Method for whole-cell catalytic production of 1,4-butanediol and application thereof

Abstract

The application discloses a method for producing 1,4-butanediol by whole cell catalysis and application thereof, and belongs to the technical field of bio-chemical industry. The application takes Escherichia coli as a starting strain, and obtains a recombinant Escherichia coli by overexpressing five exogenous genes, namely, alpha-ketoglutarate decarboxylase SucA, NADH-dependent 4-hydroxybutyrate dehydrogenase 4Hbd, carboxylic acid reductase Car, 4'-phosphopantetheinyl transferase sfp and alcohol dehydrogenase AdhE. The recombinant strain is used for whole cell catalysis, 1,4-butanediol can be produced by using alpha-ketoglutarate under mild conditions, and the method has a very broad application prospect.

Description

Technical Field

[0001] This invention relates to a method for the whole-cell catalytic production of 1,4-butanediol and its application, belonging to the field of biochemical technology. Background Technology

[0002] 1,4-Butanediol is an important chemical that can be used as a raw material to synthesize a series of high-value-added products with important applications, such as high-grade polyurethane adhesives and polyurethane elastomers with special properties. Its applications cover multiple fields such as polyurethane, polyester, coatings, dyes, and pharmaceuticals, and it has broad market prospects. Currently, the high price of 1,4-butanediol limits its production capacity and applications, but the global market demand for this product is growing at an annual rate of 5% to 8%.

[0003] Currently, global industrial production of 1,4-butanediol is almost entirely manufactured using chemical methods from non-renewable petroleum fossil fuels such as acetylene, butane, or butadiene. This process involves complex equipment, high production costs, and causes environmental pollution. Furthermore, industrial production equipment typically faces challenges such as demanding equipment requirements, severe corrosion, and poor catalyst stability.

[0004] Biosynthesis of 1,4-butanediol can reduce the consumption of metal catalysts and fossil fuels, improve the level of circular economy, and achieve low-carbon production. Currently, research on bio-based 1,4-butanediol synthesis mainly focuses on fermentation using biomass such as glucose and lignocellulose, which involves a lengthy metabolic pathway and complex metabolic regulation. Research on biosynthetic production of 1,4-butanediol in Europe, America, and Japan has reached a mature stage and has been commercialized, especially by Genomatica in the United States. However, the generation of acetate as a byproduct is difficult to control. Therefore, developing a novel, clean, and efficient microbial synthesis method for 1,4-butanediol is essential.

[0005] The biocatalytic production of 1,4-butanediol is not only a mild reaction but also exhibits good selectivity. Therefore, developing a bio-manufacturing industry based on α-ketoglutarate as a substrate for the bio-production of 1,4-butanediol is of great significance for environmental protection and improving the level of the circular economy. Summary of the Invention

[0006] One of the objectives of this invention is to provide a new, efficient, and high-yield method for the conversion of α-ketoglutaric acid to 1,4-butanediol under mild conditions.

[0007] This invention introduces a recombinant *E. coli* strain by introducing the α-ketoglutarate decarboxylase gene *SucA* from *Mycobacterium bovis*, the NADH-dependent 4-hydroxybutyrate dehydrogenase gene *4Hbd* from *Porphyromonas gingivalis*, the carboxyl reductase gene *Car* from *Mycobacterium marinum*, the 4'-phosphopantoaminotransferase gene *sfp* from *Bacillus subtilis*, and the alcohol dehydrogenase gene *AdhE* from *Clostridium acetobutylicum*. This strain can efficiently biotransform α-ketoglutarate to produce 1,4-butanediol. The advantages of this invention are a clear reaction pathway, few byproducts, and only a small amount of 4-hydroxybutyrate and 4-hydroxybutyraldehyde accumulating.

[0008] In one embodiment of the present invention, the nucleotide sequence of the α-ketoglutarate decarboxylase gene SucA is shown in NO.1, the nucleotide sequence of the NADH-dependent 4-hydroxybutyrate dehydrogenase gene 4Hbd is shown in NO.2, the nucleotide sequence of the carboxylic acid reductase gene Car is shown in NO.3, the nucleotide sequence of the 4'-phosphopantoaminotransferase gene sfp is shown in NO.4, and the nucleotide sequence of the alcohol dehydrogenase gene AdhE is shown in NO.5.

