Use of aldose reductase inhibitors for the preparation of a medicament for the treatment or prevention of drug-induced hearing loss

Abstract

The application discloses an application of an aldose reductase inhibitor to preparation of a drug for treating or preventing drug-induced deafness. The aldose reductase inhibitor is applied to prevention or treatment of drug-induced deafness for the first time in the application. Experiments show that the aldose reductase inhibitor can reduce cisplatin-induced increase of aldose reductase activity. In the application, epalrestat and cisplatin are co-cultured in cochlear explants, and it is found that epalrestat of different concentrations (10 / 50 / 100 μM) has a protective effect on hair cell damage caused by cisplatin. The epalrestat is used in a cisplatin acute ototoxicity model of mice, and can relieve cisplatin-induced hearing loss. It is also found that gomisin, as a new aldose reductase inhibitor, also has the performance of relieving cisplatin-induced hearing loss. Specifically, when gomisin is applied to in vitro culture of newborn mouse cochlea, the gomisin shows a protective effect on cochlear hair cells (HCs) and spiral neuron ganglion (SGN) in P2 newborn mouse cochlear in vitro culture.

Description

Technical Field

[0001] This invention relates to the field of drugs for treating or preventing drug-induced hearing loss, and in particular to the use of aldose reductase inhibitors in the preparation of drugs for treating or preventing drug-induced hearing loss. Background Technology

[0002] Hearing loss is a global health problem. According to a 2021 report by the World Health Organization (WHO), more than 1.5 billion people, or 20.3% of the global population, are affected by hearing loss. The main causes of hearing loss include auditory trauma, genetic variations, and ototoxic drugs.

[0003] Cisplatin is a widely used chemotherapy drug in cancer treatment, but the drug-induced hearing loss it causes severely impacts post-treatment quality of life. Studies have shown that the mechanisms by which cisplatin induces ototoxicity mainly involve imbalances in redox homeostasis and excessive activation of inflammation. The cochlear auditory receptor (Corti) is the primary sound-sensing structure, playing a crucial role in hearing formation. Cochlear hair cells (HC), supporting cells (SC), and spiral ganglion neurons (SGN) are key to the formation of sound-sensing function. Platinum-based drugs can cross the blood-endolymphatic barrier into the inner ear and enter the sensory hair cells through multiple transmembrane channels such as CTR1, OCT2, and MET, leading to mitochondrial DNA damage and hair cell death. Furthermore, supporting cells and spiral ganglion neurons are also susceptible to cisplatin ototoxicity. Although some preclinical and clinical trials have explored drugs that can prevent or treat cisplatin-induced hearing loss, such as antioxidants and anti-inflammatory drugs, the effectiveness of most drugs remains limited. To date, no clinically approved drugs can treat or prevent platinum-based hearing loss. Therefore, researching and developing more hearing protection drugs remains of great significance.

[0004] Aldose reductase (AR) is the rate-limiting enzyme in the polyol pathway, using NADPH as a hydride donor to convert glucose substrates into sorbitol. Aldose reductase is present in many tissues and organs, but its activity is low under normal physiological conditions. However, its activity increases significantly under stimuli such as diabetes, tumors, and tissue ischemia. Previous studies have shown that increased aldose reductase activity can lead to complications such as diabetic peripheral nerve injury, diabetic nephropathy, and myocardial ischemia-reperfusion injury. In peripheral nerve injury, aldose reductase inhibitors may have the following effects: 1) Anti-inflammatory effect: Peripheral nerve injury is often accompanied by an inflammatory response, and aldose reductase inhibitors may exert a protective effect by reducing the inflammatory response. They may inhibit the release of inflammatory mediators and reduce the infiltration of inflammatory cells, thereby alleviating inflammatory damage to nerve tissue. 2) Antioxidant effect: Peripheral nerve injury leads to oxidative stress, increasing the production of free radicals and damaging cells and tissues. Aldose reductase inhibitors may protect nerve tissue from oxidative damage by reducing oxidative stress and free radical production. 3) Neuroprotective effects: Aldose reductase inhibitors may protect nerve tissue through multiple mechanisms. They may reduce nerve cell apoptosis, promote nerve cell regeneration and repair, and enhance the nerve tissue's resistance to damage. Epalrestat, a marketed aldose reductase inhibitor, is primarily used to treat diabetes and its complications, improving peripheral neuropathy and other diabetic complications. However, there are currently no studies on the effects of aldose reductase in the field of otology.

