. Primer sequences for constructing the 4CL1 mutant

[0050]

[0051] Example 2 Construction of a high-efficiency mutant of resveratrol synthase (VST1)

[0052] Using the constructed pRSFDuet-4CL1(M4)-VST1 plasmid as a template, primers were designed for plasmid amplification and mutagenesis to obtain a linearized plasmid vector with base mutations. This vector was then transformed into E. coli BL21(DE3), and after in vivo repair and circularization, the plasmid with base mutations was obtained.

[0053] (1) Using the constructed pRSFDuet1-4CL1(M4)-VST1 plasmid as a template, PCR amplification was performed using primers VST1-N1-F and VST1-N1-R. The primer sequences are shown in Table 2. The mutant sequence was obtained. The mutation mode is as follows:

[0054] The strains were named E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S. The resulting expression mutant plasmid was named pRSFDuet1-4CL1-VST1(N1), and the resulting mutant engineered bacteria was named N1.

[0055] (2) Using the constructed pRSFDuet1-4CL1-VST1(N1) plasmid as a template, PCR amplification was performed using primers VST1-N2-F and VST1-N2-R. The primer sequences are shown in Table 2. The mutant sequence was obtained. The mutation mode is as follows:

[0056] G252C / I254V / F265C / H266D / L267M / W268L / P269K. The resulting expression mutant plasmid was named pRSFDuet1-4CL1-VST1(N2), and the resulting mutant engineered bacteria was named N2;

[0057] (3) Similar to step 2, using the constructed pRSFDuet1-4CL1-VST1(N2) plasmid as a template, PCR amplification was performed using primers VST1-N3-F and VST1-N3-R. The mutation mode was as follows:

[0058] E203Q / D204T / A205H / S208C / N270D / T273G / S276D. The mutant plasmid pRSFDuet1-4CL1-VST1(N3) was obtained, and the mutant engineered bacterium N3 was formed. The amino acid sequence of VST1(N3) is shown in SEQ ID NO. 6;

[0059] (4) The activity of the VST1 mutant engineered bacteria was detected using a whole-cell catalysis method. The specific method is described in Example 1 (steps 11-15). The results are as follows: Figure 2 As shown, compared with the control strain M4, the VST1 mutant engineered strain had a 117.4% increased resveratrol production capacity, with a maximum yield of 176.3 mg / L;

[0060] The aforementioned resveratrol synthase single mutants are not limited to any of the mutations at positions 51, 54, 57, 59, 61, 62, 203, 204, 205, 208, 252, 254, 265, 266, 267, 268, 269, 270, 273, 276, 307, 312, 313, and 315, all of which can enhance enzyme activity. The resveratrol synthase multiple mutants are also not limited to mutants N1, N2, N3, and the resveratrol synthase multiple mutants listed in Table 3; multiple resveratrol synthase mutant engineered bacteria constructed based on the aforementioned sites can also enhance catalytic activity.

[0061] Table 2. Primer sequences for VST1 mutant construction

[0062]

[0063]

[0064] Table 3.4 Resveratrol Yield of Other Mutant Strains of CL1 and VST1

[0065]

[0066]

[0067] Example 3. Co-expression of 4CL1 (M4) and VST1 (N3) genes in Yersinia lipolytica.

[0068] 1) Construction of pINA1312-4CL1(M4)-VST1(N3) integrative plasmid

[0069] The nucleotide codon preference of the 4-coumaroyl-CoA ligase mutant 4CL1(M4) gene and the resveratrol synthase mutant VST1(N3) gene in Examples 1 and 2 is Escherichia coli. Considering codon adaptability, the nucleotides of the 4CL1(M4) gene described in Example 1 were optimized with codons from Yersinia lipolytica to obtain the 4CL1(M4) nucleotide sequence, as shown in SEQ ID NO. 7; the nucleotides of the VST1(N3) mutant described in Example 2 were optimized with codons from Yersinia lipolytica to obtain the VST1(N3) nucleotide sequence, as shown in SEQ ID NO. 8. The two optimized genes were then synthesized by Wuhan Jinkairui Biotechnology Co., Ltd.

