Use of tgme49_229320 protein in preparation of toxoplasmosis diagnostic kit

An indirect ELISA method established using the Toxoplasma gondii TGME49_229320 protein solves the problem of the inability to identify the infection route of Toxoplasma gondii oocysts in existing technologies, enabling rapid, simple, and highly sensitive diagnosis of toxoplasmosis, suitable for large-scale testing.

CN116559441BActive Publication Date: 2026-04-28HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310515110.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-04
Publication Date
2026-04-28
Estimated Expiration
2043-05-04

AI Technical Summary

Technical Problem

Existing diagnostic methods for toxoplasmosis lack antigens that can identify the route of infection, and the ELISA method is insufficient in detecting Toxoplasma gondii oocyst infection, failing to meet the demand for rapid, convenient, and large-scale testing.

Method used

Using the Toxoplasma gondii TGME49_229320 protein as a candidate antigen, a diagnostic kit for identifying the route of Toxoplasma gondii oocyst infection was developed by detecting oocyst-specific antibodies in porcine serum via an indirect ELISA method. The kit includes steps such as preparing the ELISA plate, blocking, incubation, and color development, and the conditions were optimized to improve detection efficiency.

Benefits of technology

It achieves specific detection of Toxoplasma gondii oocyst infection, with high sensitivity and rapid and simple operation. It can process a large number of samples in a short time and has no cross-reactivity with other swine diseases, making it suitable for on-site testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116559441B_ABST
    Figure CN116559441B_ABST
Patent Text Reader

Abstract

The application discloses application of a Toxoplasma gondii TGME49_229320 protein in preparation of a Toxoplasma gondii diagnosis kit, a nucleotide sequence of a coding gene of the Toxoplasma gondii TGME49_229320 protein is shown as SEQ ID NO:1, and the application further discloses a Toxoplasma gondii diagnosis kit and an indirect ELISA method for detecting Toxoplasma gondii for non-diagnosis purposes, and belongs to the field of molecular biology.The application provides more candidate antigens for pathogen detection and prevention and control of Toxoplasma gondii, and the established method can specifically detect antibody serum of Toxoplasma gondii oocyst infection, and has the advantages of good accuracy, strong sensitivity and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of the Toxoplasma gondii TGME49_229320 protein in the preparation of diagnostic kits for toxoplasmosis. This invention also relates to a diagnostic kit for toxoplasmosis established using the TGME49_229320 protein and an indirect ELISA method, belonging to the field of molecular biology. Background Technology

[0002] Toxoplasma gondii (Nicolle & Mancea 1908), commonly known as Toxoplasma gondii, belongs to the class Sporozoa, order Eucochytozoa, and family Toxoplasmidae. It is the pathogen of toxoplasmosis. Toxoplasma gondii can infect more than 140 animal species, including humans. Its definitive host is felines. In cats, Toxoplasma gondii reproduces by schizogony in the epithelial cells of the small intestine, forming schizonts. Some schizonts transform into gametophytes (microgametes and macrogametes), which combine to form oocysts. These oocysts are excreted in the feces and, under suitable conditions, transform into infective oocysts after 2-4 days. Pigs are a major host for Toxoplasma gondii infection. Clinical symptoms mainly include a short-term increase in body temperature, decreased appetite, difficulty breathing, dry feces, dark yellow urine, and purple clots on the abdomen. Severe cases may present with vomiting and diarrhea, and pregnant sows may experience abortion. There are two main ways pigs become infected with Toxoplasma gondii. The first is through ingesting food, feed, and water contaminated with oocysts; the second is through ingesting infected mice. In the intermediate host, Toxoplasma gondii exists as cysts, and the host remains a carrier for life. Another, less common route of infection is through infection of sows during pregnancy, resulting in congenital carrier status in piglets. Toxoplasmosis is prevalent in pigs in my country, with an average infection rate of approximately 40%. From a farming environment perspective, the infection rate is higher in small-scale farms than in large-scale farms, and multiparous sows are more susceptible to infection with more litters. Geographical location, age, sex, feeding methods, and the presence of cats in the surrounding environment all significantly influence the positive rate.