[0009] The present invention also provides a method for preparing the recombinant Escherichia coli, comprising the following steps:

[0010] (1) The gene was linked to the plasmid pTrcHisA in the order of AdhE and SucA to construct the recombinant plasmid pTrcHisA-AdhE-SucA;

[0011] (2) The gene was linked to plasmid pTetOne in the order of Car, sfp and 4hbd to construct the recombinant plasmid pTet-Car-sfp-4hbd;

[0012] (3) Transform the recombinant plasmid pTrcHisA-AdhE-SucA constructed in step (1) and the recombinant plasmid pTet-Car-sfp-4Hbd constructed in step (2) into competent cells of Escherichia coli JM109 to obtain recombinant Escherichia coli.

[0013] The present invention also provides a method for preparing a cell catalyst for the production of 1,4-butanediol, wherein the recombinant Escherichia coli is fermented and the bacterial cells are collected.

[0014] In one embodiment of the present invention, the fermentation involves culturing the recombinant Escherichia coli in LB medium at 37°C and 200 rpm for 6–8 h, then transferring it to TB medium, inducing culture for 2 h, and then collecting the bacterial cells at 4°C for 14–16 h.

[0015] This invention also provides a method for the whole-cell catalytic production of 1,4-butanediol, wherein the recombinant *Escherichia coli* is added to a catalytic system containing α-ketoglutarate for reaction. The catalytic system includes: 0.025 M to 0.05 M PBS buffer with a pH of 7.2 to 7.4, and 1 mM to 2 mM MgO. 2+ α-ketoglutarate at a concentration of 20–21.8 g / L, and the OD of the recombinant Escherichia coli cell suspension. 600 It ranges from 20 to 60;

[0016] In one embodiment of the present invention, the catalytic system comprises: a PBS buffer solution with a concentration of 0.01M and a pH of 7.2–7.4, α-ketoglutarate with a concentration of 20 g / L, and the OD of the recombinant Escherichia coli cell suspension. 600 It is 30.

[0017] In one embodiment of the present invention, the reaction conditions of the catalytic system are: 30±1℃, 190-210rpm, and a reaction time of 24h.

[0018] The present invention also provides any one of the following applications of the above-mentioned recombinant microorganism, its preparation method, method for preparing a cell catalyst for producing 1,4-butanediol, and whole-cell catalytic production of 1,4-butanediol:

[0019] (1) Application in the fermentation production of 1,4-butanediol;

[0020] (2) Application in improving the ability of biosynthesizing 1,4-butanediol.

[0021] Beneficial effects:

[0022] This invention provides a whole-cell catalytic method for the production of 1,4-butanediol, which utilizes α-ketoglutarate to produce 1,4-butanediol under mild conditions. This reaction time is shorter than direct fermentation, with fewer intermediate steps and higher yield. Using α-ketoglutarate as a substrate, recombinant *E. coli* is added, and whole-cell catalysis is carried out at 30°C. Consuming 20 g / L of α-ketoglutarate, 7.2 g / L of butanediol is produced, achieving a molar conversion rate of 59%, with only 2.3 g / L of 4-hydroxybutyric acid and 3.0 g / L of 4-hydroxybutyraldehyde accumulating. Attached Figure Description

[0023] Figure 1 Liquid phase diagram of product 1,4-butanediol;

[0024] Figure 2 : Yield of 1,4-butanediol produced by whole-cell catalysis;

[0025] Figure 3 Optimization of whole-cell catalytic substrate concentration;

[0026] Figure 4 Whole-cell catalytic temperature optimization;

[0027] Figure 5 Whole-cell catalysis of initial OD 600 Value optimization. Detailed Implementation

[0028] The preferred embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and intent. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] Example 1: Construction of Recombinant Escherichia coli

[0030] Escherichia coli cannot directly synthesize 1,4-butanediol from α-ketoglutarate. Therefore, the following genes were introduced into E. coli: the α-ketoglutarate decarboxylase gene SucA from Mycobacterium bovis, the NADH-dependent 4-hydroxybutyrate dehydrogenase gene 4Hbd from Porphyromonas gingivalis, the carboxyl reductase gene Car from Mycobacterium marinum, the 4'-phosphopantoaminotransferase gene sfp from Bacillus subtilis, and the alcohol dehydrogenase gene AdhE from Clostridium acetobutylicum. A recombinant E. coli strain A01 was constructed that can utilize α-ketoglutarate to produce 1,4-butanediol.

