Recombinant escherichia coli with high yield of o-acetyl-l-homoserine and application thereof

By inserting the metX gene, knocking out the patZ, cspC, and yahK genes, inserting the ppnK gene, and replacing the acs gene promoter in Escherichia coli W3110, the problem of insufficient acetyl-CoA supply was solved, the yield and conversion rate of O-acetyl-L-homoserine were increased, and the industrialization needs were met.

CN116496964BActive Publication Date: 2026-06-05ZHEJIANG UNIV OF TECH
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV OF TECH
Filing Date
2023-03-17
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

In existing technologies, E. coli is prone to reduced synthesis capacity during the production of O-acetyl-L-homoserine due to insufficient supply of acetyl-CoA, resulting in insufficient yield and conversion rate to meet industrialization needs.

Method used

By using metabolic engineering and gene editing techniques, the metX gene was inserted into Escherichia coli W3110, the patZ, cspC, and yahK genes were knocked out, the ppnK gene was inserted, and the acs gene promoter was replaced, thus reshaping the O-acetyl-L-homoserine synthesis pathway and enhancing the supply of acetyl-CoA.

Benefits of technology

A recombinant Escherichia coli strain with high O-acetyl-L-homoserine production was developed, improving the yield and conversion rate of O-acetyl-L-homoserine and meeting the needs of industrialization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116496964B_ABST
    Figure CN116496964B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and discloses a recombinant Escherichia coli for high-yield O-acetyl-L-homoserine and application thereof. The recombinant Escherichia coli for high-yield O-acetyl-L-homoserine is obtained by the following combination of modification strategies: in Escherichia coli W3110, a gene encoding homoserine O-acetyltransferase is integrated into a gene site encoding L-arginine ABC transporter ATP binding subunit, then a gene encoding phosphoacetyltransferase is knocked out, then a gene encoding transcriptional anti-terminator and mRNA stability regulator is knocked out, then a gene encoding ATP-NAD kinase is integrated into a gene site encoding NADPH-dependent aldehyde reductase, and finally a gene promoter of acetyl-CoA synthetase is replaced by a Ptrc promoter to obtain the recombinant Escherichia coli. The recombinant Escherichia coli is used for fermentation to produce O-acetyl-L-homoserine, and has the advantage of high yield. metx artp patz cspc ppnk yahk acs ​​​​​​​
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a recombinant Escherichia coli that produces high levels of O-acetyl-L-homoserine and its applications. Background Technology

[0002] In recent years, due to increasingly serious environmental problems, biomanufacturing, which utilizes renewable resources to sustainably produce valuable chemicals, has received more and more attention.

[0003] O-acetyl-L-homoserine (OAH) is an important platform compound for the production of high-value compounds such as L-methionine, L-homoserine, and γ-butyrolactone. While OAH does not directly participate in protein synthesis in microbial cells, it is a key precursor in the biosynthesis of important sulfur-containing compounds in cellular metabolism, such as L-methionine and S-adenosylmethionine (SAM). Furthermore, OAH can also serve as an important raw material, directly conjugated with methanethiol via highly active enzymatic methods to produce L-methionine in industrial processes. L-methionine is an essential amino acid widely used in the food, pharmaceutical, cosmetic, and feed industries, with a global market exceeding 1.6 million tons per year. Starting with OAH, Malaysia has already built an 80,000-ton-per-year L-methionine industrial production line and is gradually increasing production. Therefore, OAH, as a promising platform chemical, has attracted significant attention due to its growing market demand and applications.

[0004] Escherichia coli, as an important industrial microorganism, has been used to produce L-aspartic acid family amino acids, such as L-threonine and L-isoleucine, and has great potential for OAH production. Wild-type Escherichia coli lacks a pathway for synthesizing O-acetyl-L-homoserine; therefore, it is necessary to introduce the metX gene encoding homoserine O-acetyltransferase into the E. coli genome to efficiently synthesize O-acetyl-L-homoserine.

[0005] However, in existing technologies, metabolic engineering can easily lead to the accumulation of homoserine due to insufficient acetyl-CoA supply, thereby weakening OAH synthesis capacity. Currently, metabolic engineering of O-acetyl-L-homoserine-producing strains has achieved a certain production capacity, but its yield and conversion rate still have room for improvement before industrialization. Therefore, improving the production performance of engineered O-acetyl-L-homoserine strains has become an urgent problem to be solved in this field. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a recombinant *Escherichia coli* strain that produces high levels of O-acetyl-L-homoserine and its applications. The purpose of this invention is to modify *Escherichia coli* using metabolic engineering and gene editing techniques to obtain a recombinant *E. coli* strain that produces high levels of O-acetyl-L-homoserine. Specifically, the invention aims to provide a plasmid-free genetically engineered bacterium that produces high levels of O-acetyl-L-homoserine, using *Escherichiacoli* W3110ΔmetIJBΔthrBΔmetAΔtdcCTrc-metL-thrA-rhtA as the substrate bacterium, and to provide its construction method and application in the microbial fermentation preparation of O-acetyl-L-homoserine using metabolic engineering and gene editing techniques.