[0003] Currently, the main methods for detecting toxoplasmosis include etiological detection, molecular biological detection, and serological methods. Etiological diagnosis is the most direct diagnostic method. Toxoplasma gondii oocysts in feces, water, and soil, as well as parasites or eggs in diseased tissues, can be directly observed using an optical microscope. This method is accurate and reliable, but time-consuming, labor-intensive, has a low detection rate, and is not suitable for large-scale testing. Molecular biological methods mainly include PCR, which involves designing Toxoplasma gondii-specific primers to amplify Toxoplasma gondii fragments. This method is sensitive and specific, and is an important tool for laboratory diagnosis of toxoplasmosis. Serological methods utilize immunological reactions to detect Toxoplasma gondii antibodies or antigens, and mainly include MAT (modified agglutination assay), WB (Western blot assay), IFA (indirect immunofluorescence assay), and ELISA (enzyme-linked immunosorbent assay). Among these, ELISA has high sensitivity and specificity, can detect large batches of samples in a short time, is easily automated, is fast and simple, requires no special operator skills, and is suitable for epidemiological and field investigations, thus receiving widespread attention.

[0004] ELISA methods rely on specific antibodies or antigens. Currently, there are reports of using Toxoplasma gondii micronematodes, rod-shaped bodies, membrane surface proteins, and dense granular proteins as candidate antigens for toxoplasmosis. For example, Bai Bing et al. prepared polyclonal antibodies using the TGME49_209950 protein and achieved specific detection of the target antigen; Zhao Xu et al. constructed the TGME49_229480 recombinant protein and detected the differences in transcription and expression levels of this protein in different strains of Toxoplasma gondii. Overall, the number of antigens currently available for the diagnosis and detection of toxoplasmosis is still limited and cannot meet practical needs. Furthermore, most antigens reported in existing literature can only detect whether serum samples are positive for Toxoplasma gondii and cannot be used to identify the route of infection.

[0005] The TGME49_229320 protein is annotated on ToxoDB as having phosphoglycolate phosphatase activity and belongs to the Cof family of hydrolases (https: / / toxodb.org / toxo / app / ). Research on the function of this protein in the field of Toxoplasma gondii is still lacking. TGME49_229320 is a protein highly expressed during the oocyst stage of Toxoplasma gondii and can identify the oocyst infection route of toxoplasmosis. This invention utilizes this protein to establish an iELISA method that can identify oocyst-specific antibodies in porcine serum, thereby helping farms to rationally and effectively plan toxoplasmosis prevention and control efforts. Summary of the Invention

[0006] The primary objective of this invention is to provide the application of Toxoplasma gondii TGME49_229320 protein in the preparation of diagnostic kits for toxoplasmosis.

[0007] A second objective of this invention is to provide a diagnostic kit for toxoplasmosis.

[0008] A third objective of this invention is to provide an indirect ELISA method for toxoplasmosis that can identify the source of infection.

[0009] To achieve the above objectives, the applicant extracted total RNA from *Toxoplasma gondii* tachyzoites, reverse transcribed it to obtain cDNA, designed primers based on the TGME49_229320 gene sequence, amplified the target fragment using PCR, and ligated the target fragment into the pET28a vector using homologous recombination. After PCR identification and sequencing verification, the constructed pET28a-229320 plasmid was transformed into *E. coli* BL21(DE3) for expression. The pET28a-229320 expression strain was expanded and cultured, induced, and purified to obtain the *Toxoplasma gondii* Cof family hydrolase subfamily protein TGME49_229320. The nucleotide sequence of the gene encoding this protein is shown in SEQ ID NO: 1.

[0010] Western blot analysis showed that the TGME49_229320 protein reacts with positive swine serum infected with Toxoplasma gondii oocysts to generate the target band, but does not react with positive swine serum infected with Toxoplasma gondii tachyzoites. Therefore, this protein can be used to prepare an indirect enzyme-linked immunosorbent assay (ELISA) kit for Toxoplasma gondii oocyst infection and for the ELISA detection of IgG antibodies against Toxoplasma gondii oocyst infection.

[0011] By optimizing the ELISA conditions using TGME49_229320 protein as a candidate antigen, an indirect enzyme-linked immunosorbent assay (ELISA) method for detecting Toxoplasma gondii IgG antibodies was obtained. This method includes the following steps:

[0012] 1) Dilute the Toxoplasma gondii TGME49_229320 protein and coat it onto an ELISA plate;

[0013] 2) Block the ELISA plate with blocking solution;

[0014] 3) Dilute the serum sample and add it to the ELISA plate, then incubate at 37°C for 30-90 minutes;

[0015] 4) Dilute the enzyme-labeled secondary antibody and add it to the ELISA plate, then incubate at 37°C for 30-90 minutes;

[0016] 5) Add the colorimetric solution and perform the colorimetric reaction at 37°C in the dark. After the reaction is completed, take a reading at a wavelength of 630 nm.