[0005] To date, no clinically approved drugs have been found to treat or prevent hearing loss caused by platinum-based medications. Therefore, inhibition of aldose reductase is a promising target for preventing hearing loss, and whether aldose reductase inhibitors can treat or prevent hearing loss is a question that requires further investigation by those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to address the lack of research on drugs for treating or preventing drug-induced hearing loss in the existing technology, and to provide an aldose reductase inhibitor for use in the preparation of drugs for treating or preventing drug-induced hearing loss.

[0007] Another object of the present invention is to provide a medicament for treating or preventing drug-induced deafness.

[0008] The technical solution adopted to achieve the purpose of this invention is:

[0009] The application of an aldose reductase inhibitor in the preparation of drugs for the treatment or prevention of drug-induced hearing loss.

[0010] In the above technical solution, the aldose reductase inhibitor is one or more of toresistat, fildastat, zopostat, quercetin, linalool, and epalrestat.

[0011] In the above technical solution, the aldose reductase inhibitor is linalool and / or epalrestat.

[0012] In the above technical solution, epalrestat is administered intraperitoneally at a dosage of 20-40 mg / kg;

[0013] The linalool is administered via the tympanic cavity of each ear at a dose of 0.175-0.3 mg / kg.

[0014] In the above technical solution, the drug-induced deafness is deafness caused by platinum drugs and / or aminoglycoside antibiotics.

[0015] In the above technical solution, the platinum-based drug is cisplatin.

[0016] In another aspect, the present invention provides a medicament for treating or preventing drug-induced deafness, comprising an aldose reductase inhibitor.

[0017] In the above technical solution, the drug also includes a sustained-release agent.

[0018] In the above technical solution, the sustained-release agent is poloxamer.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] This invention marks the first application of aldose reductase inhibitors in the prevention or treatment of drug-induced hearing loss. Experiments have shown that aldose reductase inhibitors can alleviate cisplatin-induced aldose reductase activity increases. Specifically, co-culturing cochlear explants with epalrestat and cisplatin revealed that different concentrations of epalrestat (10 / 50 / 100 μM) protected against cisplatin-induced hair cell damage. Epalrestat, used in a mouse model of acute cisplatin ototoxicity, alleviated cisplatin-induced hearing loss. Furthermore, linaloside, a novel aldose reductase inhibitor, was found to also alleviate cisplatin-induced hearing loss. Specifically, when applied to ex vivo cochlear cultures from newborn mice, linaloside showed protective effects against cochlear hair cells (HCs) and spiral ganglia (SGNs) in P2 newborn mouse cochlear cultures. In a mouse model of cisplatin-induced hearing loss, linaloside significantly improved cisplatin-induced hearing loss. Animal experiments have confirmed that linalool has a protective effect against cisplatin-induced hearing loss. Auditory brainstem response test results show that linalool can improve hearing threshold by 10-20 dB in the main hearing frequency range of mice.

[0021] These results demonstrate that aldose reductase inhibitors effectively inhibit apoptosis by suppressing the increase in aldose reductase levels during cisplatin-induced hearing loss, thereby reducing oxidative stress in cochlear hair cells and improving cisplatin-induced hearing loss. This opens up a new avenue for the prevention and treatment of drug-induced hearing loss and also provides new insights into the development of anticancer drugs that mitigate the side effects of drug-induced hearing loss. Attached Figure Description

[0022] Figure 1 For Western blot detection of AR protein expression, among which, Figure 1 A represents the SDS-PAGE analysis of AR protein in different experimental groups. Figure 1 B represents AR protein expression levels in different experimental groups. Statistical analysis: #, P < 0.05; **, P < 0.01. Data are shown as mean ± SEM.

