Escherichia coli o157:h7 visual rapid detection system and its kit

By combining LAMP technology with a closed-tube detection system using calcein indicator, the problems of speed, accuracy, and economy in detecting Escherichia coli O157:H7 have been solved, achieving simplified operation and efficient detection, suitable for both on-site and batch testing.

CN116426656BActive Publication Date: 2026-06-19NANJING AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2023-03-09
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing technologies for detecting Escherichia coli O157:H7 involve cumbersome traditional methods with long detection cycles, and PCR methods require sophisticated equipment, making it difficult to achieve rapid and accurate detection. Furthermore, they are prone to cross-contamination and false positive results.

Method used

Using loop-mediated isothermal amplification (LAMP) technology, combined with a calcein visualization indicator, specific primers were designed to establish a closed-tube detection system. The detection results were judged by color change, simplifying the operation process and reducing cross-contamination.

Benefits of technology

It achieves rapid, accurate, and economical detection, significantly shortens the detection cycle, reduces the probability of false positives, is suitable for on-site and batch testing, has high sensitivity, good specificity, and strong anti-interference ability, and is suitable for actual inspection and testing work.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116426656B_ABST
    Figure CN116426656B_ABST
Patent Text Reader

Abstract

This invention provides a visual rapid detection system and kit for *Escherichia coli* O157:H7. Targeting the specific target gene of *E. coli* O157:H7, a loop-mediated isothermal amplification (LAMP) system was established using SYBR Green fluorescent indicator, and calcein was used as a visual indicator instead of the fluorescent indicator, thus establishing a visual LAMP technique for detecting *E. coli* O157:H7. This invention creatively establishes a new quantitative and visual LAMP detection technology that can accurately and rapidly identify *E. coli* O157:H7, possessing high specificity, high sensitivity, and anti-interference capabilities. Furthermore, the established visual LAMP detection system is assembled into a commercial kit, reducing detection steps, improving convenience, and meeting the needs of on-site and batch testing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of food safety testing technology, specifically relating to a visual rapid detection system for Escherichia coli O157:H7 and its reagent kit. Background Technology

[0002] Escherichia coli O157:H7, belonging to the genus Escherichia of the family Enterobacteriaceae, is the main pathogenic serotype of enterohemorrhagic Escherichia coli and one of the most common foodborne pathogens. It was isolated in 1975 from a patient with hemorrhagic colitis. Symptoms caused by E. coli O157:H7 are primarily non-hemorrhagic diarrhea, but severe cases can develop into hemorrhagic colitis and even death, particularly common in the elderly and those with weakened immune systems. Foodborne illnesses caused by E. coli O157:H7 are related to contaminated food and water. Currently, many areas lack clean drinking water and food; therefore, food safety issues caused by E. coli O157:H7 continue to threaten public health, and reports of E. coli O157:H7 infection have been reported from time to time in recent years. Early detection and control of E. coli O157:H7 in food and water are crucial for reducing disease outbreaks, ensuring public health, and avoiding economic losses. In recent years, researchers have developed and designed a variety of methods to control and detect Escherichia coli O157:H7.

[0003] In my country, traditional methods for detecting Escherichia coli O157:H7 mainly rely on the national standard GB-4789.36-2016. These methods require enrichment, selective culture, physiological and biochemical experiments, serotyping, and virulence gene identification. While accurate and reliable, these methods are cumbersome, time-consuming, and fail to achieve rapid detection. PCR methods require specialized equipment, limiting their widespread application. To address this issue, isothermal amplification techniques, such as LAMP, eliminate the need for temperature cycling, can be performed in simple temperature-controlled equipment, and offer short reaction times and good visualization, providing a simple and rapid method for detecting Escherichia coli O157:H7. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a visual rapid detection system and kit for Escherichia coli O157:H7. Compared to the LAMP method, which uses gel electrophoresis to determine test results, this invention enables closed-tube detection, reducing cross-contamination of samples, decreasing the probability of false positives, and eliminating the cumbersome electrophoresis procedure. Compared to the TaqMan probe method, it eliminates the need for synthesizing fluorescently modified probes, making it more economical. Compared to traditional national standard methods, the procedure is simpler, shortening the detection cycle and achieving rapid detection. Furthermore, it offers high accuracy and reliable results, demonstrating excellent performance in all aspects when applied to practical testing and inspection work. It can meet the practical needs of rapid, accurate, and efficient detection of Escherichia coli O157:H7, as well as the requirements for on-site and batch testing.

[0005] This invention provides a rapid detection method and kit for Escherichia coli O157:H7 based on calcein visual indicator. The detection results are evaluated based on the color change in the reaction tube after the reaction, making the method simple, easy to implement, and low-cost.

[0006] The technical solution adopted by this invention to solve its technical problem is:

[0007] In a first aspect, the present invention protects a visual rapid detection system for Escherichia coli O157:H7, which is established by means of the following method: targeting the Escherichia coli O157:H7 specific gene ECs_2840 screened in the laboratory, a loop-mediated isothermal amplification (LAMP) method is used to establish an initial reaction system with SYBR Green as a fluorescent indicator, and then a visual reaction system is established by replacing the fluorescent indicator with calcein indicator, so as to rapidly and accurately identify Escherichia coli O157:H7.

[0008] In a specific implementation plan, the method includes the following steps:

[0009] Step 1: Identify the target gene and design LAMP primers;

[0010] Step 2, Determining the initial LAMP architecture;

[0011] Step 3, LAMP method procedure optimization (e.g., primer ratio optimization, dNTP concentration optimization, Mg...) 2+ The concentration, amount of Bst3.0 DNA polymerase, and reaction temperature were optimized to determine the quantitative real-time LAMP amplification system.