[0017] Preferably, the final concentration of the Toxoplasma gondii TGME49_229320 protein is 2 μg / mL; the serum sample is diluted 200 times.

[0018] Preferably, the blocking solution is 1% bovine serum albumin, and the blocking time is 60 minutes.

[0019] Preferably, the enzyme-labeled secondary antibody is HRP-labeled goat anti-pig IgG.

[0020] The beneficial effects of this invention are:

[0021] This invention marks the first time that the Toxoplasma gondii TGME49_229320 protein has been used to detect the pathogen of toxoplasmosis, and a successful indirect ELISA method has been established. This invention provides more candidate antigens for the detection and control of Toxoplasma gondii. The established method can specifically detect antibody serum infected with Toxoplasma gondii oocysts, and also has the advantages of high sensitivity, speed, and simplicity, as detailed below:

[0022] In terms of sensitivity, the detection method established in this invention has a sensitivity greater than 1:400, which meets the needs of on-site testing.

[0023] In terms of specificity, the detection method established in this study showed no cross-reactivity with positive sera for classical swine fever, porcine reproductive and respiratory syndrome (PRRS), pseudorabies, porcine circovirus disease, foot-and-mouth disease, and Toxoplasma gondii tachyzoites.

[0024] This invention can process a large number of samples in a short time and can directly determine whether a sample is positive or negative for Toxoplasma gondii based on the size (ratio) of the readings. It has the advantages of being fast and convenient.

[0025] For more detailed technical solutions, please refer to the specific embodiments. Of course, the technical solutions of the present invention are not limited to the embodiments. Based on the functional characteristics of the TGME49_229320 protein reported by the present invention, those skilled in the art can also use the protein for other research without creative effort. For example, the protein can be used to prepare antibodies and perform direct ELISA detection on antigens. These improvements without creative effort are also within the protection scope of the present invention. Attached Figure Description

[0026] Figure 1 This is the PCR amplification result of the Toxoplasma gondii 229320 coding sequence. In the figure: lane M: DNA molecular weight standard; lane 1: 229320 coding sequence amplification product.

[0027] Figure 2 This is the identification result of recombinant plasmid pET28a-229320. In the figure: lane M: protein standard; 1-5: pET28a-229320 plasmid digestion products; 6: negative control.

[0028] Figure 3 The results are SDS-PAGE analysis of the pET28a-229320 expression product. In the figure: lane M: molecular weight standard; 1: uninduced; 2: induced at 37℃ for 4h; 3: induced at 16℃ for 4h; 4: induced at 16℃ for 16h.

[0029] Figure 4 This is the SDS-PAGE analysis result of the pET28a-229320 expression product. In the figure: lane M: protein molecular weight standard; 1: supernatant; 2: inclusion bodies.

[0030] Figure 5 This is the Western blot purification result of the pET28a-229320 expression product. In the figure: lane M: protein molecular weight standard; 1: purified His-229320.

[0031] Figure 6 This is the Western blot result for the usability assessment of pET28a-229320. In the figure: lane M: protein molecular weight standard; 1: oocyst-positive porcine serum; 2: tachyzoite-positive porcine serum. Detailed Implementation

[0032] Example 1: Preparation of TGME49_229320 protein

[0033] Total RNA was extracted from the tachyzoites of Toxoplasma gondii ME49 strain, and cDNA was obtained using a TransGen reverse transcription kit. Primers were designed using SnapGene molecular cloning software to amplify the target fragment using PCR. The fragment was then ligated into the pET28a vector using homologous recombination. After PCR identification and sequencing verification, the constructed pET28a-229320 plasmid was transformed into Escherichia coli BL21(DE3) for expression.