[0007] The specific technical solution of this invention is as follows:

[0008] On the one hand, the present invention provides a recombinant Escherichia coli that produces high levels of O-acetyl-L-homoserine, which is constructed by the following method:

[0009] (1) Using E. coli W3110 as the chassis bacteria, the metX gene of homoserine O-acetyltransferase was inserted into the artP gene site encoding the ATP-binding subunit of L-arginine ABC transporter in the genome of strain E. coli W3110 to obtain the recombinant strain W3110ΔartPTrc-metX.

[0010] (2) The patZ gene of phosphorylated acetyltransferase in the genome of strain W3110ΔartPTrc-metX was knocked out to obtain recombinant strain W3110ΔartPΔpatZTrc-metX;

[0011] (3) Knock out the cspC gene encoding the transcriptional antiterminator and mRNA stability regulator in the genome of strain W3110ΔartPΔpatZTrc-metX to obtain the recombinant strain W3110ΔartPΔpatZΔcspCTrc-metX.

[0012] (4) Knock out the yahK gene encoding NADPH-dependent aldehyde reductase in the genome of strain W3110ΔartPΔpatZΔcspCTrc-metX to obtain recombinant strain W3110ΔartPΔpatZΔcspCΔyahKTrc-metX.

[0013] (5) Insert the ppnK gene encoding ATP-NAD kinase into the yahK gene site encoding NADPH-dependent aldehyde reductase in strain W3110ΔartPΔpatZΔcspCTrc-metX to obtain the recombinant strain W3110ΔartPΔpatZΔcspCΔyahKTrc-metX-ppnK.

[0014] (6) The promoter encoding the acetyl-CoA synthase acs gene in the genome of strain W3110ΔartPΔpatZΔcspCTrc-metX was replaced with the Ptrc promoter to obtain the recombinant strain W3110ΔartPΔpatZΔcspCΔyahKTrc-metX-ppnK-acs, which is the recombinant Escherichia coli that produces high levels of O-acetyl-L-homoserine.

[0015] The *Escherichia coli* W3110 is the *Escherichia coli* W3110ΔmetIJBΔthrBΔmetAΔtdcCTrc-metL-thrA-rhtA disclosed in patent ZL201810844040.2. The recombinant *Escherichia coli* with high O-acetyl-L-homoserine production obtained in this invention is constructed using this bacterium as the starting strain through the above steps (1) to (6) via metabolic engineering and gene editing technology. Specifically:

[0016] The recombinant Escherichia coli with high O-acetyl-L-homoserine production provided by this invention was obtained through a combination of the following modification strategies using metabolic engineering and gene editing techniques:

[0017] ① The metX gene encoding homoserine O-acetyltransferase was integrated into the artP gene site encoding the ATP-binding subunit of L-arginine ABC transporter in Escherichia coli. This operation strongly expressed metX at the artP site of the basal bacteria, remodeled the OAH synthesis pathway, and reduced intracellular ATP consumption.

[0018] ②The patZ gene encoding phosphorylated acetyltransferase, the cspC gene encoding transcriptional reverse terminator and mRNA stability regulator are knocked out in sequence to relieve the repression of the key gene acs in the cellular acetate utilization pathway and enhance the reflux of acetate.

[0019] ③The ppnK gene encoding ATP-NAD kinase is then integrated into the yahK gene site encoding NADPH-dependent aldehyde reductase. This operation knocks out the yahK gene encoding NADPH-dependent aldehyde reductase and overexpresses the ppnK gene encoding ATP-NAD kinase to reduce ATP consumption and increase NADPH regeneration in the metabolic network.

[0020] ④ Finally, the promoter of the acs gene encoding acetyl-CoA synthase was replaced with the Ptrc promoter. This operation enhanced the supply of acetyl-CoA, thereby reconstructing and strengthening the O-acetyl-L-homoserine synthesis pathway in recombinant Escherichia coli.

[0021] Using recombinant Escherichia coli that produces O-acetyl-L-homoserine obtained through the combination of the above-mentioned modification strategies has the advantage of high yield in the production of O-acetyl-L-homoserine.

[0022] Specifically, as a preferred embodiment of the above-mentioned technical solution of the present invention, the nucleotide sequence of the artP gene is shown in SEQ ID NO.1; the metX gene is derived from Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO.3; the nucleotide sequence of the patZ gene is shown in SEQ ID NO.5; the nucleotide sequence of the cspC gene is shown in SEQ ID NO.7; the nucleotide sequence of the yahK gene is shown in SEQ ID NO.9; the nucleotide sequence of the ppnK gene is shown in SEQ ID NO.11; the nucleotide sequence of the acs gene is shown in SEQ ID NO.13; and the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO.16.

[0023] On the other hand, the present invention also provides the application and method of the above-mentioned recombinant Escherichia coli with high O-acetyl-L-homoserine production in the preparation of O-acetyl-L-homoserine by microbial fermentation.

[0024] Specifically, the application method includes the following steps: the recombinant Escherichia coli obtained above is inoculated into a fermentation medium with glucose as the carbon source, and fermented at 30°C and 180-200 rpm for 48-80 h. After fermentation, the supernatant of the fermentation broth is taken for separation and purification to obtain O-acetyl-L-homoserine.

[0025] As a preferred embodiment of the above-mentioned technical solution of the present invention, the recombinant Escherichia coli is first activated by slant culture and then cultured by seed culture. The seed culture is inoculated into the fermentation medium at a volume concentration of 5%. The slant activation method is as follows: the recombinant Escherichia coli is inoculated on LB plates and cultured overnight at 37°C to obtain slant cells. The seed culture method is as follows: a single colony of the slant cells is picked and inoculated into LB liquid medium and cultured overnight at 37°C and 200 rpm to obtain seed culture.