[0031] 1. Construction of recombinant plasmid pTrcHisA-AdhE-SucA

[0032] (1) Using SucA U and SucA D as primers, and the artificially synthesized codon-optimized SucA gene (nucleic acid sequence as shown in NO.1) as a template, the SucA fragment with restriction sites was amplified.

[0033] SucAU: ATAAGGATCGATGGGGATCCATGTATAGGAAATTTAGAGATGACCCTCATCC;

[0034] SucA D:TTCTCCTCTTTAATGAGCTCTTAGCCGAACGCCTCGTCCA;

[0035] (2) Using AdhE U and AdhE D as primers, and the artificially synthesized codon-optimized AdhE gene (nucleic acid sequence as shown in NO.5) as a template, the AdhE fragment with restriction enzyme sites was amplified.

[0036] AdhE U:AGCTCATAAAGAGGAGAAAATGAAAGTAACAAATCAAAAAGAACTAAAGCAAAAATT G;

[0037] AdhE D: TACCAGCTGCAGATCTCGAGTTAAAAGCTCTTAATATAGATGTCTTTCAGCTCGCT;

[0038] (3) The plasmid pTrcHisA was digested with EcoRI and HindIII enzymes.

[0039] (4) The gene fragments SucA and AdhE obtained in steps (1) and (2) are fused by PCR using AdhE-SucA-U and AdhE-SucA-D as primers to obtain the AdhE-SucA fragment.

[0040] AdhE-SucA-U:

[0041] ctcgagATTAAAGAGGAGAAAATGTATAGGAAATTTAGAGATGACCCTCATCC;

[0042] AdhE-SucA-D:

[0043] TACATTTTTCTCCTCTTTAATctcgagTTAAAAGCTCTTAATATAGATGTCTTTCAGC;

[0044] (5) The enzyme digestion plasmid obtained in step (3) and the gene fragment AdhE-SucA obtained in step (4) are ligated by PCR using Ptrc-AdhE-SucA reverse PD and Ptrc-AdhE-SucA reverse PU as primers to obtain the recombinant plasmid pTrcHisA-AdhE-SucA.

[0045] Ptrc-AdhE-SucA anti-PU:gaattcgaagcttggctgtt

[0046] Ptrc-AdhE-SucA anti-PD:TTCATTTTCTCCTCTTTctcggatccccatcgatcctt

[0047] 2. Construction of recombinant plasmid pTet-Car-sfp-4hbd

[0048] (1) Using Car U and Car D as primers, the Car gene with optimized artificial codons (nucleic acid sequence as shown in NO.3) was used as a template to amplify the Car fragment with restriction sites.

[0049] Car U: AAGAATTCAAAGAGGAGAAAATGTCACCCATAACAAGAGAAGAGAGG;

[0050] Car D: TTCTCCTCTTTAATGTCGACTTACAACAGGCCTAAAAGACGTAGATCG;

[0051] (2) Using sfp U and sfp D as primers, and the artificially synthesized codon-optimized sfp gene (nucleic acid sequence as shown in NO.4) as a template, the sfp fragment with restriction sites was amplified.

[0052] sfp U: TCGACATTAAAGAGGAGAAAATGAAGATTTACGGGATTTACATGGACC;

[0053] sfp D:ATTTTCCCCTCTTTAAGCTTTTAAAGCAACTCCTCGTAAGAAACCATG;

[0054] (3) Using 4hbd U and 4hbd D as primers, the 4hbd gene with optimized artificial codons (nucleic acid sequence as shown in NO.2) was used as a template to amplify the 4hbd fragment with restriction sites.

[0055] 4hbd U:

[0056] AAAAGCTTAAAGAGGGGAAAATGCAATTATTTAAACTAAAGTCAGTAACACACCAC;

[0057] 4hbd D:

[0058] CCTGGAGATCCCTTACTCGAGTTAATACAGACGTCTGTAGATGCCCTCG

[0059] (4) The plasmid pTet-One was digested with EcoRI and HindIII enzymes.