[0012] Step 4: Determination of the sensitivity of quantitative real-time LAMP (qLP) technology;

[0013] Step 5: Visual exploration (e.g., visual indicator preparation, visual LAMP reaction time optimization) to determine the visual LAMP amplification system.

[0014] In the specific implementation plan, the LAMP primer sequences are as follows:

[0015] F3: 5'–GGTTATATTTATGACTTTCACACTG–3', as shown in SEQ ID No: 1;

[0016] B3: 5'–AGCGAACCATTTTAATTGAGG–3', as shown in SEQ ID No: 2;

[0017] FIP: 5'–TGTTAGCGCAATTGACATCAATTTACTATCCTTCATTTTTTAGTAAGCG–3’, as shown in SEQ ID No: 3;

[0018] BIP: 5'–ATGCACATTCAGTTATTACCGATGCGCATGGACTAAATGGAAGAG–3', as shown in SEQ ID No: 4;

[0019] LF: 5'–AACACATTCCTTTGATCTATT–3', as shown in SEQ ID No: 5;

[0020] LB: 5'–GGGATTATTCTGCAAAACTAC–3', as shown in SEQ ID No: 6.

[0021] In a specific implementation scheme, the final LAMP amplification system composition determined by this invention is as follows: a 25 μL amplification system is used, including 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×Isothermal Amplification Buffer 2.5 μL, Bst 3.0 DNA polymerase final concentration 0.32 U / μL, 2 μL DNA template, 20×SYBRGreen 1 μL for quantitative real-time LAMP assay, add water to make up to 25 μL; for visual LAMP assay, add calcein-manganese chloride indicator 1 μL, add water to make up to 25 μL.

[0022] In a specific implementation plan, the amplification procedure of the LAMP detection system determined by the present invention is as follows: the quantitative fluorescence LAMP reaction procedure is: react at 65°C for 1 hour, and collect fluorescence signals once every 1 minute; the visualization LAMP reaction procedure is: react at 65°C for 40 minutes.

[0023] In the specific implementation plan, (1) when the fluorescence quantitative LAMP reaction is completed, if the detection result has an amplification curve and the Times value does not exceed 30, the detection result can be judged as positive; otherwise, it is negative; (2) when the visual LAMP reaction is completed, if the color in the reaction tube changes from orange-yellow to green, the detection result can be judged as positive; otherwise, it is negative.

[0024] For quantitative real-time LAMP assays, the detection sensitivity is 8.8 × 10⁻⁶ when bacterial culture is used as a template. 0 CFU / mL; when using the genome as a template, the detection sensitivity is 4.61 fg / μL.

[0025] Compared to the LAMP method, which uses gel electrophoresis to determine test results, it can achieve closed-tube detection, reducing cross-contamination of samples, decreasing the probability of false positive results, and eliminating the cumbersome operation of electrophoresis detection; compared to the TaqMan probe method, it does not require the synthesis of fluorescent groups to modify probes, making it more economical; compared to the traditional national standard method, the steps are simpler, the detection cycle is shortened, and it can achieve the purpose of rapid detection, while being highly accurate and reliable.

[0026] Based on the aforementioned detection system, this invention establishes a novel rapid detection kit for visual LAMP, which exhibits excellent performance in all aspects when applied to actual testing and inspection work. It can meet the actual needs of rapid, accurate, and efficient detection of Escherichia coli O157:H7, as well as the detection requirements for on-site and batch testing.

[0027] Secondly, this invention first protects a primer for detecting Escherichia coli O157:H7 using LAMP technology, wherein the primer targets the gene ECs_2840, and the sequence is:

[0028] F3: 5'–GGTTATATTTATGACTTTCACACTG–3', as shown in SEQ ID No: 1;

[0029] B3: 5'–AGCGAACCATTTTAATTGAGG–3', as shown in SEQ ID No: 2;

[0030] FIP: 5'–TGTTAGCGCAATTGACATCAATTTACTATCCTTCATTTTTTAGTAAGCG–3’, as shown in SEQ ID No: 3;

[0031] BIP: 5'–ATGCACATTCAGTTATTACCGATGCGCATGGACTAAATGGAAGAG–3',

[0032] As shown in SEQ ID No: 4;

[0033] LF: 5'–AACACATTCCTTTGATCTATT–3', as shown in SEQ ID No: 5;

[0034] LB: 5'–GGGATTATTCTGCAAAACTAC–3', as shown in SEQ ID No: 6.

[0035] Thirdly, the present invention protects a detection reagent or kit for Escherichia coli O157:H7, wherein the reagent or kit contains the primer set as described in claim 1.

[0036] In a specific implementation plan, the following steps are required when assembling the kit: (1) kit assembly; (2) kit sensitivity assessment; (3) kit specificity assessment; (4) kit anti-interference performance assessment; (5) kit stability assessment (reproducibility); (6) kit artificial contamination test.

[0037] In a more specific embodiment, the present invention protects a detection kit for Escherichia coli O157:H7, the kit employing a LAMP amplification system, comprising 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10× Isothermal Amplification Buffer 2.5 μL, Bst 3.0 DNA polymerase final concentration 0.32 U / μL, indicator 1 μL, DNA template 2 μL, add water to make up to 25 μL.

[0038] Preferably, the kit is a real-time fluorescence kit, employing a real-time fluorescence LAMP amplification system, including 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×Isothermal Amplification Buffer 2.5 μL, Bst 3.0 DNA polymerase final concentration 0.32 U / μL, 20×SYBR Green 1 μL, 2 μL DNA template, add water to make up to 25 μL.