[0026] As a preferred embodiment of the above-mentioned technical solution of the present invention, the fermentation culture medium consists of: glucose 30 g / L, potassium dihydrogen phosphate 1 g / L, ammonium chloride 3.43 g / L, peptone 6.82 g / L, L-threonine 0.5 g / L, L-methionine 0.2 g / L, L-lysine 0.1 g / L, MgSO4 2 g / L, FeSO4 0.005 g / L, MnSO4 0.005 g / L, ZnSO4 0.005 g / L, and deionized water as the solvent, with a pH of 6.8.

[0027] Specifically, fermentation is carried out in a fermenter, with the glucose concentration in the fermenter controlled at 2-10 g / L by adding feed medium; the fermentation conditions are: DO level at 20%, stirring speed at 300-800 rpm, and aeration rate controlled at 1-2 vvm; during fermentation, the culture temperature is controlled at 30℃ and the pH is adjusted to the range of 6.75-6.80 with 50% ammonia water. The culture medium in the fermenter consisted of: 30 g / L glucose, 1 g / L potassium dihydrogen phosphate, 3.43 g / L ammonium chloride, 6.82 g / L peptone, 0.5 g / L L-threonine, 0.2 g / L L-methionine, 0.1 g / L L-lysine, 2 g / L MgSO4, 0.005 g / L FeSO4, 0.005 g / L MnSO4, and 0.005 g / L ZnSO4, with deionized water as the solvent and a pH of 6.8. The fed culture medium consisted of: 500 g / L glucose, 1 g / L potassium dihydrogen phosphate, 3.43 g / L ammonium chloride, 6.82 g / L peptone, 4 g / L L-threonine, 1 g / L L-methionine, and 0.5 g / L L-lysine, with water as the solvent.

[0028] Compared with the prior art, the present invention has the following technical effects:

[0029] This invention remodels the OAH synthesis pathway by strongly expressing metX at the artP site in *E. coli*, while simultaneously reducing intracellular ATP consumption. By knocking out the patZ gene encoding phosphoacetyltransferase and the cspC gene encoding a transcriptional reverse terminator and mRNA stability regulator, the repression of the key gene acs in the cellular acetate utilization pathway is relieved, thus enhancing acetate reflux. Furthermore, by knocking out the yahK gene encoding NADPH-dependent aldehyde reductase and overexpressing the pppnK gene encoding ATP-NAD kinase, ATP consumption in the metabolic network is reduced and NADPH regeneration is increased. In addition, replacing the acs promoter with Ptrc enhances the supply of acetyl-CoA, achieving the reconstruction and enhancement of the O-acetyl-L-homoserine synthesis pathway in recombinant *E. coli*. Through this combination of modification strategies, a recombinant *E. coli* strain producing high levels of O-acetyl-L-homoserine was successfully obtained. Attached Figure Description

[0030] Figure 1 This is a diagram showing the results of fed-batch fermentation of O-acetyl-L-homoserine-derived genetically engineered bacterium OAH6 in Example 4 of this invention. Detailed Implementation

[0031] The present invention will be further described below with reference to embodiments.

[0032] In this invention, the term "enhancement" refers to increasing the activity of an enzyme encoded by the corresponding polynucleotide. This can be achieved through gene overexpression or by replacing the gene's expression regulatory sequence on the genome (promoter substitution, etc.).

[0033] The LB liquid medium consists of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride, with deionized water as the solvent and a natural pH value.

[0034] LB plates are made by adding agar to LB liquid medium at a final concentration of 2 g / L.

[0035] Example 1: Metabolic Modification Based on Engineered Strains

[0036] (1) Knockout of the artP gene

[0037] To reduce ATP consumption, it is necessary to block the ATP binding site of the L-arginine ABC transporter to conserve energy and concentrate it on the acetyl synthesis pathway. Therefore, using the *Escherichia coli* W3110ΔmetIJBΔthrBΔmetAΔtdcCTrc-metL-thrA-rhtA disclosed by the inventors in patent ZL201810844040.2 as the starting strain, the artP gene (nucleotide sequence shown in SEQ ID NO.1) was knocked out using CRISPR-Cas9 gene editing technology. The CRISPR-Cas9 gene editing method is referenced in Jiang Y, Chen B, Duan C, et al. Multigene Editing in the Escherichiacoli Genome via the CRISPR-Cas9 System [J]. Applied & Environmental Microbiology, 2015, 81(7):2506.

[0038] Using the pTarget vector as a template, PCR amplification was performed using primers 1 and 2 to construct the sgRNA mutant vector pTarget-ΔartP, capable of transcribing artP. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by DpnI treatment at 37℃ for 3 h and then transformed into E. coli DH5α recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. The bacterial cells were collected, and the plasmid was extracted to obtain the pTarget-ΔartP vector.

[0039] Using wild-type *Escherichia coli* strain as a template, the upstream homologous fragment of the *artP* gene was amplified using primers 3 and 4. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; followed by a 10-min extension at 72℃. The downstream homologous fragment of the *artP* gene was amplified using primers 5 and 6 in the same manner. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were then excised and purified. The two recovered DNA fragments were then subjected to fusion PCR using primers 3 and 6. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated 30 times; followed by a 10-min extension at 72℃. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were then excised and purified (nucleotide sequence shown in SEQ ID NO. 2). The pTarget-ΔartP vector and the recovered DNA fragment were electroporated together into the Escherichia coli strain W3110ΔmetIJBΔthrBΔmetAΔtdcCTrc-metL-thrA-rhtA containing the pCas9 vector.