[0060] (5) The gene fragments Car, sfp and 4hbd obtained in steps (1), (2) and (3) are fused by PCR using Car D1, Sfp U1, Sfp D1 and 4Hbd U1 as primers to obtain the Car-Sfp-4Hbd fragment.

[0061] Car D1:TTCTCCTCTTTAATGTCGACTTACAACAGGCCTAAAAGACGTAGATCG;

[0062] Sfp U1:TCGACATTAAAGAGGAGAAAATGAAGATTTACGGGATTTACATGGACC;

[0063] Sfp D1:ATTTTCCCCTTCTTAAGCTTTTAAAGCAACTCCTCGTAAGAAACCATG;

[0064] 4Hbd U1:AAAAGCTTAAAGAGGGGAAAATGCAATTATTTAAACTAAAGTCAGTAACACACCAC

[0065] (6) The enzyme-digested plasmid obtained in step (4) and the gene fragment Car-Sfp-4Hbd obtained in step (5) were ligated by PCR using pTet-Car-Sfp-4Hbd reverse PD and pTet-Car-Sfp-4Hbd reverse PD reverse PU as primers to obtain the recombinant plasmid pTet-Car-sfp-4hbd.

[0066] pTet-Car-Sfp-4Hbd anti-PU:Ctcgagtaaggatctccaggcatc;

[0067] pTet-Car-Sfp-4Hbd anti-PD:TTTCTCCTCTTTGAATTcttttctctatcactgatagggagt;

[0068] 3. Construction of recombinant strains

[0069] The recombinant plasmids pTrcHisA-AdhE-SucA and pTet-Car-sfp-4Hbd were transformed into competent cells of Escherichia coli JM109. The correct recombinant strain was obtained on LB agar plates containing 100 mg / L ampicillin and 33 mg / L chloramphenicol and named A01.

[0070] Example 2 Whole-cell catalytic synthesis of 1,4-butanediol

[0071] Recombinant Escherichia coli A01 was cultured in a 250 mL shake flask containing 50 mL of LB medium at 37°C and 200 rpm. After growth was complete, the culture was transferred to 50 mL of TB medium. Two hours later, when the OD... 600 When the bacterial count reaches 0.6–0.8, add 0.5 mM IPTG to induce culture for 16 h, and collect the bacterial cells by centrifugation at 4 °C.

[0072] Construction of a whole-cell catalytic system (based on final concentration): Initial OD 600 The recombinant Escherichia coli A01 with a concentration of 30 contains 1.0 mM Mn. 2+ 1.0mM Mg 2+ Whole-cell catalysis was performed using PBS buffer containing 3.0 mM NADH, 3.0 mM ATP, and 6.0 mM NADPH, with 20 g / L α-ketoglutarate, pH adjusted to 7.3, at 30 °C.

[0073] After conversion, the mixture was centrifuged at 8000 r / min for 10 min at 4℃, and the supernatant was collected. The conversion of α-ketoglutarate was detected by high-performance liquid chromatography (HPLC). The detection conditions were: Aminex HPX-87H column, mobile phase: 5 mM sulfuric acid, flow rate: 0.6 mL / min, column temperature: 35℃, injection volume: 10 μL. The actual concentrations of each component were calculated based on the standard curve. The results showed that strain A01 consumed 20 g / L of α-ketoglutarate in 24 h, producing 6.3 g / L of 1,4-butanediol, with a molar conversion rate (mol of 1,4-butanediol produced / mol of α-ketoglutarate consumed) of 51.5%. Extending the reaction time to 28 h consumed 20 g / L of α-ketoglutarate, producing 7.2 g / L of 1,4-butanediol, with a molar conversion rate of 59%. After this point, the yield no longer increased with time. Figure 2 As shown. Few reaction byproducts were produced, with only 2.3 g / L of 4-hydroxybutyric acid and 3.0 g / L of 4-hydroxybutyraldehyde accumulating.