[0039] More preferably, the quantitative fluorescence LAMP reaction procedure is as follows: the amplification procedure is: react at 65°C for 1 hour, and collect the fluorescence signal once every 1 minute.

[0040] Preferably, the kit is a visualization kit, employing a visualization LAMP amplification system, including 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10× Isothermal Amplification Buffer 2.5 μL, Bst 3.0 DNA polymerase final concentration 0.32 U / μL, calcein-manganese chloride indicator 1 μL, DNA template 2 μL, add water to make up to 25 μL.

[0041] More preferably, the visualized LAMP reaction procedure is: reaction at 65°C for 40 minutes.

[0042] Fourthly, this invention protects the primer sets described above, or any of the detection reagents or kits described above, in any of the following applications:

[0043] (1) Application in the detection of Escherichia coli O157:H7 or in the preparation of products for the detection of Escherichia coli O157:H7;

[0044] (2) Application in the preparation of products for the diagnosis or auxiliary diagnosis of diseases caused by Escherichia coli O157:H7 infection;

[0045] (3) Application in the prevention and control of Escherichia coli O157:H7.

[0046] In the performance evaluation of the kit, sensitivity analysis revealed that the detection sensitivity for visual LAMP was 4.61 fg / μL when using the genome as a template, and 2.35 × 10⁻⁶ fg / μL when using bacterial culture as a template. 0 CFU / mL. For the specific detection of the kit, a total of 14 bacterial strains were used, including 5 strains of *Escherichia coli* O157:H7 and 9 strains of common foodborne pathogens outside the genus. Only the reaction tube containing *Escherichia coli* O157:H7 changed color from orange-yellow to green; the remaining strains remained orange-yellow throughout the reaction time. Interference resistance analysis showed that even at 10... 6 Even in the presence of non-target strains, 10 CFU / mL can still be detected. 3CFU / mL of E. coli O157:H7 gene. Stability assessment concluded that, at the same bacterial concentration, all three kits constructed at the same time and three kits constructed at different times could detect E. coli O157:H7, indicating good kit stability. Furthermore, artificial contamination experiments showed that the initial contamination level before enrichment was 2.26 × 10⁻⁶. 1 The kit can detect samples with CFU / mL and above. Enrichment culture for 3 hours and 6 hours yielded 2.26 × 10⁻⁶ CFU / mL. 0 CFU / mL, 2.26×10 -1 Milk samples with initial contamination levels of CFU / mL can be detected, demonstrating the good practical application performance of the kit.

[0047] Beneficial effects

[0048] This invention offers the following advantages: The detection method of this invention can directly identify *Escherichia coli* O157:H7. In the detection of *E. coli* O157:H7, a one-step LAMP reaction is established by combining the fluorescent dye SYBR Green or the visual indicator calcein with LAMP, avoiding the need for opening the tube after the LAMP reaction, reducing cross-contamination, and decreasing the probability of false positives. The kit established based on the visual detection system exhibits high accuracy and specificity in detecting *E. coli* O157:H7; the color in the reaction tube changes from orange-yellow to green only when the *E. coli* O157:H7 gene is used as a template. The detection kit has good sensitivity; when the genome is used as a template, the detection sensitivity is 4.61 fg / μL; when bacterial culture is used as a template, the detection sensitivity is 2.35 × 10⁻⁶. 0 CFU / mL. The kit has strong anti-interference properties, at 10 6 Even in the presence of interfering bacteria at CFU / mL, 10 can still be detected. 3 The target bacteria concentration was CFU / mL. Furthermore, the kit exhibited good reproducibility and strong freeze-thaw stability, detecting an initial contamination level of 2.26 × 10⁻⁶ CFU / mL in artificial contamination tests before enrichment. 1 The target bacteria concentration was CFU / mL, and after 3 hours of enrichment, the initial contamination level was 2.26 × 10⁻⁶. -1 The kit can detect milk samples at CFU / mL, demonstrating good practical application performance and significant value. It eliminates the need for traditional biochemical or serological tests, shortening reaction time to within 6 hours and reducing costs. The established detection system and kit provide simple and reliable results, meeting the testing needs of most laboratories. Attached Figure Description

[0049] Figure 1 The results of primer ratio optimization;

[0050] Figure 2 Mg 2+ Concentration optimization results;

[0051] Figure 3 Optimization results for dNTP concentration;

[0052] Figure 4 Results of optimizing the amount of Bst 3.0 DNA polymerase added;

[0053] Figure 5 For the evaluation of the sensitivity of bacterial culture in quantitative real-time LAMP technology;

[0054] Figure 6 To evaluate the genomic sensitivity of quantitative real-time LAMP technology;

[0055] Figure 7 To visualize the optimization of LAMP detection time, where A represents a reaction time of 20 minutes, B represents a reaction time of 30 minutes, C represents a reaction time of 40 minutes, D represents a reaction time of 50 minutes, and E represents a reaction time of 60 minutes; for example... Figure 7 As shown, A: Both tubes are orange-yellow; B: Left is orange-yellow, right is light green; C: Left is orange-yellow, right is green; D: Left is orange-yellow, right is green; E: Left is orange-yellow, right is green.

[0056] Figure 8 To visualize the bacterial suspension sensitivity results of the LAMP kit, from left to right, 1-11 represent NK, 2.35×10⁻⁶, and 2.35×10⁻⁶, respectively. 7 CFU / mL -2.35×10 -2 CFU / mL; such as Figure 8 As shown, 1, 10, and 11 are orange-yellow; 2-9 are green.