[0040] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and incubated overnight at 30°C. A single colony was picked as a template for PCR using primers 7 and 8. The deletion of the artP gene was confirmed by observing a 1000 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔartP vector. The strain with the pTarget-ΔartP vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was designated HS1.

[0041] Table 1 Primer sequences

[0042] Primer 1 GCGTAAAACCGCCAGCCGAGGTTTTAGAGCTAGAAATAGC Primer 2 CTCGGCTGGCGGTTTTACGCACTAGTATTATACCTAGGAC Primer 3 CTTTTTTTGAATTCTCTAGAGCGACACTGCTTAGCGATG Primer 4 CATGTTGTTATCCCGAATCTGACACTCGTATACTGGCAGTCT Primer 5 CTGCCAGTATACGAGTGTCAGATTCGGGATAACAACAATGAA Primer 6 ATAGATCTAAGCTTCTGCAGACTCAGTGACCACTGCGGTG Primer 7 AGAGCGATCGCTTATAAGGAAA Primer 8 ACAATCAATGCACAAACGGC

[0043] (2) Enhanced expression of the metX gene

[0044] The metX gene encodes an enzyme that is crucial for converting L-homoserine to O-acetyl-L-homoserine, but this gene is absent in *E. coli*. To disrupt the biosynthetic pathway of O-acetyl-L-homoserine in *E. coli*, the metX gene (nucleotide sequence shown in SEQ ID NO.3) derived from *Corynebacterium glutamicum* was driven by the trc promoter and inserted into the site where artP was knocked out to enhance metX gene expression.

[0045] The metX gene was amplified by PCR using the genome of Corynebacterium glutamicum ATCC13032 as a template, with primers 9 and 10. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; followed by a 10 min extension at 72℃. The PCR products were detected by 1.0% agarose gel electrophoresis, and the fragments were recovered and purified by gel extraction.

[0046] Using pTrc99A vector as a template, PCR amplification was performed using primers 11 and 12 to construct the sgRNA mutant vector pTrc99A-metX, capable of overexpressing the metX gene, which is a high-serine O-acetyltransferase. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by treating with DpnI at 37℃ for 3 h, and then transformed into *E. coli* DH5α recipient bacteria along with the recovered DNA fragment metX. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L kanamycin resistance and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance and incubated at 37℃ for 12 h. The bacterial cells were collected and the plasmid was extracted to obtain pTrc99A-metX.

[0047] Using pTarget-ΔartP as a template, PCR amplification was performed using primers 13 and 14 to construct the sgRNA mutant vector pTarget-ΔartP::Trc-metX, which can insert the Trc-metX fragment into the artP site. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was treated with DpnI at 37℃ for 3 h. After inactivation, it was transformed into E. coli DH5α recipient bacteria, plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, and incubated at 37℃ for 12 h. Single colonies were randomly picked and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, incubated at 37℃ for 12 h, and the bacterial cells were collected and plasmids were extracted to obtain the pTarget-ΔartP::Trc-metX vector.

[0048] Using pTrc99A-metX as a template, primers 15 and 16 were used to amplify the metX gene fragment (nucleotide sequence shown in SEQ ID NO.4) driven by the trc promoter from Corynebacterium glutamicum. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; extension at 72℃ for 10 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was recovered and purified. The pTarget-ΔartP::Trc-metX vector and the recovered DNA fragment were electroporated together into Escherichia coli HS1 strain containing the pCas9 vector.

[0049] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and incubated overnight at 30°C. A single colony was picked as a template, and PCR was performed using primers 7 and 8. The replacement of the artP gene with the Trc-metX gene was confirmed by observing a 3236 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔartP::Trc-metX vector. The strain with the pTarget-ΔartP vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was designated OAH1.

[0050] Table 2 Primer sequences

[0051] Primer 9 GAAACAGACCATGCCCACCCTCGCGCCTTC Primer 10 TCTAGAGGATTTAGATGTAGAACTCGATGT Primer 11 CTACATCTAAATCCTCTAGAGTCGACCTGC Primer 12 GGGTGGGCATGGTCTGTTTCCTGTGTGAAA Primer 13 ATCCTGACGGATGGCCTTTTGATTCGGGATAACAACAATG Primer 14 GCCGGATGATTAATTGTCAATGACACTCGTATACTGGCAG Primer 15 TTGACAATTAATCATCCGGC Primer 16 AAAAGGCCATCCGTCAGGAT

[0052] Example 2: Metabolic Modification Based on OAH1 Strain

[0053] (1) Knockout of the patZ gene

[0054] To block patZ and relieve semiconstitutive overexpression caused by the insertion of the IS element into the 5' regulatory region of the acs gene locus without altering acs enzyme activity, thus promoting efficient utilization and tolerance of acetic acid by cells, the patZ gene (nucleotide sequence shown in SEQ ID NO. 5) was knocked out using CRISPR-Cas9 gene editing technology, starting with OAH1 strain.