[0074] Example 3: Optimization of Whole-Cell Catalytic Substrate Concentration

[0075] This embodiment provides a method for the whole-cell catalytic synthesis of 1,4-butanediol. The specific method is the same as that in Example 2, except that the concentration of α-ketoglutarate in Example 2 is changed so that the concentration of α-ketoglutarate in the catalytic system is 10 g / L, 30 g / L, and 40 g / L, respectively. Other reaction conditions remain unchanged. After 28 h, the concentration of 1,4-butanediol in the reaction solution is 7.0 g / L, 6.9 g / L, and 6.8 g / L, respectively.

[0076] Example 4: Whole-cell catalytic temperature optimization

[0077] This embodiment provides a method for the whole-cell catalytic synthesis of 1,4-butanediol, which is the same as that in Example 2, except that the temperature of the whole-cell catalysis in Example 2 is changed to 25°C, 35°C and 37°C respectively, while other reaction conditions remain unchanged. After 28 hours, the concentrations of 1,4-butanediol in the reaction solution are 4.5 g / L, 3.9 g / L and 5.6 g / L respectively.

[0078] Example 5: Optimization of Initial OD Value for Whole-Cell Catalysis

[0079] This embodiment provides a method for the whole-cell catalytic synthesis of 1,4-butanediol, which is the same as in Example 2, except that the initial OD value of the recombinant Escherichia coli in the catalytic system in Example 2 is changed to adjust its initial OD value. 600 With the concentrations set at 20, 40, and 60 μL respectively, and other reaction conditions remaining unchanged, the concentrations of 1,4-butanediol in the reaction solution after 28 hours were 5.3 g / L, 4.8 g / L, and 4.3 g / L respectively.

[0080] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant Escherichia coli, characterized in that, Overexpression of α-ketoglutarate decarboxylase gene SucA NADH-dependent 4-hydroxybutyrate dehydrogenase gene 4Hbd Carboxylic acid reductase gene Car 4'-Phosphotanyltransferase gene sfp alcohol dehydrogenase gene AdhE ; The α-ketoglutarate decarboxylase gene SucA The nucleotide sequence is shown in SEQ ID NO.1, for the NADH-dependent 4-hydroxybutyrate dehydrogenase gene. 4Hbd The nucleotide sequence is shown in SEQ ID NO.2, and the carboxylic acid reductase gene is described. Car The nucleotide sequence is shown in SEQ ID NO.3, for the 4'-phosphoubiotinyltransferase gene. sfp The nucleotide sequence of the alcohol dehydrogenase gene is shown in SEQ ID NO.

4. AdhE The nucleotide sequence is shown in SEQ ID NO.

5.

2. The method for preparing the recombinant Escherichia coli according to claim 1, characterized in that, Includes the following steps: (1) AdhE and SucA Linked to plasmid pTrcHisA, constructing recombinant plasmid pTrcHisA- AdhE - SucA ; (2) Car , sfp and 4Hbd Linked to plasmid pTetOne, constructing recombinant plasmid pTet- Car - sfp - 4Hbd ; (3) The recombinant plasmid pTrcHisA- constructed in step (1) AdhE - SucA and the recombinant plasmid pTet- constructed in step (2) Car - sfp - 4Hbd Recombinant Escherichia coli was obtained by transferring the bacteria into competent cells of Escherichia coli JM109.

3. A method for preparing a cell catalyst for the production of 1,4-butanediol, characterized in that, The recombinant Escherichia coli described in claim 1 is fermented, and the bacterial cells are collected.

4. A method for the whole-cell catalytic production of 1,4-butanediol, characterized in that, The recombinant Escherichia coli of claim 1 is added to a catalytic system containing α-ketoglutarate for reaction.

5. The method according to claim 4, characterized in that, The catalytic system comprises: 0.025M~0.05M PBS buffer with a pH of 7.2~7.4, and 1mM~2mM Mg2+ metal ions. 2＋ .

6. The method according to claim 5, characterized in that, The concentration of the α-ketoglutaric acid is 20~21.8 g / L.

7. The method according to claim 6, characterized in that, The OD of the recombinant Escherichia coli 600 The range is 20 to 60.

8. The method according to claim 7, characterized in that, The reaction conditions are: 29~31℃, 190-210rpm, for at least 24h.

9. The use of the recombinant Escherichia coli of claim 1, the method of claim 2, the method of claim 3, or any of the methods of claims 4-8 in the production of 1,4-butanediol.

Images