[0057] Figure 9 To visualize the genome sensitivity results of the LAMP kit, numbers 1-11 from left to right represent NK, 46.1 ng / μL, and 46.1 ag / μL, respectively; Figure 9 As shown, 1, 10, and 11 are orange-yellow; 2-9 are green.

[0058] Figure 10 To visualize the LAMP kit specificity test results, 1-14 correspond to 1-14 in Table 5, where 1-9 are common foodborne pathogens, and 10-14 are Escherichia coli O157:H7 serotypes; For example Figure 10 As shown, 1-9 are orange-yellow, and 10-14 are green;

[0059] Figure 11 To visualize the anti-interference test results of the LAMP kit, in A, 1 represents NK and 2-8 represent concentrations of N×10⁻⁸.6 -N×10 0 CFU / mL interfering bacterial mixture is mixed with an equal volume of sterile water. In section B, 1-7 represent concentrations of N×10⁻⁶. 6 -N×10 0 The CFU / mL interfering bacterial mixture was mixed with an equal volume of the target bacteria, and then an equal volume of sterile water was mixed with the target bacteria; for example... Figure 11 As shown, A: 1-8 are all orange-yellow; B: 1-8 are all green.

[0060] Figure 12 To visualize the repeatability test results of the LAMP kit, where AC represents NK and 2.35 × 10⁻⁶, respectively. 7 CFU / mL, 2.35×10 4 CFU / mL; 1-6 are 11281, 11291, 11301, 12011, 12012, 12013 respectively; such as Figure 12 As shown, A: 1-6 are all orange-yellow; B: 1-6 are all green; C: 1-6 are all green.

[0061] Figure 13 To visualize the results of the artificial contamination test on the LAMP kit, AC represents 0h, 3h, and 6h of incubation, respectively; 1-6 represent the initial contamination amount of 2.26×10⁻⁶. 4 CFU / mL -2.26×10 -1 CFU / mL; such as Figure 13 As shown, A: NK, 5, and 6 are orange-yellow, and 1-4 are green; B: NK is orange-yellow, and 1-6 are green; C: NK is orange-yellow, and 1-6 are green. Detailed Implementation

[0062] The present invention will be further described below with reference to the embodiments. The experimental methods in the following embodiments, unless otherwise specified, are generally carried out in accordance with known means in the art or according to the manufacturer's recommended conditions. The strains involved in the embodiments are all prior art and can be easily obtained by those skilled in the art from public commercial channels.

[0063] 1. Initial LAMP architecture determined

[0064] Using Escherichia coli O157:H7 as the target gene (ECs_2840, a laboratory-screened target), primers were designed using software, resulting in four sets of primers. Primer information is shown in Table 1. A 25 μL reaction system was used, with the following composition: outer primers (F3 and B3) 0.2 μM each, inner primers (FIP and BIP) 0.8 μM each, loop primers (LF and LB) 0.4 μM each, dNTPs final concentration 1.4 mM, and Mg... 2+Final concentration 6.0 mM, 10×Isothermal Amplification Buffer 2.5 μL, Bst3.0 DNA polymerase final concentration 0.32 U / μL, 20×SYBR Green 1 μL, 2 μL DNA template, add water to make up to 25 μL; System composition without circular primers: outer primers (F3 and B3) 0.2 μM each, inner primers (FIP and BIP) 1.6 μM each, dNTPs final concentration 1.4 mM, Mg 2+ The final concentration was 6.0 mM, with 2.5 μL of 10×Isothermal Amplification Buffer, a final concentration of 0.32 U / μL of Bst 3.0 DNA polymerase, 1 μL of 20×SYBR Green, and 2 μL of DNA template. Water was added to bring the total volume to 25 μL. The reaction conditions were 65℃ for 1 hour, with fluorescence signals collected every minute. The optimal primer set (primer set 1) was determined based on the lowest possible Time value and the smallest possible false positive results. The system for quantitative real-time LAMP detection was then optimized using this optimal primer set.

[0065] 2. Establishment of a fluorescence quantitative LAMP detection method based on fluorescent dyes

[0066] 2.1 Optimization of the Real-Time LAMP Amplification System

[0067] Starting with the optimal primer composition obtained in step 1, the primer ratio, dNTP concentration, and Mg content of the system were adjusted respectively. 2+ The concentration, amount of Bst 3.0 DNA polymerase added, and reaction temperature were optimized.

[0068] Primer ratio optimization: Keeping other conditions constant, the primer ratio in the quantitative real-time LAMP reaction system was optimized. The concentration of the loop primers was fixed, the outer primer concentration remained constant, and the concentration of the inner primers was continuously varied to achieve inner-to-outer primer ratios of 4:1, 5:1, 6:1, 7:1, 8:1, and 9:1. The optimal primer ratio was determined by analyzing the Times values ​​of the amplification curves. Results are as follows: Figure 1 As shown, when using different ratios of inner and outer primers, the amplification curves almost overlapped, and the Times values ​​showed no significant difference (P<0.05). Since the primer concentration ratio in the initial system was 4:1, the initial ratio of 4:1 was kept constant.

[0069] dNTP concentration optimization: Keeping other conditions constant, the dNTP concentration in the quantitative PCR reaction system was optimized. The final dNTP concentrations were adjusted to 1 mmol / L, 1.2 mmol / L, 1.4 mmol / L, 1.6 mmol / L, 1.8 mmol / L, and 2 mmol / L. The optimal dNTP concentration was determined by analyzing the Times value of the amplification curve. Results are as follows... Figure 2 As shown, insufficient or excessive substrate concentration will affect the detection results. When the concentration is 1.2 mmol / L, the minimum time value is 6.58. Therefore, 1.2 mmol / L dNTPs is selected as the optimal amount for LAMP reaction.