[0070] A) Using hp4d-4CL1-F / xpr2-4CL1-R as primers, the 4CL1(M4) nucleotide fragment carrying 20bp homologous sequences of the pINA1312 vector backbone at both ends was amplified using the optimized 4CL1(M4) nucleotides of Yersinia lipophilia codon as templates. Similarly, using xpr2-F / hp4d-R as primers, the pINA1312-vector vector backbone fragment was amplified using the pINA1312 plasmid as template. The two fragments were then ligated into a vector using the ClonExpress II one-step cloning kit to construct the pINA1312-4CL1(M4) plasmid.

[0071] B) Similarly, using hp4d-VST1-F / xpr2-VST1-R as primers, and the VST1(N3) nucleotides optimized according to the Yersinia lipophila codon as templates, the VST1(N3) fragment carrying 20bp homologous sequences of the pINA1312 vector backbone at both ends was amplified; the pINA1312-vector vector backbone fragment and the VST1(N3) fragment were ligated into a vector using the ClonExpress II one-step cloning kit to construct the pINA1312-VST1(N3) plasmid.

[0072] C) Using Xpr-1312-yz-up / xpr2-Zeta-R as primers and pINA1312-VST1(N3) plasmid as template, an operon fragment containing hp4d-VST1-xpr2 was amplified, with 20 bp homologous sequences at each end of the vector backbone fragment. Simultaneously, using Zeta-F1 / Xpr2-R1 as primers and pINA1312-4CL1(M4) plasmid as template, a backbone fragment containing the full length of pINA1312-4CL1(M4) plasmid was amplified. The fragments were then ligated using the ClonExpress II one-step cloning kit to construct the pINA1312-4CL1(M4)-VST1(N3) plasmid. The primers used are shown in the table below:

[0073] Primer name Sequence 5'→3' hp4d-4CL1-F TACAACCACACACATCCACAATGGCACCCCAAGAACAAGC xpr2-4CL1-R GGGACAGGCCATGGAGGTACTTAGAGACCATTCGCCAGCT xpr2-F TAAGTACCTCCATGGCCTGTCC hp4d-R TGTGGATGTGTGTGGTTGTATGTG hp4d-VST1-F TACAACCACACACATCCACAATGGCATCAGTAGAGGAATT xpr2-VST1-R GGGACAGGCCATGGAGGTACTTAATTGGTAACCGTCGGCA Xpr-1312-yz-up CCCGTGTCCGAATTCCATGTGCTAGCTTATCGATACGCGT xpr2-Zeta-R CTCTCCAGAGCGAGTGTTACCATCTCACTTGCGTATGTATGGAA Zeta-F1 GTAACACTCGCTCTGGAGAG Xpr2-R1 ACATGGAATTCGGACACGGG

[0074] 2) Transformation of Yersinia lipolytica with genes 4CL1 (M4) and VST1 (N3)

[0075] The transformation of the *Yeast lipolyticis* strain was performed primarily according to the instructions of the Zymo Frozen-EZ Yeast Transformation kit II, which are briefly described below:

[0076] Linearization of the transformation fragment vector: The pINA1312-4CL1(M4)-VST1(N3) plasmid constructed in Example 3(1) was digested with NEB restriction endonucleases. The digestion system is shown in the table below:

[0077]

[0078] The prepared enzyme digestion system was placed in a 37℃ water bath for 4 hours to obtain linearized plasmid fragments, which were then reserved for later use.

[0079] Preparation of competent cells: Pick a single po1f colony from the resuscitation plate and incubate it overnight at 30°C with shaking at 250 rpm. When the OD value of the bacterial culture reaches 1.0, centrifuge the cells at 500g for 4 min, discard the supernatant, add 1 ml of Solution 1 to resuspend the cells, centrifuge again and discard the supernatant; add 100 μl of Solution 2 to resuspend the cells. The resulting competent cells of Yersinia lipophila can be directly used for transformation.

[0080] Transformation of competent cells: Mix 50 μL of competent cells with the linearized plasmid fragments described above, add 500 μL of Solution 3, mix thoroughly, and incubate in a 30°C water bath for 45 min. During incubation, gently tap or vortex at low speed 2-3 times to mix thoroughly. Spread the incubation solution onto the corresponding SD defect plates, place the plates in a 30°C incubator, and incubate statically for 2-4 days to obtain transformants. The correct transformant is named VST1-01.