[0023] Figure 2 A shows the immunofluorescence staining of AR (green) and Myosin7a (red) in cochlear HC. Figure 2 B represents the hair cell count statistics. The horizontal axis represents different experimental groups, and the vertical axis represents the number of Myosin7a-AR co-labeled positive hair cells per 200 μm. The counts in the figure are mean ± SEM. Statistical analysis: **** / ####, P<0.0001.

[0024] Figure 3 A is the NADPH absorbance graph of aldose reductase activity at 340nm. The slope of the largest line is the AR positive control group, which indicates the highest enzyme activity. The black line is the cisplatin-damaged group, and its slope also changed compared to the control group. The horizontal axis is the test time, and the vertical axis is the absorbance value at 340nm. Figure 3 B represents the determination of BCA-binding protein concentration, and the calculation of aldose reductase activity in cochlear explants (approximately 15 μg protein concentration). The horizontal axis represents different treatment groups, and the vertical axis represents the calculated AR activity value. Statistical analysis: ** / ##, P<0.01, data are shown as mean ± SEM.

[0025] Figure 4 A shows the immunofluorescence staining of cochlear explants co-cultured with epalrestat and cisplatin, with Myosin7a (green fluorescence) used to label hair cells. Figure 4 B represents the hair cell count statistics. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the number of Myosin7a-positive hair cells per 100μm. The counts in the figure are mean ± SEM.

[0026] Figure 5 This is a flowchart of the acute cisplatin assay in vivo.

[0027] Figure 6A represents the ABR threshold 72 hours after cisplatin-induced acute injury. The horizontal axis represents the corresponding frequency, and the vertical axis represents the threshold in decibels. Compared with the cisplatin injury group, the hearing threshold of each frequency was reduced in the epalrestat group. Figure 6 B represents the ABR threshold shift before and after injury in each mouse. The horizontal axis represents the corresponding frequency, and the vertical axis represents the threshold shift in decibels. Statistical analysis: *, P<0.05, data are shown as mean ± SEM.

[0028] Figure 7 A is a confocal image of cochlear hair cells after an acute cisplatin test in vivo, with hair cells labeled with Myosin7a (red fluorescence); Figure 7 B represents the hair cell count statistics. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the number of Myosin7a-positive hair cells per 100 μm. The counts in the figure are mean ± SEM. Statistical analysis: **, P < 0.01; ****, P < 0.0001.

[0029] Figure 8 A is a confocal image of the cochlear synapse after an acute cisplatin test in vivo. The synapse is labeled with CtBP2 (green fluorescence), and the outline of the inner hair cells is delineated with white lines. Figure 8 B represents the count statistics of CtBP2 positive synapses. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the synapse count on each inner hair cell. The counts in the figure are mean ± SEM. Statistical analysis: *, P<0.05; ***, P<0.001.

[0030] Figure 9 A is a confocal image of a section of spiral ganglion neurons in the cochlea following an acute cisplatin test in vivo. The spiral ganglion neurons are labeled with Tuj1 (green fluorescence). Figure 9 B represents the count statistics of Tuj1 positive cells, with the horizontal axis representing the corresponding location in the cochlea and the vertical axis representing the number of cells per 10,000 μm. 2 Tuj1-positive cell counts within the range. Counts in the figure are mean ± SEM. Statistical analysis: **** / ####, P<0.0001.

[0031] Figure 10 A represents the fluorescence detection of mitochondrial reactive oxygen species in hair cells; the red fluorescence is enhanced after apoptosis. Figure 10 B represents the count of Mitosox-positive hair cells within a 100 μm area. The x-axis represents the corresponding location in the cochlea, and the y-axis represents the number of Mitosox-positive hair cells within a 100 μm area. The counts in the figure are mean ± SEM. ***, P < 0.001; ####, P < 0.0001.