[0070] Mg 2+ Concentration optimization: keeping other conditions constant, the concentration of Mg in the quantitative PCR LAMP reaction system was optimized. 2+ Concentration was optimized, and Mg was adjusted. 2+ The optimal Mg concentration was determined by analyzing the Time values ​​of the amplification curves at concentrations of 3 mmol / L, 4 mmol / L, 5 mmol / L, 6 mmol / L, 7 mmol / L, and 8 mmol / L. 2+ Concentration. Results as follows: Figure 3 As shown, with Mg 2+ As the concentration increased, the Time values ​​gradually decreased, especially at concentrations of 6, 7, and 8 mmol / L Mg. 2+ The differences in Time values ​​at different concentrations were not significant (p<0.05). Considering Mg... 2+ Too high a concentration will affect enzyme performance; therefore, a concentration of 6 mmol / L Mg is recommended. 2+ As the optimal amount to add.

[0071] Optimization of Bst 3.0 DNA polymerase dosage: Keeping other conditions constant, the dosage of Bst 3.0 DNA polymerase in the quantitative real-time LAMP reaction system was optimized. The dosage was adjusted to 0.4 μL, 0.6 μL, 0.8 μL, 1 μL, 1.2 μL, and 1.4 μL. The optimal dosage was determined by analyzing the Times value of the amplification curve. The results are as follows... Figure 4 As shown, when other conditions remain unchanged, there is no significant difference between the different Time values ​​when only the amount of enzyme added is changed (P<0.05). Since the amount of enzyme added under the initial conditions is 1 μL, maintaining the amount of enzyme added at 1 μL is optimal.

[0072] 2.2 Optimization of Real-Time LAMP Amplification System Conditions

[0073] Optimization of reaction temperature: With other conditions unchanged, the reaction temperature in the quantitative real-time LAMP method was adjusted. Six temperature gradients were selected: 60℃, 61℃, 62℃, 63℃, 64℃, and 65℃. The optimal reaction temperature was determined by analyzing the Times value of the amplification curve. The results are shown in Table 2. It can be seen that the Times value is the smallest at 65℃, so 65℃ is selected as the optimal reaction temperature.

[0074] 2.3 The optimal system for quantitative real-time LAMP is as follows: The quantitative real-time LAMP system (25 μL) includes 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+ The final concentration was 6.0 mM, with 2.5 μL of 10×Isothermal Amplification Buffer, a final concentration of 0.32 U / μL of Bst 3.0 DNA polymerase, 1 μL of 20×SYBR Green, and 2 μL of DNA template. Water was added to bring the total volume to 25 μL. The amplification program was as follows: incubation at 65°C for 1 hour, with fluorescence signals collected every minute.

[0075] 3. Sensitivity evaluation of quantitative real-time LAMP

[0076] 3.1 Evaluation of bacterial suspension sensitivity

[0077] Colony counting was performed on overnight cultured E. coli O157:H7. The known initial concentration of E. coli O157:H7 bacterial suspension was serially diluted 10-fold to 10-fold. -8 For each concentration gradient, 1 mL of genomic DNA was extracted and then detected. Three replicates were set up for each concentration to obtain the lowest detection limit of the real-time quantitative LAMP technique.

[0078] Plate counting was performed on groups using bacterial suspensions as templates. The results showed that the concentration of *E. coli* O157:H7 (ATCC 43889) cultured overnight at 37℃ and 180 rpm was 8.8 × 10⁻⁶. 7 CFU / mL. From Figure 5 The results show that when bacterial concentration is used as the evaluation standard, the detection sensitivity is 8.8 × 10⁻⁶. 0 CFU / mL.

[0079] 3.2 Evaluation of Genomic Sensitivity

[0080] The genome of *E. coli* O157:H7 was extracted and its concentration was measured. Genome samples of known concentrations were serially diluted 10-fold to 10⁻⁸. The diluted bacterial solutions were used as templates for detection, with three replicates for each concentration. The limit of detection (LOD) for quantitative real-time LAMP (qLAM) was determined. Results are as follows: Figure 6As shown, the detection sensitivity is 4.61 fg / μL when the genome is used as a template.

[0081] 4. Research on Visualized LAMP Detection Technology

[0082] 4.1 Establishment of a Visualized LAMP System and Optimization of Reaction Conditions

[0083] The visualization LAMP system is basically the same as the quantitative real-time LAMP system, except that the SYBR Green dye in the quantitative real-time LAMP system is replaced with a visualization indicator instead of the fluorescence indicator calcein-manganese chloride, as follows:

[0084] The outer primers (F3 and B3) were each 0.2 μM, the inner primers (FIP and BIP) were each 0.8 μM, the loop primers (LF and LB) were each 0.4 μM, the final concentration of dNTPs was 1.2 mM, and Mg... 2+ Final concentration 6.0 mM, 10× Isothermal Amplification Buffer 2.5 μL, Bst 3.0 DNA polymerase final concentration 0.32 U / μL, calcein-manganese chloride mixed indicator 1 μL, DNA template 2 μL, water added to make up to 25 μL. Initial reaction conditions: 65℃ for 1 hour, observe color change after reaction.

[0085] Reaction time optimization: With other conditions unchanged, adjust the reaction time in the visualization LAMP method, selecting times of 20 minutes, 30 minutes, 40 minutes, 50 minutes, and 60 minutes; determine the optimal reaction time by comparing color differences. From Figure 7 The results show that the optimal conditions for visualizing the LAMP reaction are: 65°C for 40 minutes.