[0034] 1. Obtaining the target fragment TGME49_229320

[0035] (1) Extraction of Total RNA from Toxoplasma gondii Tachyzoites

[0036] Centrifuge the collected parasites, discard the supernatant, add 1 mL of Trizol to resuspend the precipitate, and mix thoroughly by pipetting. Transfer the sample to a 1.5 mL RNase-free centrifuge tube, vortex vigorously for 3 min to ensure complete lysis of the parasites, and incubate at room temperature for 10 min. Add chloroform at a ratio of 200 μL chloroform / mL Trizol, vortex vigorously for 15 sec, and incubate at room temperature for 2–3 min. Centrifuge at 12000 rpm for 15 min at 4 °C. Carefully aspirate the upper aqueous phase into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol, mix thoroughly, and incubate at room temperature for 10 min to precipitate. Centrifuge at 12000 rpm for 10 min at 4 °C, discard the supernatant; RNA will settle to the bottom of the tube as a white precipitate. Add 1 mL of 75% ethanol prepared with DEPC water, invert the centrifuge tube, and wash the precipitate. Centrifuge at 7500 rpm for 5 min at 4 °C, discarding as much supernatant as possible, and air dry in a laminar flow hood. Add 30 μL of RNase-free... The RNA precipitate was dissolved in DEPC water; the quality of the extracted total RNA was identified by 1.5% agarose gel electrophoresis, and the total RNA concentration and purity were determined by UV spectrophotometer.

[0037] (2) Preparation of Toxoplasma gondii cDNA

[0038] Take 1 μg of Total RNA and obtain cDNA using the TransGen reverse transcription kit. Add the following reactants in sequence:

[0039] Step 1: RNA template denaturation

[0040]

[0041] Heat at 65℃ for 5 minutes, then quickly place on ice and let stand for 2 minutes.

[0042] Step 2: Removal of genomic DNA

[0043]

[0044] Step 3: Gently pipette and proceed with the first-strand cDNA synthesis according to the following reaction.

[0045]

[0046] The product can be used immediately for PCR reactions, or stored at -20℃ for six months. For long-term storage, it is recommended to aliquot and store at -80℃.

[0047] (3) PCR amplification of the target fragment

[0048] The cDNA obtained from reverse transcription was used as a template for amplifying the target gene (Gene ID: 7894331). The upstream and downstream primers for this gene were designed using SnapGene molecular cloning software: 229320-F (AGCAAATGGGTCGCGGATCCATGAACGGTTTATTCTCTCGTGTTGCTTCGAC) and 229320-R (TGGTGGTGGTGGTGCTCGAGCGACTTGGAGCTGGAGTGTGCTTG). PCR amplification yielded a 942 bp band, consistent with the predicted size. The results are shown below. Figure 1 The fragment was recovered using a gel extraction kit. Based on the sequence of the commercial pET28a plasmid, upstream primer pET28a-F and downstream primer pET28a-R for amplifying the pET28a vector were designed using SnapGene software. Using the pET28a plasmid as a template, PCR amplification yielded a 5335bp band, which was then recovered using a gel extraction kit.

[0049] The PCR reaction system is as follows:

[0050]

[0051] The PCR reaction conditions are as follows:

[0052]

[0053] Steps two through four consist of a total of 35 cycles.

[0054] (4) Target fragment retrieval

[0055] Follow the instructions for the Novizan DNA Agarose Gel Extraction Kit. Extract the target fragment from a single band and place it in a 1.5 mL centrifuge tube. Add an equal volume of sol, incubate at 55°C for 10 min, inverting the tube every 5 min to mix thoroughly. Cool the melted gel to room temperature and add it to the DNA extraction column. Incubate at room temperature for 1 min. Centrifuge at 12000 rpm for 1 min at room temperature, discarding the effluent. Add 300 μL of GDP to the column, incubate for 1 minute, centrifuge at 12000 rpm for 1 min at room temperature, discarding the effluent. Add 650 μL of GDP to the extraction column. Centrifuge the GW washing buffer at 12000 rpm for 1 min at room temperature, discard the effluent from the collection tube, and repeat once. Centrifuge the empty recovery column at 12000 rpm for 2 min, discard the remaining effluent from the collection tube, place the recovery column into a new 1.5 mL centrifuge tube, and place it in a clean bench to dry it with air to evaporate any residual ethanol. Add 10–30 μL of sterile water preheated to 55 °C to the intermediate membrane of the recovery column, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min at room temperature, collect the effluent, and store it at -20 °C.

[0056] 2. Construction of pET28a-229320 plasmid

[0057] Homologous recombination was used to ligate the 229320-CDS fragment and the pET28a vector fragment. After ligation, the ligation product was transformed into *E. coli* competent cells DH5α using a heat shock method. The transformation product was plated on kanamycin-resistant LB agar plates, incubated upside down overnight, and single colonies were picked for PCR identification. The results were consistent with expectations. Figure 2 After expansion culture, plasmids were extracted and sequenced for verification. The sequencing results were compared with the CDS of the TGME49_229320 gene in the database. The two were a perfect match, with no frameshifts or mutated bases. This result proves that the recombinant expression plasmid pET28a-229320 was successfully constructed.

