Diagnostic markers for distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma and their application

Abstract

The present invention discloses a diagnostic marker for distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma and application thereof; the biomarker comprises any one or more CpG sites of 137999bp, 138017bp, 138035bp, 138059bp, 138073bp, 138083bp, 138088bp, 138096bp, 138113bp and 138149bp in the EB virus BILF2 gene fragment, and primers and probes are specifically designed for the methylation sites; ROC analysis shows that the marker has very high specificity and sensitivity, has diagnostic value, can be used to distinguish nasopharyngeal carcinoma from nasal NK / T cell lymphoma or non-nasopharyngeal carcinoma patients, and improves the diagnostic efficiency of nasopharyngeal carcinoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a diagnostic marker for distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma and an application thereof. Background Art

[0002] Nasopharyngeal carcinoma, also known as Guangdong cancer, is prevalent in southern China. Currently, the diagnosis of nasopharyngeal carcinoma is mainly performed clinically through nasopharyngeal endoscopy, imaging scans (such as CT, MRI, etc.), tissue biopsy, etc. However, the symptoms of early nasopharyngeal carcinoma are not obvious and non-specific (such as bloody nose, sore throat, difficulty swallowing, headache, tinnitus or pain, etc.), and are often ignored by patients, which leads to most patients having progressed to the late stage when diagnosed, greatly affecting the patient's prognosis. Therefore, carrying out convenient and effective early screening in high-incidence areas is of great significance to increase the early diagnosis rate of nasopharyngeal carcinoma and improve patient prognosis.

[0003] Nasal NK / T-cell lymphoma is a rapidly growing type of non-Hodgkin lymphoma that is common in Asia. This lymphoma usually occurs in organs or tissues other than lymph nodes, most commonly in the nasal cavity, but can also affect the sinuses or upper throat. The most common initial symptoms of patients with this disease are nasal congestion, runny nose, and blood in the nose, followed by edema and ulcerative necrotic lesions, mainly affecting the nasal mucosa, nasal septum, paranasal sinuses and nasopharynx. Clinically, imaging and pathological biopsy are usually used for diagnosis.

[0004] Since NPC originates from the nasopharynx, non-invasive and efficient sampling of the nasopharynx and detection of corresponding molecular markers can more directly reflect the condition of the lesion site, and in theory can timely detect early primary or recurrent NPC patients. Using nasopharyngeal swabs to collect nasopharyngeal samples is a feasible technical solution. Related studies have been conducted in South China, Indonesia, Canada and other countries or regions, that is, using nasopharyngeal brushes or nasopharyngeal swabs to collect samples from suspicious parts of the nasopharynx, and then using q-PCR to test the Epstein-Barr virus DNA load to determine whether NPC is present. Since nasopharyngeal swabs are a method that can directly obtain samples from lesions in the nasopharynx, it not only has the advantages of being painless and non-invasive, but also the exfoliated cells obtained can directly reflect the characteristics of nasopharyngeal tumors. Therefore, it has received widespread attention in the early screening and diagnosis of NPC.

[0005] However, the occurrence and development of both nasopharyngeal carcinoma and nasal NK / T cell lymphoma are closely related to Epstein-Barr virus infection. At the same time, due to the same site of onset and similar clinical manifestations, it is difficult to distinguish between the two diseases by only testing the Epstein-Barr virus load through nasopharyngeal swab sampling.

[0006] Although the exact mechanism of the disease is still unclear, current studies have found that the methylation patterns of EB virus vary in different EB virus-related tumors, suggesting that nasopharyngeal carcinoma and nasal NK / T cell lymphoma can be differentially diagnosed from the perspective of EB virus methylation. Summary of the invention

[0007] The object of the present invention is to provide a biomarker that can effectively distinguish nasopharyngeal carcinoma from nasal NK / T cell lymphoma and diagnose nasopharyngeal carcinoma.

[0008] The technical solution adopted by the present invention is:

[0009] In a first aspect of the present invention, a methylation biomarker combination is provided, wherein the methylation biomarker comprises all or part of the CpG sites in the BILF2 gene fragment of the Epstein-Barr virus.

[0010] Preferably, the methylation biomarker includes any one or more CpG sites of 137999bp, 138017bp, 138035bp, 138059bp, 138073bp, 138083bp, 138088bp, 138096bp, 138113bp, and 138149bp on the BILF2 gene fragment of Epstein-Barr virus (NC_007605.1).