[0081] strain genotype Po1f Wild type VST1-01 Po1f, pINA1312-4CL1(M4)-VST1(N3)

[0082] 3) VST1-01 strain transformed with p-coumaric acid to produce resveratrol

[0083] The VST1-01 strain obtained in Example 3(2) was selected for shake-flask fermentation of resveratrol strain. Single clones were picked into test tubes containing 3 ml of YPD liquid medium (20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose) and cultured overnight at 30°C and 220 rpm. After overnight culture, the culture was transferred to 50 ml of YPD liquid medium (250 ml Erlenmeyer flask) and cultured for 24 h. 3 g / L of p-coumaric acid was added, and fermentation was carried out for 72 h. The fermentation broth was taken for liquid chromatography analysis. The liquid chromatography method was as shown in Example 1. The fermentation results are shown in the table below:

[0084] strain residual coumaric acid Resveratrol production VST1-01 2234.1 mg / L 724.6 mg / L

[0085] Example 4: Fusion expression of 4CL1 (M4) and VST1 (N3) to increase resveratrol yield

[0086] Protein fusion expression is often used to reduce the consumption of potentially unstable intermediates, thereby increasing the yield of the final product. Resveratrol yield was increased by using rigid peptides of (GP)*4 (GPGPGPGP) and (GP)*8 (GPGPGPGGPGPGPG). The specific construction method is shown below:

[0087] Using 4GP-4CL1-R / 4GP-VST1-F as primers and pINA1312-4CL1(M4)-VST1(N3) as a template, an operon fragment containing hp4d-4CL1-VST1-Xpr was amplified. This fragment carries a rigid peptide with (GP)*4. Subsequently, the vector was self-ligated using the ClonExpress II one-step cloning kit to construct the plasmid pINA1312-4CL1(M4)-GP4-VST1(N3). The plasmid vector is described below. Figure 3 As shown; using 8GP-4CL1-R / 8GP-VST1-F as primers and pINA1312-4CL1(M4)-VST1(N3) as a template, an operon fragment containing hp4d-4CL1-VST1-Xpr was amplified. This fragment carries a rigid peptide of (GP)*8. Subsequently, the vector was self-ligated using the ClonExpress II one-step cloning kit to construct the vector plasmid pINA1312-4CL1(M4)-GP8-VST1(N3). The primer sequences used are shown in the table below:

[0088]

[0089]

[0090] The constructed pINA1312-4CL1(M4)-GP4-VST1(N3) and pINA1312-4CL1(M4)-GP8-VST1(N3) plasmids were transformed into po1f strain according to the yeast transformation method in Example 3(2), and the new strains were constructed as shown below:

[0091] strain genotype VST1-10 Po1f, pINA1312-4CL1(M4)-GP4-VST1(N3) VST1-11 Po1f, pINA1312-4CL1(M4)-GP8-VST1(N3)

[0092] The newly constructed strain was fermented according to the fermentation method of Example 3(3), and the fermentation yield of resveratrol is shown in the table below:

[0093] strain residual coumaric acid Resveratrol production VST1-10 1982.3 mg / L 896.3 mg / L VST1-11 1952.2 mg / L 1003.45mg / L

[0094] Example 5. Production of resveratrol by fed-batch fermentation of strain VST1-11

[0095] VST1-11 single clones were picked from the plate and inoculated into test tubes containing 2 ml of YPD medium. The culture was carried out at 30°C and 220 rpm with shaking for 24 h. The culture was then transferred to a 500 ml Erlenmeyer flask containing 100 ml of YPD medium and cultured with shaking for another 24 h to obtain the seed culture for batch fermentation. All 100 ml of the seed culture was transferred to 3 L of fermentation medium, the composition of which was: 60 g / L glucose, 15 g / L (NH4)2SO4, 8 g / L KH2PO4, 6.15 g / L MgSO4, 12 ml / L vitamins, 10 ml / L trace metal salts, 0.5 g / L leucine, and 10 g / L p-coumaric acid. The trace metal salt solution contained the following components: 5.75 g / L ZnSO4·7H2O, 0.32 g / L MnCl2, 0.32 g / L CuSO4, 0.47 g / L CoCl2, 0.48 g / L Na2MoO4, 2.9 g / L CaCl2·2H2O, 2.8 g / L FeSO4·7H2O, and 0.5 M EDTA. The vitamin solution contained the following components: 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L nicotinic acid, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxal phosphate, and 0.2 g / L para-aminobenzoic acid.