[0058] (1) Homologous recombination to construct plasmids

[0059] Step 1: Ligate the recovered target fragment according to the instructions of the Novizanol fragment cloning kit. The ligation system is as follows:

[0060]

[0061] After mixing the above liquids thoroughly, incubate at 37°C for 30 min in a PCR instrument. Then, take competent cells and ligation products and incubate on ice at 4°C for 5 min before transformation. The optimal amount of fragment used = [0.02 × number of fragment base pairs] ng (0.03 pmol).

[0062] Step 2: Transform the ligation product into E. coli DH5α chemocompetent cells: Add the ligation product (or plasmid), mix well, and place on ice for 5 min;

[0063] Step 3: Heat shock in a 42℃ water bath for 42 seconds, then quickly remove and place in an ice bath for 1 minute;

[0064] Step 4: Add 400 μL of antibiotic-free LB liquid medium and incubate at 37°C and 180 rpm for 45 min;

[0065] Step 5: Centrifuge at 5000 r / min for 3 min, discard 300 μL of supernatant, mix the remaining supernatant and spread it on LB plates with the corresponding resistance, invert and incubate at 37℃ for 12-16 h.

[0066] (2) Plasmid transformation

[0067] Take E. coli chemically competent cells stored at -80℃ and thaw them on ice; add ligation products (or plasmids), mix well, and place on ice for 30 min; subject them to heat shock in a 42℃ water bath for 95 sec, remove them quickly, and place them on ice for 2 min;

[0068] Add 400 μL of antibiotic-free LB liquid medium and incubate at 37℃ and 180 r / min for 60 min; take 300 μL and spread it on the corresponding antibiotic LB plate, invert it and incubate at 37℃ for 10-12 h.

[0069] 3. Expression and purification of protein 229320

[0070] The successfully constructed prokaryotic expression plasmid pET28a-229320 was transformed into *E. coli* competent strain BL21(DE3). The transformed bacterial culture was plated on kanamycin-resistant LB agar plates and incubated overnight at 37°C. Single colonies were picked and cultured to expand the culture. Four different expression conditions were set using IPTG at a final concentration of 0.1 mM: 37°C, 180 rpm for 4 h; 16°C, 180 rpm for 4 h; and 16°C, 180 rpm for 16 h. A control group without induction was also included. After the induction process, bacterial cultures from both the induced and uninduced groups were collected, the supernatant was discarded, and the samples were processed (the precipitate was resuspended in 40 μL PBS, 50 μL loading buffer and 10 μL DTT were added, and the mixture was boiled in water for 10 min). SDS-PAGE analysis was then performed, and the results are shown below. Figure 3The optimal induction time was 16℃, 180 rpm, and 16 h. A relatively thick protein band was observed at 38.8 kDa, indicating that the recombinant plasmid pET28a-229320 was successfully expressed in competent strain BL21(DE3). pET28a-229320 expressing bacteria were cultured and induced under the same conditions, followed by pressure disruption (3 cycles at 1000 bar at 4℃), centrifugation at 9000 rpm for 40 min to separate the supernatant and inclusion bodies. Samples of the supernatant and inclusion bodies were processed and then analyzed by SDS-PAGE. The results are as follows: Figure 4 The analysis results indicate that the vast majority of pET28a-229320 is expressed in the supernatant.

[0071] The pET28a-229320 expression strain was expanded and cultured. IPTG (0.1 mM) was added, and the cells were induced at 16°C for 14 h. The cells were collected by centrifugation and disrupted using a pressure lysing device. The supernatant was collected by centrifugation at 4°C and filtered through a 0.45 μm filter. The supernatant was then bound to a His-tagged affinity chromatography column for 1 h. The protein was eluted with different concentrations of imidazole, from low to high. The eluted protein was dialyzed against PBS for three days before Western blot analysis. The results are as follows: Figure 5 The protein was then encapsulated and concentrated with sucrose, and the protein concentration was measured using a BCA assay kit.