[0011] Preferably, the methylation biomarkers include CpG sites at 138035 bp, 138059 bp, 138073 bp and 138149 bp on the EB virus BILF2 gene fragment.

[0012] Preferably, the BILF2 gene fragment is NC_007605.1:137464-138282.

[0013] The second aspect of the present invention provides the use of a reagent for detecting the methylation level of the marker described in the first aspect of the present invention in preparing a product, wherein the function of the product is any one of the following;

[0014] (1) Diagnosis of nasopharyngeal carcinoma;

[0015] (2) Differentiate between nasopharyngeal carcinoma and nasal NK / T-cell lymphoma.

[0016] Preferably, the reagents for detecting the methylation level of the marker include reagents for detecting the methylation level of the marker by at least one of methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution melting curve method, methylation-sensitive restriction endonuclease method and fluorescence quantitative method.

[0017] Preferably, the reagents include primers and probes.

[0018] Preferably, the sequence of the primer includes:

[0019] Methylation upstream primer: TGGAAGTAGTTACGGTTAAGG (SEQ ID NO. 1);

[0020] Methylation downstream primer: TCACCGCCCATACAAATACTA (SEQ ID NO. 2);

[0021] Unmethylated upstream primer: TTGGAAGTAGTTATGGTTAAGG (SEQ ID NO. 3);

[0022] Non-methylated downstream primer: TCACCACCCATACAAATACTAA (SEQ ID NO. 4).

[0023] Preferably, the sequence of the probe comprises:

[0024] Methylation probe: ATTTTCGGGAGTGTATTTTCGGTTT (SEQ ID NO. 5);

[0025] Unmethylated probe: TATTTTTGGGAGTGTATTTTTGGTTTA (SEQ ID NO. 6).

[0026] Preferably, both ends of the probe are labeled with a fluorescent reporter gene and a fluorescent quencher gene, respectively.

[0027] Preferably, the 5' end of the probe is labeled with a fluorescent reporter gene, and the 3' end is labeled with a fluorescent quencher gene.

[0028] Preferably, the fluorescence reporter gene is selected from at least one of FAM, HEX, ROX, CY5, CY3, and VIC; and the fluorescence quencher gene is selected from at least one of BHQ1, BHQ2, BHQ3, and MGB.

[0029] Preferably, the product includes at least one of a reagent, a test kit, a test paper, and a chip.

[0030] The third aspect of the present invention provides a kit, which includes a reagent for detecting the marker described in the first aspect of the present invention.

[0031] Preferably, the functions of the kit are at least one of the following:

[0032] (1) Diagnosis of nasopharyngeal carcinoma;

[0033] (2) Differentiate between nasopharyngeal carcinoma and nasal NK / T-cell lymphoma.

[0034] Preferably, the reagents for detecting the methylation level of the marker include reagents for detecting the methylation level of the marker by at least one of methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution melting curve method, methylation-sensitive restriction endonuclease method and fluorescence quantitative method.

[0035] Preferably, the reagents include primers and probes.

[0036] Preferably, the sequence of the primer includes:

[0037] Methylation upstream primer: TGGAAGTAGTTACGGTTAAGG (SEQ ID NO. 1);

[0038] Methylation downstream primer: TCACCGCCCATACAAATACTA (SEQ ID NO. 2);

[0039] Unmethylated upstream primer: TTGGAAGTAGTTATGGTTAAGG (SEQ ID NO. 3);

[0040] Non-methylated downstream primer: TCACCACCCATACAAATACTAA (SEQ ID NO. 4).

[0041] Preferably, the sequence of the probe comprises:

[0042] Methylation probe: ATTTTCGGGAGTGTATTTTCGGTTT (SEQ ID NO. 5);

[0043] Unmethylated probe: TATTTTTGGGAGTGTATTTTTGGTTTA (SEQ ID NO. 6).

[0044] Preferably, the product includes at least one of a reagent, a test kit, a test paper, and a chip.

[0045] A fourth aspect of the present invention provides a system for diagnosing nasopharyngeal carcinoma or distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma, comprising:

[0046] A detection module, used to detect the methylation level of the marker described in the first aspect in a sample;

[0047] Analysis module: used to obtain the above test results and determine the diagnosis results according to predetermined rules.