[0086] 5. Visualization of LAMP rapid detection kit and related performance evaluation

[0087] 5.1 Visualization of LAMP Rapid Detection Kit Assembly and Result Interpretation

[0088] The visualized LAMP system (25 μL) included 0.2 μM each of outer primers (F3 and B3), 0.8 μM each of inner primers (FIP and BIP), 0.4 μM each of loop primers (LF and LB), a final concentration of 1.2 mM dNTPs, and Mg... 2+The final concentration was 6.0 mM, with 2.5 μL of 10× Isothermal Amplification Buffer, a final concentration of Bst 3.0 DNA polymerase of 0.32 U / μL, 1 μL of calcein-manganese chloride indicator, and 2 μL of DNA template. Water was added to make up to 25 μL. The composition of the LAMP system is shown in Table 3. The amplification program was: 65℃ for 40 minutes, and the color change of the reaction tube was observed after the reaction.

[0089] The kit composition is shown in Table 4, including 50 premixed solutions. Each solution contains 2.5 μL of 10×Isothermal Amplification Buffer, 3 μL of dNTPs (10 mM), 1.5 μL of MgSO4 (100 mM), 0.5 μL each of outer primers F3 and B3 (10 μM), 2 μL each of inner primers FIP and BIP (10 μM), and 1 μL each of loop primers LF and LB (10 μM), totaling 700 μL. It also contains 1 μL of Bst 3.0 DNA polymerase for each of the 50 solutions, totaling 50 μL. Additionally, it contains 0.5 μL each of 1.25 mM calcein and 25 mM manganese chloride for each of the 50 solutions, totaling 25 μL. A blank control (sterile ultrapure water), a positive control (E. coli O157:H7 genomic DNA), and a negative control (Listeria monocytogenes genomic DNA) are also included. The visualization LAMP reaction system is 25 μL: Before starting, calcein and manganese chloride are mixed in equal volumes to prepare an indicator. Take 14 μL of the premix, 1 μL of Bst 3.0 DNA polymerase, 1 μL of calcein-manganese chloride mixed indicator, and 2 μL of the genomic DNA of the sample to be tested into each reaction tube, and then add sterile purified water to 25 μL.

[0090] The reaction temperature was set to 65℃, and the reaction time was 40 minutes. After the reaction, the color change in the reaction tube was observed to determine the test result. If the color in the sample tube changed from orange-yellow to green, while the color in the blank control tube remained unchanged at orange-yellow, the test result was considered positive. If both the sample tube and the blank control tube remained orange-yellow, the test result was considered negative, and *E. coli* O157:H7 was not detected.

[0091] 5.2 Visual Performance Evaluation of LAMP Reagent Kit

[0092] 5.2.1 Sensitivity Evaluation of Visualized LAMP Kits

[0093] 5.2.1.1 Sensitivity detection of bacterial suspension

[0094] Colony counting was performed on overnight cultured E. coli O157:H7. The known initial concentration of E. coli O157:H7 bacterial suspension was serially diluted 10-fold to 10-fold. -10After extracting 1 mL of genome at each concentration gradient, the genome was detected using the constructed kit. Three replicates were set up for each concentration to obtain the limit of detection of the kit.

[0095] Plate counting was performed on groups using bacterial suspensions as templates. The results showed that the concentration of *E. coli* O157:H7 (ATCC 43889) cultured overnight at 37℃ and 180 rpm was 2.35 × 10⁻⁶. 7 CFU / mL. The test results are as follows: Figure 8 As shown, when using bacterial concentration as the evaluation standard, a concentration of 2.35 × 10⁻⁶ is used. 7 CFU / mL -2.35×10 0 When using CFU / mL bacterial culture as a template, the reaction tube will be green; for blank and 2.35×10⁻⁶ CFU / mL bacterial culture, the reaction tube will be green. 0 The reaction tubes with concentrations below CFU / mL retain their orange-yellow color, therefore the detection sensitivity is 2.35 × 10⁻⁶. 0 CFU / mL.

[0096] 5.2.1.2 Genomic Sensitivity Detection

[0097] Genome samples were extracted from E. coli O157:H7 and their concentration was measured. Genome samples with known concentrations were serially diluted 10-fold to 10⁻⁶. -10 The obtained diluted bacterial cultures were used as templates in the constructed kit for detection, with three replicates for each concentration, to obtain the limit of detection of the kit. Results are shown below. Figure 9 When the genome is used as a template, the genome concentration is 46.1 ng / μL-4.61 fg / μL, and the reaction tube color is green. The blank reaction tube and the reaction tube with a genome concentration of 4.61 fg / μL remain orange-yellow. Therefore, the detection sensitivity is 4.61 fg / μL.

[0098] 5.2.2 Visual evaluation of LAMP kit specificity

[0099] Using Escherichia coli O157:H7 and non-Escherichia coli O157:H7 genomic DNA as templates (test strains are shown in Table 5), the constructed kit was used for detection, and the specificity of the kit was evaluated.

[0100] After testing, from Figure 10 The results showed that all 5 strains of Escherichia coli O157:H7 were detected, while all 9 strains of non-Escherichia coli O157:H7 were not detected.

[0101] 5.2.3 Visualization of LAMP Reagent Kit Anti-interference Test

[0102] The target bacteria of Escherichia coli O157:H7 was diluted to 3.9 × 10⁻⁶. 3CFU / mL, Staphylococcus aureus, Listeria monocytogenes, Salmonella enteritidis, and Shigella flexneri were diluted to N×10⁻⁶. 6 CFU / mL-N×10 0 CFU / mL (strain plate count results are shown in Table 6). To verify whether the visualization LAMP kit has a certain anti-interference ability in the detection of Escherichia coli O157:H7, non-E. coli O157:H7 were mixed in equal volumes, with a total bacterial count of N×10⁻⁶. 0 CFU / mL, N×10 1 CFU / mL, N×10 2 CFU / mL, N×10 3 CFU / mL, N×10 4 CFU / mL, N×10 5 CFU / mL, N×10 6 CFU / mL, then with 3.9 × 10 3 An equal volume of CFU / mL Escherichia coli O157:H7 was mixed, and genomic DNA was extracted from the mixed bacterial culture for detection to determine the kit's ability to detect the Escherichia coli O157:H7 gene in the presence of other contaminating bacteria.