[0072] 4.229320 protein availability for Western blotting identification

[0073] The purified pET28a-229320 protein was run on two protein gels and transferred to membranes. It was then incubated overnight with standard positive swine serum from Toxoplasma gondii oocysts and standard positive swine serum from Toxoplasma gondii tachyzoites at a dilution of 1:500. Goat anti-swine HRP secondary antibody was diluted 1:5000 and incubated on a shaker at room temperature for 1 hour. Finally, ECL chromogenic buffer was added. The results are as follows. Figure 6 Positive swine serum from oocyst infection showed a clear target band, while positive swine serum from tachyzoite infection did not.

[0074] Example 2: Establishment of a rapid and accurate field diagnostic method for porcine toxoplasmosis oocyst infection (229320-iELISA)

[0075] 1. Optimized testing conditions

[0076] (1) Determination of antigen coating concentration and serum dilution factor: Protein 229320 was serially diluted at concentrations of 16 μg / mL, 8 μg / mL, 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL, and 0.25 μg / mL to coat the ELISA plate, with each concentration coating one column of 7 wells. Negative and positive control sera were diluted with insulated buffer at volume ratios of 1:25, 1:50, 1:100, 1:200, 1:400, and 1:800, with each dilution added to one row of 6 wells. Following standard ELISA procedures, OD was measured using a microplate reader. 630 The P / N values ​​of each antigen are compared, and the antigen coating concentration and serum dilution factor corresponding to the largest P / N value of the antigen are selected as the optimal conditions.

[0077] (2) Optimization of optimal blocking concentration and blocking time: The blocking concentration and blocking time were optimized according to the optimal conditions of antigen coating concentration and serum dilution factor. With other experimental conditions fixed, 0.1%, 0.5%, 1%, and 2% BSA (bovine serum albumin) were used for blocking for 30 min, 45 min, 60 min, and 75 min, respectively. The procedure was performed according to standard ELISA procedures, and the readings were recorded using a microplate reader. A line graph was plotted to compare the OD values. 630 The optimal blocking concentration and blocking time are determined by the P / N (positive serum / negative serum) value, with the value at which the P / N is highest being selected as the best conditions.

[0078] (3) Optimization of serum incubation time: Under the conditions determined above, other experimental conditions were fixed, and serum was added and incubated for 30 min, 45 min, 60 min, 75 min and 90 min respectively. The routine ELISA procedure was followed, and the serum incubation time was selected according to the P / N value.

[0079] (4) Optimization of the optimal concentration and time of the secondary antibody: Under the conditions determined above and with other experimental conditions fixed, the enzyme-labeled secondary antibody was diluted at ratios of 1:1000, 1:2000, 1:3000, and 1:4000, respectively. Following the standard ELISA procedure, the concentration of the secondary antibody was selected based on the P / N ratio. Similarly, with other experimental conditions fixed, the enzyme-labeled secondary antibody was added and incubated for 30 min, 45 min, 60 min, and 75 min, respectively. Following the standard ELISA procedure, the incubation time was selected based on the P / N ratio.

[0080] (5) Optimization of optimal substrate reaction time: With other experimental conditions fixed, the substrate was reacted for 10 min, 15 min, 20 min, 25 min and 30 min respectively. The ELISA procedure was followed and the substrate reaction time was selected according to the P / N value.

[0081] The final detection method is as follows:

[0082] 1) Dilute protein 229320 to a final concentration of 2 μg / mL with diluent and coat the microplate;

[0083] 2) Block the ELISA plate with 1% BSA blocking solution (the optimal blocking time is 60 min);

[0084] 3) Dilute the pig serum 200 times with diluent and add it to the ELISA plate, then incubate at 37°C for 75 min;

[0085] 4) Dilute the HRP-labeled goat anti-pig IgG 2000 times with diluent and add it to the ELISA plate, then incubate at 37°C for 1 hour;

[0086] 5) Add the colorimetric solution, develop the color at 37°C in the dark for 25 minutes, and finally add hydrofluoric acid to terminate the reaction. Take the reading at a wavelength of 630 nm.

[0087] 2. Determination of the cutoff value for an indirect ELISA detection kit for porcine toxoplasmosis oocyst infection.

[0088] Twenty porcine serum samples that tested negative for Toxoplasma gondii IgG antibodies by GRA1-ELISA were tested. Standard positive and negative controls were also included. Odionation was measured repeatedly. 630 The final criteria for determining the critical value of this method are as follows:

[0089] Cut-off value calculation method: S / N mean (X) + 3 standard deviations (SD)

[0090] Criteria for determining the positive / negative boundary: S / N ≥ 2.822 is considered positive; otherwise, it is considered negative.