[0048] Preferably, the predetermined rule is specifically: dividing the data into a high methylation group and a low methylation group based on the cutoff value, determining whether the sample to be tested is nasopharyngeal carcinoma by comparing the relative size of the methylation level of the sample to be tested and the cutoff value; if the methylation level is greater than the cutoff value, it is diagnosed as nasopharyngeal carcinoma; if the methylation level is lower than the cutoff value, it is diagnosed as nasal NK / T cell lymphoma or non-nasopharyngeal carcinoma.

[0049] Preferably, the sample is selected from at least one of nasopharyngeal swab, plasma, serum, whole blood, saliva, tissue, cell sample, urine, and feces.

[0050] The beneficial effects of the present invention are:

[0051] The present invention screens out highly sensitive and specific methylation sites by performing EB virus methylation analysis on samples of nasopharyngeal carcinoma and nasal NK / T cell lymphoma, including 137999bp, 138017bp, 138035bp, 138059bp, 138073bp, 138083bp, 138088bp, 138096bp, 138113bp and 138149bp sites on the EB virus BILF2 gene fragment; it can be used as a diagnostic marker for distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma; the inventor also designs primers and probes for the methylation sites. Through ROC analysis, it is found that it has very high specificity and sensitivity, has diagnostic value, can be used to distinguish nasopharyngeal carcinoma from nasal NK / T cell lymphoma or non-nasopharyngeal carcinoma patients, and improves the diagnostic efficiency of nasopharyngeal carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 Epstein-Barr virus methylation levels in patients with nasopharyngeal carcinoma (NPC) and nasal NK / T-cell lymphoma (NKTCL).

[0053] Figure 2 The figure is a mountain plot of the methylation density distribution of Epstein-Barr virus in samples of nasopharyngeal carcinoma (NPC) and nasal NK / T-cell lymphoma (NKTCL) patients.

[0054] Figure 3 The figure is a heat map based on the methylation density of the EBV gene.

[0055] Figure 4 A heat map of the methylation density of CpG sites with significant differences between the two groups was drawn after comparing the methylation density of CpG sites between the two groups and performing a rank sum test.

[0056] Figure 5 The results of intergroup comparison of EB virus BILF2 gene methylation density in nasopharyngeal carcinoma (NPC) and nasal NK / T cell lymphoma (NKTCL); Figure 5A is a scatter plot of inter-group comparison of the overall methylation density of the BILF2 gene; Figure 5 B is a scatter plot comparing the methylation density of each CpG site on the BILF2 gene between groups.

[0057] Figure 6 This is the qPCR validation result of the differential sites on the BILF2 gene; Figure 6 A is the scatter plot of EBV load among the three groups. Figure 6 B is a scatter plot comparison of ML levels in the regions measured by BILF2.

[0058] Figure 7 is the ROC curve. DETAILED DESCRIPTION

[0059] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0060] Example 1 Epstein-Barr virus methylation capture sequencing of nasopharyngeal carcinoma and nasal NK / T cell lymphoma

[0061] Epstein-Barr virus methylation capture sequencing was performed on nasopharyngeal swab samples from 6 patients with nasopharyngeal carcinoma (NPC) and 3 patients with nasopharyngeal NK / T cell lymphoma (NKTCL). After quality control filtering, a total of 3,683 CpG sites were successfully captured in all samples and included in subsequent analysis. The sequencing results showed:

[0062] (1) From the perspective of the average methylation level of EB virus, both groups of samples were high, but the EB virus methylation level in NPC samples was slightly higher than that in NKTCL samples ( Figure 1 );

[0063] (2) From the distribution of EBV methylation levels Figure 2 ), the vast majority of sites in the sample are in a high methylation state, and very few sites are in a low methylation or unmethylated state, with similar distributions in NPC and NKTCL samples. However, more sites in NPC are in a high methylation state (the mountain graph shows that the peak is after the methylation density is >80%, and the mountain is high and narrow); while there are relatively few high methylation sites in NKTCL samples (the mountain graph shows that although the peak is after the methylation density is >80%, the mountain is short and wide, and the peak corresponding to the methylation density of 0% is higher than that in NPC samples).

[0064] (3) The captured sites were annotated to the EB virus gene, the methylation density of the EB virus gene was obtained and a heat map was drawn. The results showed that the methylation patterns of EB virus in samples from the same tumor were similar, but there were differences in methylation patterns in samples from different tumors ( Figure 3 ).