[0096] Supplemented culture medium: 700 g / L glucose, 120 g / L p-coumaric acid, 10 ml / L trace metal salts, 10 ml / L vitamins, supplemented with 680 mL.

[0097] The batch fermentation temperature was 30℃, and the pH was controlled to 6.0 using NaOH. The glucose concentration was controlled to 30g / L in batches, and the product formation was monitored during the fermentation process.

[0098] Ultimately, strain VST1-11 produced a maximum of 35.8 g / L of resveratrol, achieving a conversion rate of 92.3%. A schematic diagram of the fermentation process is shown below. Figure 4 As shown.

Claims

1,4-Coumaroyl-CoA ligase mutant, characterized by: The amino acid sequence of the 4-coumaroyl-CoA ligase mutant is obtained by mutating the sequence shown in SEQ ID NO:1 in any of the following ways: Y260F / S328V / A330S / L333M / E338R, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V / G351S / G353C / L451F / F452D / I453V / L457M / L460M, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V / G351S / G353C / L451F / F452D / I453V / L457M / L460M / I442V / K492P / E498Q.

2. The encoding gene of the 4-coumaroyl-CoA ligase mutant according to claim 1.

3. A recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium comprises an expression vector containing a coding gene for a 4-coumaroyl-CoA ligase mutant and an expression vector containing a coding gene for a resveratrol synthase mutant, or wherein its genome integrates the coding genes for both the 4-coumaroyl-CoA ligase mutant and the resveratrol synthase mutant, wherein the amino acid sequence of the 4-coumaroyl-CoA ligase mutant is as shown in SEQ ID NO. The sequence shown in NO:1 is obtained by mutating in any of the following ways: Y260F / S328V / A330S / L333M / E338R, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V / G351S / G353C / L451F / F452D / I453V / L457M / L460M, or Y260F / S328V / A330S / L333M / E338R / L363A / A364S / S378P / C381V / G351S / G353C / L451F / F452D / I453V / L457M / L460M / I442V / K492P / E498Q, The amino acid sequence of the resveratrol synthase mutant is obtained by mutating the sequence shown in SEQ ID NO:2 at one or more amino acid residue sites selected from the group consisting of: E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S, or E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S / G252C / I254V / F265C / H 266D / L267M / W268L / P269K, or E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S / G252C / I254V / F265C / H266D / L267M / W268L / P269K / E203Q / D204T / A205H / S208C / N270D / T273G / S276D.

4. The recombinant genetically engineered bacteria according to claim 3, characterized in that: The recombinant genetically engineered strain is a high-resveratrol-producing *Yersinia lipophila* strain that fuses a 4-coumaroyl-CoA ligase mutant and a resveratrol synthase mutant.

5. A fusion protein obtained by linking the 4-coumaroyl-CoA ligase mutant of claim 1 and the resveratrol synthase mutant via a linker peptide, wherein the amino acid sequence of the resveratrol synthase mutant is obtained by mutating the sequence shown in SEQ ID NO:2 at one or more amino acid residue sites selected from the group consisting of: E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S, or E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S / G252C / I254V / F265C / H 266D / L267M / W268L / P269K, or E51D / K54E / N57K / I59M / D61Q / K62S / P307H / A312Q / V313I / A315S / G252C / I254V / F265C / H266D / L267M / W268L / P269K / E203Q / D204T / A205H / S208C / N270D / T273G / S276D.

6. The application of the genetically engineered bacteria according to claim 3 in the production of resveratrol.

Citation Information

Patent Citations

  • Engineering bacterium for synthesizing resveratrol by using p-coumaric acid, construction and application

    CN116875474A