[0091] The detailed operating steps are as follows:

[0092] Dilute 229320 protein to a final concentration of 2 μg / mL with carbonate coating buffer (pH 9.6) and coat the microplate overnight at 4°C. Wash each well three times with 200 μL PBS-T (0.01 mol / L PBS, 0.05% Tween-20, pH 7.4) wash buffer, and block with 1% BSA (bovine serum albumin) at 37°C for 60 min. Dilute serum with 0.1% BSA at a ratio of 1:200 and add 100 μL to each well, with three replicates per sample, and incubate at 37°C for 75 min. Then wash three times with PBS-T (0.01 mol / L PBS, 0.05% Tween-20, pH 7.4) wash buffer, and add 100 μL of HRP-labeled goat anti-pig IgG diluted 1:2000 to each well, and incubate at 37°C for 1 h. Add 100 μL of chromogenic solution (substrate buffer: TMB stock solution = 1:19, 0.2 μL / mL 30% hydrogen peroxide) to each well and incubate at 37°C in the dark for 25 min. Finally, add 50 μL of 0.25% hydrofluoric acid to each well to terminate the reaction and take readings at 630 nm. If sample S (sample OD) 630 ) / N (negative serum OD) 630 If the value is ≥2.822, it is considered positive; otherwise, it is considered negative.

[0093] Example 3: Sensitivity and Specificity Tests of Indirect ELISA Method for Detecting Toxoplasma gondii Oocyst Infection in Porcines

[0094] Following the method in Example 2, two positive sera were diluted 1:25, 1:50, 1:100, 1:200, 1:400, 1:800, 1:1600, and 1:3200 for detection, with positive, negative, and blank controls included. The results are shown in Table 1. The results show that the sensitivity of the 229320-iELISA diagnostic method established in this invention is greater than 1:400. The established method was used to detect positive sera for classical swine fever, porcine reproductive and respiratory syndrome (PRRS), pseudorabies, porcine circovirus disease, foot-and-mouth disease, and Toxoplasma gondii tachyzoites. The results are shown in Table 2. The results show that this method has good specificity and no cross-reactivity with positive sera for classical swine fever, PRRS, pseudorabies, porcine circovirus disease, foot-and-mouth disease, and Toxoplasma gondii tachyzoites. Positive, negative, and blank controls were also included.

[0095] Table 1. Results of Sensitivity Tests

[0096]

[0097] Table 2 Results of Specificity Tests

[0098]

Claims

1. Application of Toxoplasma gondii TGME49_229320 protein in the preparation of a diagnostic kit for toxoplasmosis, wherein the nucleotide sequence of the gene encoding the Toxoplasma gondii TGME49_229320 protein is shown in SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that: The kit is an indirect ELISA kit for detecting IgG antibodies against Toxoplasma gondii oocyst infection.

3. The application as described in claim 1, characterized in that: The kit also contains diluent, blocking solution, washing solution, enzyme-labeled secondary antibody, colorimetric solution, and stop solution.

4. An indirect ELISA method for detecting Toxoplasma gondii for non-diagnostic purposes, characterized in that... Includes the following steps: 1) Dilute the Toxoplasma gondii TGME49_229320 protein as described in claim 1 and coat it onto an ELISA plate; 2) Block the ELISA plate with blocking solution; 3) Dilute the serum sample and add it to the ELISA plate, then incubate at 37°C for 30-90 minutes; 4) Dilute the enzyme-labeled secondary antibody and add it to the ELISA plate, then incubate at 37°C for 30-90 minutes; 5) Add the colorimetric solution and perform the colorimetric reaction at 37°C in the dark. After the reaction is completed, take a reading at a wavelength of 630 nm.

5. The indirect ELISA method for detecting Toxoplasma gondii as described in claim 4, characterized in that: The final concentration of the Toxoplasma gondii TGME49_229320 protein was 2 μg / mL; the serum sample was diluted 200 times.

6. The indirect ELISA method for detecting Toxoplasma gondii as described in claim 4, characterized in that: The blocking solution is 1% bovine serum albumin, and the blocking time is 60 minutes.

7. The indirect ELISA method for detecting Toxoplasma gondii as described in claim 4, characterized in that: The enzyme-labeled secondary antibody is HRP-labeled goat anti-pig IgG.