[0065] Example 2 Screening of differential sites

[0066] The above results suggest that there are methylation differences in Epstein-Barr virus in nasopharyngeal swab samples of NPC and NKTCL, so the methylation density of the 3,683 captured CpG sites was compared between groups and a rank sum test was performed. The results showed that the differences between the groups in 288 sites were statistically significant (P<0.05), and 70 of them were significantly different between the two groups (the median methylation density difference between the two groups was ≥50%). Most sites (64 / 70) were highly methylated in NPC samples. Among these sites, the number of sites annotated to the BILF2 gene was the largest, with 11, so the focus was on the CpG sites on this gene ( Figure 4 ).

[0067] The BILF2 gene (NC_007605.1:137464-138282) is 819 bp in length and contains 27 CpG sites on the positive strand, all of which were successfully captured in this capture sequencing. Based on the overall methylation density of the gene, NPC is much higher than NKTCL; the results of the inter-group comparison of each site showed that the differences in the last 10 adjacent CpG sites of the gene between the two groups were very significant (including sites on 137999bp, 138017bp, 138035bp, 138059bp, 138073bp, 138083bp, 138088bp, 138096bp, 138113bp, 138149bp) ( Figure 5 ).

[0068] Example 3 qPCR verification of significant difference sites

[0069] Using nasopharyngeal swab samples from 63 NPC patients, 9 NKTCL patients and 50 non-NPC controls, qPCR was performed on the regions where the four CpG sites of 138035 bp, 138059 bp, 138073 bp and 138149 bp in the BILF2 gene were located. The primers, probes, PCR reaction system and conditions were as follows:

[0070] Primer probe sequences:

[0071] Methylation upstream primer: TGGAAGTAGTTACGGTTAAGG (SEQ ID NO. 1);

[0072] Methylation downstream primer: TCACCGCCCATACAAATACTA (SEQ ID NO. 2);

[0073] Unmethylated upstream primer: TTGGAAGTAGTTATGGTTAAGG (SEQ ID NO. 3);

[0074] Non-methylated downstream primer: TCACCACCCATACAAATACTAA (SEQ ID NO. 4);

[0075] Methylation probe: FAM-ATTTTCGGGAGTGTATTTTCGGTTT-BHQ1 (SEQ ID NO. 5);

[0076] Unmethylated probe: HEX-TATTTTTGGGAGTGTATTTTTGGTTTA-BHQ1 (SEQ ID NO. 6).

[0077] Amplification reaction system:

[0078] Each sample was subjected to methylation and non-methylation amplification reactions, and each amplification reaction system was 20 μL. The methylation amplification reaction system contained: 10 μL qPCR mixture, 0.75 μL methylated upstream primer, 0.75 μL methylated downstream primer, 0.8 μL methylated Taqman probe, 6.7 μL ddH2O, and 1 μL bisulfite-converted DNA; the non-methylation amplification reaction system contained: 10 μL qPCR mixture, 0.75 μL non-methylated upstream primer, 0.75 μL non-methylated downstream primer, 0.8 μL non-methylated Taqman probe, 6.7 μL ddH2O, and 1 μL bisulfite-converted DNA.

[0079] Amplification reaction conditions:

[0080] Pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 15 seconds, annealing and extension at 58°C for 60 seconds, 45 cycles; cooling at 40°C for 30 seconds.

[0081] After qPCR is completed, the relative methylation level (ML) of the CpG site is calculated. The calculation formula of ML value is: -(Ct M -Ct U ). M is the Ct value after amplification of the site in the methylation amplification system, Ct UIt is the Ct value after amplification of the site in the non-methylated amplification system. If only one of the Ct values ​​is detected after qPCR is completed for the sample, the other Ct value is defined as 45 and substituted into the calculation formula to calculate the relative methylation degree. If neither Ct value is detected after qPCR is completed for the sample, the sample is defined as a test failure.

[0082] Test results such as Figure 6 As shown: Figure 6 A is the scatter plot of EBV load among the three groups. Figure 6 B is a scatter plot comparison of ML levels in the regions measured by BILF2;

[0083] Two NKTCL, four NPC and 30 control samples failed the test due to low EBV load. The test results of the remaining 7 NKTCL, 59 NPC and 20 control samples showed that only non-methylated products could be detected in most (6 / 7) NKTCL patient samples, while only methylated products could be detected in most (50 / 59) NPC patient samples. The mean ML value of the NKTCL group was -5.39, while that of the NPC group was 15.08. The difference between the two groups was significant and statistically significant (Table 1).