[0103] After testing, by Figure 11 -B indicates that even if 10 is mixed in... 6 Non-target bacteria such as Staphylococcus aureus, Listeria monocytogenes, Salmonella enteritidis, and Shigella flexneri, other than Escherichia coli O157:H7, can also be detected at 10 CFU / mL. 3 When the CFU / mL E. coli O157:H7 gene was present, the sample tube color changed from orange-yellow to green. However, when seven different concentrations of interfering bacteria were mixed with equal volumes of sterile water, the color of each tube remained orange-yellow. Figure 11 -A.

[0104] 5.2.4 Visualization of LAMP Reagent Kit Stability Evaluation

[0105] 5.2.4.1 Repeatability Assessment

[0106] The repeatability assessment of the kit is divided into inter-batch repeatability assessment and intra-batch repeatability assessment, and the steps are as follows:

[0107] Three kits prepared at different times were named 11281, 11291, and 11301. The kits were used to detect target genes at different concentrations. The batch-to-batch reproducibility of the kits was evaluated based on the color change of the reaction tubes.

[0108] Three kits produced at the same time were named 12011, 12012, and 12013. The kits were used to detect different concentrations of the target gene, and the intra-batch reproducibility of the kits was evaluated based on the color change of the reaction tubes.

[0109] Repeatability test results as follows Figure 12 As shown. Whether the three kits were prepared at the same time or at different times, for different concentrations of bacterial suspension (A is the blank control, B is 2.35 × 10⁻⁶), 7 CFU / mL, C = 2.35 × 10 4 The kit could detect the CFU / mL sample, and the color of the sample tube changed from orange-yellow to green, indicating good reproducibility of the kit.

[0110] 5.2.5 Visualization of LAMP Reagent Kit Artificial Contamination Test

[0111] The known initial concentration of Escherichia coli O157:H7 bacterial suspension was serially diluted 10-fold to 10-fold. 0 CFU / mL. A concentration of 10 was selected. 5 -10 0 10 mL each of CFU / mL bacterial culture and sterile water were added to 90 mL of milk and homogenized to obtain artificially contaminated milk samples and blank controls. At this point, the bacterial concentrations were 10... 4 -10 -1 CFU / mL. 25 mL of homogenized milk was mixed with 225 mL of mEc+n broth and homogenized again. The mixture was then incubated at 37°C and 180 rpm for 24 hours. 1 mL of bacterial culture was collected at 0, 3, and 6 hours of incubation. Genomic DNA was extracted using the boiling method and detected using a kit. The experimental results were determined by color changes.

[0112] The bacterial concentration was 2.26 × 10⁻⁶. 8 CFU / mL. The test results are as follows: Figure 13 As shown, the initial contamination level before enrichment was 2.26 × 10⁻⁶. 1 For samples with CFU / mL or higher, the test tube turns green, indicating an initial contamination level of 2.26 × 10⁻⁶. 1 Samples with concentrations below CFU / mL turned orange-yellow, consistent with the control. Enrichment cultures were performed for 3 hours and 6 hours, yielding 2.26 × 10⁻⁶ cells / mL. 0 CFU / mL, 2.26×10 -1 Milk samples with an initial contamination level of CFU / mL were all detectable, and the test tubes turned green, indicating that the kit performed well in practical applications.

[0113] Appendix:

[0114] Table 1 LAMP primer sequences

[0115]

[0116] Table 2 Visualizes LAMP reaction temperature optimization

[0117]

[0118]

[0119] Table 3 Visualization of LAMP reaction system

[0120]

[0121] Table 4 Visualizes the composition of the LAMP kit (50T)

[0122]

[0123] a: Includes F3 / B3, FIP / BIP, LF / LB, dNTPs, MgSO4, and 10×Isothermal Amplification Buffer; b: Store in a brown EP tube protected from light.

[0124] c: Positive control

[0125] d: Negative control

[0126] Table 5. Visualization of LAMP reagent kit specificity test results

[0127]

[0128] a: "+" indicates a positive test result, and "-" indicates a negative test result.

[0129] Table 6. Results of strain plate counts

[0130]

[0131]

[0132] It is understood that the above embodiments are merely exemplary implementations used to illustrate the principles of the invention. However, the present invention is not limited thereto. Those skilled in the art can make various improvements and modifications without departing from the essence of the present invention, and these improvements and modifications also fall within the protection scope of the present invention.

Claims

1. A visual rapid detection system for Escherichia coli O157:H7, characterized in that, The detection system was established by the following method: LAMP primers were designed for the Escherichia coli O157:H7 specific gene ECs_2840, and a fluorescence quantitative LAMP amplification system was established using loop-mediated isothermal amplification with SYBR Green as the fluorescent indicator. Then, a visual LAMP amplification system was established by replacing the fluorescent indicator with calcein to identify Escherichia coli O157:H7. The sequence of the LAMP primers is as follows: F3: 5'–GGTTATATTTATGACTTTCACACTG–3', as shown in SEQ ID No: 1; B3: 5'–AGCGAACCATTTTAATTGAGG–3', as shown in SEQ ID No: 2; FIP: 5'–TGTTAGCGCAATTGACATCAATTTACTATCCTTCATTTTTTAGTAAGCG–3', as shown in SEQ ID No: 3; BIP: 5'–ATGCACATTCAGTTATTACCGATGCGCATGGACTAAATGGAAGAG–3', as shown in SEQ ID No: 4; LF: 5'–AACACATTCCTTTGATCTATT–3', as shown in SEQ ID No: 5; LB: 5'–GGGATTATTCTGCAAAACTAC–3', as shown in SEQ ID No:

6.