[0055] Using the pTarget vector as a template, primers 17 and 18 were used for amplification to construct the mutant vector pTarget-ΔpatZ, capable of transcribing sgRNA targeting patZ. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by treating with DpnI at 37℃ for 3 h and then transformed into *E. coli* DH5α recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. The bacterial cells were collected, and the plasmid was extracted to obtain the pTarget-ΔpatZ vector.

[0056] Using the *E. coli* genome as a template, the upstream homologous fragment of the patZ gene was amplified using primers 19 and 20. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; followed by a 10-min extension at 72℃. The downstream homologous fragment of the patZ gene was amplified using primers 21 and 22 in the same manner. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were then excised and purified. The two recovered DNA fragments were then subjected to fusion PCR using primers 19 and 22. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated 30 times; followed by a 10-min extension at 72℃. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were then excised and purified (nucleotide sequence shown in SEQ ID NO. 6). The pTarget-ΔpatZ vector and the recovered DNA fragment were electroporated together into the OAH1 strain containing the pCas9 vector.

[0057] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride, and incubated overnight at 30°C. Single colonies were picked as templates for PCR using primers 23 and 24, and the deletion of the patZ gene was confirmed by observing a 1000 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔpatZ vector. The strain with the pTarget-ΔpatZ vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was designated *Escherichia coli* OAH2.

[0058] Table 3 shows the primer sequences used.

[0059] Primer 17 TAATACTAGTTAAAAGCGGACGTAGCCCGGGTTTTAGAGCTAGAAATAGC Primer 18 GCTCTAAAACCCGGGCTACGTCCGCTTTTAACTAGTATTATACCTAGGAC Primer 19 CTTTTTTTGAATTCTCTAGATTTGCCTGATACCGTTGCGT Primer 20 AGTACCTTACACCGGTCTCCCGCAGAAGTG Primer 21 GGAGACCGGTGTAAGGTACTGGAAATGTTG Primer 22 ATAGATCTAAGCTTCTGCAGATTGATTGGAACGCCATAAA Primer 23 CGAAAACGCTGTTCTCCAGT Primer 24 TCATCCAGACGATTAACGCC

[0060] (2) Knockout of the cspC gene

[0061] To improve cellular utilization of acetic acid, reduce the amount of rpoS mRNA, and decrease its stability, the cspC gene (nucleotide sequence shown in SEQ ID NO. 7) was knocked out using CRISPR-Cas9 gene editing technology, starting with OAH2 strain.

[0062] Using the pTarget vector as a template, PCR amplification was performed with primers 25 and 26 to construct the mutant vector pTarget-ΔcspC, capable of transcribing sgRNA targeting cspC. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by DpnI treatment at 37℃ for 3 h and then transformed into *E. coli* DH5α recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. The bacterial cells were collected, and the plasmid was extracted to obtain the pTarget-ΔcspC vector.

[0063] The upstream homologous fragment of the cspC gene was amplified by PCR using primers 27 and 28 with wild-type E. coli as a template. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; extension at 72℃ for 10 min. The downstream homologous fragment of the cspC gene was amplified using primers 29 and 30 in the same manner. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were recovered and purified. The two recovered DNA fragments were then subjected to fusion PCR using primers 27 and 30. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated 30 times; extension at 72℃ for 10 min. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were recovered and purified (nucleotide sequence shown in SEQ ID NO. 8). The pTarget-ΔcspC vector and the recovered DNA fragment were electroporated together into the OAH2 strain containing the pCas9 vector.

[0064] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and incubated overnight at 30°C. Single colonies were picked as templates for PCR using primers 31 and 32, and the deletion of the cspC gene was confirmed by observing a 1000 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔcspC vector. The strain with the pTarget-ΔcspC vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was designated OAH3.

[0065] Table 4 Primer sequences

[0066] Primer 25 TAATACTAGTGTTGAGTTCGAAATTCAGGAGTTTTAGAGCTAGAAATAGC Primer 26 GCTCTAAAACTCCTGAATTTCGAACTCAACACTAGTATTATACCTAGGAC Primer 27 CTTTTTTTGAATTCTCTAGAGCCGTTAACTGACTGTTTTA Primer 28 GTGGATTCGATTGAAAAATTCCTTAGATTG Primer 29 AATTTTTCAATCGAATCCACTGATCTGAAG Primer 30 ATAGATCTAAGCTTCTGCAGGTGGTGATTTCGGGCAACGC Primer 31 ATGGTGCAACTGCTTCAAATTA Primer 32 CTTCAGCTCCATCAAATGTCG

[0067] (3) Knockout of the yahK gene

[0068] To prevent excessive reduction of NADPH by cells, which would increase NADPH accumulation, it is necessary to block the expression of the NADPH reductase responsible for NADPH reductase, specifically the yahK gene encoding NADPH-dependent aldehyde reductase. Therefore, using OAH3 strain as the starting strain, the yahK gene (nucleotide sequence shown in SEQ ID NO.9) was knocked out using CRISPR-Cas9 gene editing technology.

[0069] Using the pTarget vector as a template, PCR amplification was performed with primers 33 and 34 to construct the mutant vector pTarget-ΔyahK, capable of transcribing sgRNA targeting yahK. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by DpnI treatment at 37℃ for 3 h and then transformed into *E. coli* DH5α recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. The bacterial cells were collected, and the plasmid was extracted to obtain the pTarget-ΔyahK vector.