[0084] Table 1

[0085]

[0086] Example 4: Constructing a differentiation model

[0087] The ML obtained by qPCR was used as a model indicator to distinguish between groups, and the ROC curve was drawn and the area under the curve (AUC) was calculated, and compared with the differentiation model constructed by EBV load. The results showed that the AUC of the NPC and NKTCL differentiation model using ML as an indicator reached 0.965; when the optimal cutoff value obtained by ROC analysis was used as the cutoff value (COV = 7.27), the model sensitivity and specificity were 0.810 and 1.000, respectively ( Figure 7 and Table 2); the AUC of the differentiation model constructed with EBV load was 0.765, and the sensitivity and specificity were 0.508 and 1.000, respectively. In the diagnosis of NPC, the AUC of the diagnostic model with ML as the indicator was 0.935, the sensitivity was 0.810, and the specificity was 0.966; the AUC of the diagnostic model with EBV load as the indicator was 0.909, the sensitivity was 0.810, and the specificity was 0.932. The above results suggest that the BILF2 ML indicator can effectively distinguish NPC from NKTCL, and is superior to the EBV load indicator; it is also superior to the EBV load diagnostic model in distinguishing NPC from non-NPC controls.

[0088] Table 2

[0089]

[0090]

[0091] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a reagent for detecting the methylation level of a marker combination in the preparation of a product, wherein the function of the product is any of the following; (1) Diagnosis of nasopharyngeal carcinoma; (2) Differentiate between nasopharyngeal carcinoma and nasal NK / T-cell lymphoma; The marker combination is CpG sites of 138035 bp, 138059 bp, 138073 bp and 138149 bp on the Epstein-Barr virus genome, and the Epstein-Barr virus genome is NC_007605.

1.

2. The use according to claim 1, characterized in that: The test sample of the product is selected from nasopharyngeal swabs.

3. The use according to claim 1, characterized in that: The reagents for detecting the methylation level of the marker include reagents for detecting the methylation level of the marker by at least one of methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution melting curve method, methylation-sensitive restriction endonuclease method and fluorescence quantitative method.

4. The use according to claim 3, characterized in that: The reagents include primers and probes; The sequences of the primers are: Methylation upstream primer: TGGAAGTAGTTACGGTTAAGG; Methylation downstream primer: TCACCGCCCATACAAATACTA; Unmethylated upstream primer: TTGGAAGTAGTTATGGTTAAGG; Unmethylated downstream primer: TCACCACCCATACAAATACTAA; The sequence of the probe is: Methylation probe: ATTTTCGGGAGTGTATTTTCGGTTT; Unmethylated probe: TATTTTTGGGAGTGTATTTTTGGTTTA.

5. The use according to any one of claims 1 to 4, characterized in that: The product includes at least one of a reagent, a test paper, and a chip.

6. A system for diagnosing nasopharyngeal carcinoma or distinguishing nasopharyngeal carcinoma from nasal NK / T cell lymphoma, comprising: A detection module, used to detect the methylation level of the marker combination in the sample; Analysis module: used to obtain the above test results and determine the diagnosis results according to predetermined rules; The marker combination is CpG sites of 138035 bp, 138059 bp, 138073 bp and 138149 bp on the EB virus genome; The EB virus genome is NC_007605.

1.

7. The system according to claim 6, characterized in that: When the system is used to diagnose nasopharyngeal carcinoma, the predetermined rule is specifically: if the methylation level is greater than the cutoff value, it is diagnosed as nasopharyngeal carcinoma; if the methylation level is lower than the cutoff value, it is diagnosed as non-nasopharyngeal carcinoma; When the system is used to distinguish between nasopharyngeal carcinoma and nasal NK / T cell lymphoma, the predetermined rule is specifically: if the methylation level is greater than the cutoff value, it is diagnosed as nasopharyngeal carcinoma; if the methylation level is lower than the cutoff value, it is diagnosed as nasal NK / T cell lymphoma.

8. The system according to claim 6, characterized in that The sample was selected from a nasopharyngeal swab.

Images