2. The visual rapid detection system for Escherichia coli O157:H7 according to claim 1, characterized in that, The quantitative real-time LAMP amplification system includes 0.2 µM each of outer primers F3 and B3, 0.8 µM each of inner primers FIP and BIP, 0.4 µM each of loop primers LF and LB, a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×IsothermalAmplification Buffer 2.5 µL, Bst 3.0 DNA polymerase final concentration 0.32 U / µL, 20×SYBR Green 1 µL, 2 µL DNA template, add water to make up to 25 µL.

3. The visual rapid detection system for Escherichia coli O157:H7 according to claim 2, characterized in that, The quantitative fluorescence LAMP reaction procedure is as follows: the amplification program is: react at 65℃ for 1 hour, and collect the fluorescence signal once every 1 minute.

4. The visual rapid detection system for Escherichia coli O157:H7 according to claim 1, characterized in that, The visualized LAMP amplification system includes 0.2 µM each of outer primers F3 and B3, 0.8 µM each of inner primers FIP and BIP, 0.4 µM each of loop primers LF and LB, a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×IsothermalAmplification Buffer 2.5 µL, Bst 3.0 DNA polymerase final concentration 0.32 U / µL, calcein-manganese chloride indicator 1 µL, 2 µL DNA template, add water to make up to 25 µL.

5. The visual rapid detection system for Escherichia coli O157:H7 according to claim 4, characterized in that, Visualization of LAMP reaction program: The amplification program is: 65℃ reaction for 40 minutes.

6. A primer for detecting Escherichia coli O157:H7, characterized in that, The primers were designed to target the gene ECs_2840, and the primer sequences are as follows: F3: 5'–GGTTATATTTATGACTTTCACACTG–3', as shown in SEQ ID No: 1; B3: 5'–AGCGAACCATTTTAATTGAGG–3', as shown in SEQ ID No: 2; FIP: 5'–TGTTAGCGCAATTGACATCAATTTACTATCCTTCATTTTTTAGTAAGCG–3', as shown in SEQ ID No: 3; BIP: 5'–ATGCACATTCAGTTATTACCGATGCGCATGGACTAAATGGAAGAG–3', as shown in SEQ ID No: 4; LF: 5'–AACACATTCCTTTGATCTATT–3', as shown in SEQ ID No: 5; LB: 5'–GGGATTATTCTGCAAAACTAC–3', as shown in SEQ ID No:

6.

7. A detection reagent or kit for Escherichia coli O157:H7, characterized in that, The reagent or kit contains the primer set as described in claim 6.

8. The detection kit for Escherichia coli O157:H7 according to claim 7, characterized in that, The kit uses a LAMP amplification system, including 0.2 µM each of outer primers F3 and B3, 0.8 µM each of inner primers FIP and BIP, 0.4 µM each of loop primers LF and LB, a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×Isothermal Amplification Buffer 2.5 µL, Bst 3.0 DNA polymerase final concentration 0.32 U / µL, indicator 1 µL, DNA template 2 µL, add water to make up to 25 µL.

9. The detection kit for Escherichia coli O157:H7 according to claim 8, characterized in that, The kit described is a real-time fluorescence kit, employing a real-time fluorescence LAMP amplification system, including 0.2 µM each of outer primers F3 and B3, 0.8 µM each of inner primers FIP and BIP, 0.4 µM each of loop primers LF and LB, a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×Isothermal Amplification Buffer 2.5 µL, Bst 3.0 DNA polymerase final concentration 0.32 U / µL, 20×SYBR Green 1 µL, 2 µL DNA template, add water to make up to 25 µL.

10. The detection kit for Escherichia coli O157:H7 according to claim 9, characterized in that, The quantitative fluorescence LAMP reaction procedure is as follows: the amplification program is: react at 65℃ for 1 hour, and collect the fluorescence signal once every 1 minute.

11. The detection kit for Escherichia coli O157:H7 according to claim 8, characterized in that, The kit employs a visual LAMP amplification system, including 0.2 µM each of outer primers F3 and B3, 0.8 µM each of inner primers FIP and BIP, 0.4 µM each of loop primers LF and LB, a final concentration of 1.2 mM dNTPs, and Mg... 2+ Final concentration 6.0 mM, 10×IsothermalAmplification Buffer 2.5 µL, Bst 3.0 DNA polymerase final concentration 0.32 U / µL, calcein-manganese chloride indicator 1 µL, 2 µL DNA template, add water to make up to 25 µL.

12. The detection kit for Escherichia coli O157:H7 according to claim 11, characterized in that, The LAMP reaction procedure for visualization is: reaction at 65°C for 40 minutes.

13. The primer of claim 6 or the detection reagent or kit of any one of claims 7-12, in any of the following applications: (1) Application in the detection of Escherichia coli O157:H7 for non-disease diagnostic purposes or in the preparation of products for the detection of Escherichia coli O157:H7; (2) Application in the preparation of products for the diagnosis or auxiliary diagnosis of diseases caused by Escherichia coli O157:H7 infection; (3) Application in the prevention and control of Escherichia coli O157:H7 for non-disease diagnosis purposes.