[0070] The upstream homologous fragment of the yahK gene was amplified using primers 35 and 36 with the genomic DNA of strain OAH3 as a template. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; followed by a 10 min extension at 72℃. The downstream homologous fragment of the yahK gene was amplified using primers 37 and 38 in the same manner. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were excised and purified (nucleotide sequence shown in SEQ ID NO. 10). The two recovered DNA fragments were then subjected to fusion PCR using primers 35 and 38. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated 30 times; followed by a 10 min extension at 72℃. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were excised and purified. The pTarget-ΔyahK vector and the recovered DNA fragment were electroporated together into the OAH3 strain containing the pCas9 vector.

[0071] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride, and incubated overnight at 30°C. Single colonies were picked as templates for PCR using primers 39 and 40, and the deletion of the yahK gene was confirmed by observing a 1000 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔyahK vector. The strain with the pTarget-ΔyahK vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way is designated OAH4.

[0072] Table 5 Primer sequences

[0073] Primer 33 TAATACTAGTCCAAATACACATAGCTAATCGTTTTAGAGCTAGAAATAGC Primer 34 GCTCTAAAACGATTAGCTATGTGTATTTGGACTAGTATTATACCTAGGAC Primer 35 CTTTTTTTGAATTCTCTAGACTTATGGTCTGGGCGACATG Primer 36 CAGGGTATTTATTAATTTTTGCGAGCCTGAATGAAACAGA Primer 37 TCTGTTTCATTCAGGCTCGCAAAAATTAATAAATACCCTGTGGTTT Primer 38 ATAGATCTAAGCTTCTGCAGTTAACCGGGTGATCAGGGTA Primer 39 ATCACTCTGGTTGACGCGTAA Primer 40 TTTTTTATCGCCCACGCAC

[0074] (4) Enhanced expression of ppnK gene

[0075] The ppnK gene encodes the enzyme ATP-NAD kinase in cells, which is the only enzyme in the body capable of catalyzing NAD. + Phosphorylation to NADP + To enhance NADPH accumulation in cells, the ppnK gene (nucleotide sequence shown in SEQ ID NO. 11) derived from Corynebacterium glutamicum was driven by the trc promoter and inserted into the yahK knockout site to enhance reducing power accumulation.

[0076] The ppnK gene was obtained by PCR amplification using the genome of *Corynebacterium glutamicum* ATCC13032 as a template, with primers 41 and 42. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; followed by a final extension at 72℃ for 10 min. The PCR products were detected by 1.0% agarose gel electrophoresis, and the purified fragments were recovered by gel extraction.

[0077] Using the pTrc99A vector as a template, PCR amplification was performed using primers 43 and 44 to construct the sgRNA mutant vector pTrc99A-ppnK, which overexpresses the ppnK gene of ATP-NAD kinase. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by treating with DpnI at 37℃ for 3 h, and then transformed into *E. coli* DH5α recipient bacteria along with the recovered DNA fragment ppnK. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L kanamycin resistance and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L kanamycin resistance and incubated at 37℃ for 12 h. The bacterial cells were collected and the plasmid was extracted to obtain pTrc99A-ppnK.

[0078] Using pTarget-ΔyahK as a template, PCR amplification was performed using primers 45 and 46 to construct the sgRNA mutant vector pTarget-ΔartP::Trc-ppnK, which can insert the Trc-ppnK fragment into the yahK site. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was treated with DpnI at 37℃ for 3 h. After inactivation, it was transformed into E. coli DH5α recipient bacteria, plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, and incubated at 37℃ for 12 h. Single colonies were randomly picked and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, incubated at 37℃ for 12 h, and the bacterial cells were collected and plasmids were extracted to obtain the pTarget-ΔartP::Trc-ppnK vector.

[0079] Using pTrc99A-ppnK as a template, primers 47 and 48 were used to amplify the ppnK gene fragment (nucleotide sequence shown in SEQ ID NO. 12) driven by the trc promoter from Corynebacterium glutamicum. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated for 30 cycles; extension at 72℃ for 10 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was recovered and purified. The pTarget-ΔartP::Trc-ppnK vector and the recovered DNA fragment were electroporated together into Escherichia coli OAH4 strain containing the pCas9 vector.

[0080] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and incubated overnight at 30°C. Single colonies were picked as templates for PCR using primers 39 and 40. The replacement of the yahH gene with the Trc-ppnK gene was confirmed by observing a 3070 bp DNA band on a 1.0% agarose gel. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔartP::Trc-ppnK vector. The strain with the pTarget-ΔartP::Trc-ppnK vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The resulting strain was designated OAH5.

[0081] Table 6 Primer sequences

[0082] Primer 41 AGCGGGGTAAATCCTCTAGAGTCGACCTGC Primer 42 GTGCAGTCATGGTCTGTTTCCTGTGTGAAA Primer 43 GAAACAGACCATGACTGCACCCACGAACGC Primer 44 TCTAGAGGATTTACCCCGTCGACCTGGGAT Primer 45 TAATTGTCAAGCGAGCCTGAATGAAACAGA Primer 46 ATGGCCTTTAAAAATTAATAAATACCCTG Primer 47 TCAGGCTCGCTTGACAATTAATCATCCGGC Primer 48 ATTAATTTTTAAAAGGCCATCCGTCAGGAT

[0083] (5) Enhanced expression of acs gene

[0084] The acs gene encodes acetyl-CoA synthase. To reduce acetic acid byproducts, recover wasted carbon, and redirect carbon flux to a more favorable pathway for O-acetyl-L-homoserine production during glucose fermentation, the original promoter sequence in the acs gene (nucleotide sequence shown in SEQ ID NO. 13) will be replaced with a TRC promoter sequence to enhance acs gene expression and increase acetyl-CoA supply.

[0085] Using the pTarget vector as a template, PCR amplification was performed using primers 49 and 50 to construct the sgRNA mutant vector pTarget-ΔPacs::Ptrc, capable of transcribing the promoter sequence of the target gene acs. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, repeated 30 times; extension at 72℃ for 10 min. The PCR product was inactivated by DpnI treatment at 37℃ for 3 h and then transformed into E. coli DH5α recipient bacteria. The transformed bacteria were plated on LB agar plates containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. Single colonies were randomly selected and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride and incubated at 37℃ for 12 h. The bacterial cells were collected, and plasmids were extracted to obtain the pTarget-ΔPacs::Ptrc vector.

[0086] The upstream homologous fragment of the acs gene promoter sequence was amplified by PCR using primers 51 and 52 with the genome of OAH5 strain as a template. The promoter sequence information of the acs gene was obtained from the EcocycE.coli Database (EcoCyc gene accession number: EG11448, nucleotide sequence shown in SEQ ID NO.14). The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, repeated 30 times; extension at 72℃ for 10 min. The downstream homologous fragment of the acs gene promoter sequence was amplified by primers 53 and 54 in the same manner. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were excised and purified. The two recovered DNA fragments were subjected to fusion PCR using primers 51 and 54. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, repeated for 30 cycles; extension at 72℃ for 10 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment (nucleotide sequence shown in SEQ ID NO. 15) was excised and purified. The Ptrc promoter sequence (nucleotide sequence shown in SEQ ID NO. 16) was inserted between the two homologous fragments in this gene band. The pTarget-ΔPacs::Ptrc vector and the recovered DNA fragment were electroporated together into OAH5 strain containing the pCas9 vector.

[0087] The electroporated bacterial culture was plated onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin hydrochloride resistance, and incubated overnight at 30°C. Single colonies were picked as templates for PCR using primers 55 and 56. The presence of a 700 bp DNA band on a 1.0% agarose gel confirmed that the original promoter sequence of the acs gene had been replaced by the Ptrc promoter sequence. The confirmed strain was then incubated overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔPacs::Ptrc vector. The strain with the pTarget-ΔPacs::Ptrc vector removed was then incubated overnight at 37°C in LB medium to remove the pCas vector. The strain after removing the pCas vector was subjected to PCR amplification using primers 55 and 54. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min 15 s, repeated for 30 cycles; extension at 72℃ for 10 min. The PCR products were sequenced for verification. The sequencing results, confirmed by BLAST sequence alignment, showed that the in situ promoter sequence of the acs gene had been successfully replaced by the Ptrc promoter. The constructed strain was designated OAH6.

[0088] Table 7 Primer sequences

[0089]

[0090]

[0091] Example 3: Shake-flask fermentation experiment

[0092] Fermentation experiments were conducted on the above-mentioned bacterial cells in shake flasks to compare the ability of different genotype strains to produce O-acetyl-L-homoserine. The shake flask fermentation experiments were carried out according to the following protocol: each strain was streaked onto LB agar plates and incubated overnight at 37°C. A single colony was then picked and inoculated into 5 ml of LB medium and incubated overnight at 37°C with a rotation speed of 200 rpm to obtain the seed culture.

[0093] Add 50 ml of fermentation medium to a 500 ml shake flask, and inoculate 2.5 ml of seed culture for each strain into the fermentation medium. Then, incubate at 180 rpm in a 30°C incubator for 72 hours. Take 1 ml of liquid from the shake flask, dilute it 100 times with ultrapure water, filter it through a membrane, and analyze the O-acetyl-L-homoserine content in the fermentation broth using an amino acid analyzer. Finally, compare the amount of O-acetyl-L-homoserine obtained from different genotype strains. The results are shown in Table 8, "Shake Flask Fermentation Experiment of Metabolic Modified Strains." The final concentration of the fermentation medium was as follows: glucose 30 g / L, potassium dihydrogen phosphate 1 g / L, ammonium chloride 3.43 g / L, peptone 6.82 g / L, L-threonine 0.5 g / L, L-methionine 0.2 g / L, L-lysine 0.1 g / L, MgSO4 2 g / L, FeSO4 0.005 g / L, MnSO4 0.005 g / L, ZnSO4 0.005 g / L, with deionized water as the solvent and a pH of 6.8.

[0094] Table 8 Results of shake-flask fermentation for each strain

[0095] strain O-acetyl-L-homoserine (g / L) L-homoserine (g / L) HS1 0 11.4 OAH1 6.3 3.8 OAH2 8.2 3.1 OAH3 9.9 2.5 OAH4 11.8 1.4 OAH5 14.3 1.1 OAH6 17.6 0.2

[0096] As shown in Table 8, the metabolically modified OAH6 strain does not require the presence of exogenous plasmids and possesses the ability to produce and accumulate O-acetyl-L-homoserine extracellularly. Compared to the wild type, it can better utilize carbon sources such as glucose for O-acetyl-L-homoserine production. The best-performing modified strain increased the level of O-acetyl-L-homoserine produced during fermentation from 0 g / L to 17.6 g / L compared to the wild-type strain. Other modified strains also showed varying degrees of improvement in O-acetyl-L-homoserine production compared to the original strain.

[0097] Example 4: Large-scale fermenter culture experiment

[0098] For large-scale production of O-acetyl-L-homoserine, strain OAH6 was used and cultured in a 5L fermenter. The strain was streaked onto LB agar plates and incubated overnight at 37°C. Single colonies were picked and inoculated into 10ml of LB medium and incubated at 37°C for 8 hours. Then, 1ml of the culture was inoculated into a 500ml Erlenmeyer flask containing 100ml of seed culture (LB liquid) and incubated at 37°C for 8-10 hours at 200rpm. 200ml of the seed culture was then inoculated into a 5L fermenter (BIOTECH-5JG) containing 2L of fermentation medium. Feed-on-feed medium was added in batches, and the fermentation was continued for 50-100 hours. During fermentation, the glucose concentration was maintained at 2–10g / L using feed-on-feed. The dissolved oxygen (DO) level was controlled at approximately 20% during fermentation using a stirred-coupled dissolved oxygen (DO) mode. The stirring speed was maintained at 300–800 rpm, and the aeration rate at 1–2 vvm. The fermentation temperature was controlled at 30℃, and the pH was adjusted to 6.75–6.80 using 50% ammonia. The culture medium composition is shown in Table 9. An amino acid analyzer determined the concentration of O-acetyl-L-homoserine in the fermentation broth to be 47.2 g / L. Figure 1 As shown.

[0099] Table 9. Culture medium formulation (solvent: deionized water, pH 6.8)

[0100] composition Fermentation medium Feeding culture medium Glucose (g / L) 30 500 Potassium dihydrogen phosphate (g / L) 1 1 Ammonium chloride (g / L) 3.43 3.43 Peptone (g / L) 6.82 6.82 L-Threonine (g / L) 0.5 4 L-methionine (g / L) 0.2 1 L-Lysine (g / L) 0.1 0.5 <![CDATA[MgSO4(g / L)]]> 2 / <![CDATA[FeSO4(g / L)]]> 0.005 / <![CDATA[MnSO4(g / L)]]> 0.005 / <![CDATA[ZnSO4(g / L)]]> 0.005 /

[0101] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A recombinant *Escherichia coli* producing O-acetyl-L-homoserine, characterized in that: It is constructed using the following methods: (1) with E. coli W3110 ΔmetIJBΔthrBΔmetAΔtdcCTrc - metL - thrA - rhtA The bacteria are called "chamber bacteria," which are Escherichia coli. E. coli W3110 encodes the L-methionine transport protein metI Genes encoding negative regulatory repression factors metJ Gene, encoding cystathionine γ synthase metB Genes encoding homoserine kinase thrB Gene, encoding homoserine-O-succinyltransferase metA Genes and encoding L-homoserine transport proteins tdcC After the genes were knocked out sequentially, the genes encoding homoserine dehydrogenase I were then separately... thrA Gene encoding homoserine dehydrogenase II metL Genes and encoding L-homoserine efflux proteins rhtA The promoters of the genes were all replaced with Ptrc The promoter was obtained; in the chassis bacteria artP Gene locus insertion metX Genes were obtained to obtain the recombinant strain OAH1; (2) The genome of strain OAH1 obtained in step (1) patZ Gene knockout yielded recombinant strain OAH2; (3) The strain OAH obtained in step (2) 2 In the genome cspC Gene knockout yielded recombinant strain OAH3; (4) The genome of strain OAH3 obtained in step (3) yahK Gene knockout yielded recombinant strain OAH4; (5) The genome of strain OAH4 obtained in step (4) yahK Gene locus insertion ppnK Genes were used to obtain the recombinant strain OAH5; And, (6) the genome of strain OAH5 obtained in step (5) acs Gene promoter replacement with Ptrc The promoter was used to obtain the recombinant Escherichia coli producing O-acetyl-L-homoserine, wherein: The artP The gene nucleotide sequence is shown in SEQ ID NO.

1. metX The gene nucleotide sequence is shown in SEQ ID NO.

3. patZ The gene nucleotide sequence is shown in SEQ ID NO.

5. cspC The gene nucleotide sequence is shown in SEQ ID NO.

7. yahK The nucleotide sequence is shown in SEQ ID NO.

9. ppnK The gene nucleotide sequence is shown in SEQ ID NO.

11. acs The gene nucleotide sequence is shown in SEQ ID NO.

13.

2. The recombinant Escherichia coli as described in claim 1, characterized in that: The Ptrc The promoter nucleotide sequence is shown in SEQ ID NO.

16.

3. The application of the recombinant Escherichia coli as described in claim 1 in the microbial fermentation preparation of O-acetyl-L-homoserine.

Citation Information

Patent Citations

  • Recombinant escherichia coli capable of high-yielding L-homoserine and application thereof

    CN109055290A

  • Recombinant escherichia coli with high yield of L-homoserine as well as construction method and application of recombinant escherichia coli

    CN116622607A

  • Recombinant escherichia coli with high yield of O-acetyl-L-homoserine and application of recombinant escherichia coli

    CN117511837A