[0032] Figure 11A represents the use of the fluorescent probe JC-1 to detect mitochondrial membrane potential in cells. Cisplatin-induced mitochondrial dysfunction increased the monomeric form of JC-1 (green fluorescence), while the addition of epalrestat reduced cisplatin-induced mitochondrial damage and enhanced the polymeric form of JC-1 in mitochondria (red fluorescence). Figure 11 B represents the calculation and statistical analysis of the ratio changes between JC-1 polymer (red fluorescence) and JC-1 monomer (green fluorescence). Counts in the figure are mean ± SEM values, **** / ####, P < 0.0001.

[0033] Figure 12 This is the 3D conformation diagram of linalool (PubChem ID: 5320686).

[0034] Figure 13 The crystal structure of aldose reductase protein AKR1B1 (PDB ID: 4LBS).

[0035] Figure 14 The target of linalool was predicted using the SwissTargetPrediction website.

[0036] Figure 15 This is a schematic diagram of the molecular docking binding of linalool with AKR1B1 protein. AKR1B1 protein is shown as a colored background structure, NADP carbon atoms are shown as gray, 4O8 carbon atoms are shown as green, nitrogen atoms are blue, phosphorus atoms are orange, oxygen atoms are red, bromine atoms are dark red, and fluorine atoms are light blue. Linalool forms hydrogen bonds (yellow dashed lines) with AKR1B1 residues TRP20, GLN49, THR113, and CYS298, and forms π-π interactions (magenta dashed lines) with AKR1B1 residue TRP111.

[0037] Figure 16 This is a 2D schematic diagram of the interaction between linalool and the active residues of AKR1B1. Linalool forms hydrogen bonds (dashed arrows) with AKR1B1 residues TRP20, GLN49, THR113, and CYS298, and forms a π-π interaction (dashed arrow with benzene ring) with AKR1B1 residue TRP111.

[0038] Figure 17 The diagram shows the docking conformations of two known positively charged compounds that bind to AKR1B1, 4O8 and 4JIR. The cyan bar represents 4O8, and the yellow bar represents 4JIR.

[0039] Figure 18 A is the electrostatic surface diagram of AKR1B1; Figure 18B represents the molecular docking structure of linalool and the positively charged compound 4O8. The cyan bar represents 4O8, the green bar represents linalool, the structure of protein AKR1B1 is shown as background lines, the yellow dashed lines represent hydrogen bonds, and the magenta dashed lines represent π-π interactions.

[0040] Figure 19 A 2D schematic diagram of the interaction between 4O8 and AKR1B1 protein.

[0041] Figure 20 A represents the measurement of aldose reductase activity. The maximum slope indicates the highest enzyme activity, serving as the positive control group for aldose reductase. The minimum slope of the gray line represents the negative control group. Figure 20 B represents the relative aldose reductase activity calculated based on tissue protein content. An asterisk (*) indicates a statistically significant difference compared to the AR positive control. Statistical analysis: **, P < 0.01; ****, P < 0.0001. Data are presented as SEM ± mean.

[0042] Figure 21 To detect the mRNA levels of aldose reductase and sorbitol dehydrogenase in cochlear explants treated with cisplatin and TIL by qRT-PCR. The x-axis represents the gene names (Akr1b1, Akr1b7, Sord), and the y-axis represents the relative gene expression level. * indicates P < 0.05; ** / ## indicates P < 0.01.

[0043] Figure 22 Cell viability was assessed using the CCK-8 assay. The x-axis represents the concentrations of cisplatin and linalool, and the y-axis represents the absorbance at 450 nm. Statistical analysis: **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Data are shown as SEM ± mean.

[0044] Figure 23 A represents the effect of linalool on cisplatin-induced apoptosis using flow cytometry. Figure 23 B represents cell death rate analysis. Statistical analysis: **, P<0.01, data are based on SEM ± mean.

[0045] Figure 24 A shows the immunofluorescence staining of cochlear explants co-cultured with linalool and cisplatin, with Myosin7a (green fluorescence) used to label hair cells; Figure 24 B represents the hair cell count statistics. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the number of Myosin7a-positive hair cells per 100 μm. The counts in the figure are mean ± SEM, ****, P < 0.0001.

[0046] Figure 25A shows the immunostaining of spiral neuron ganglia co-cultured with linalool and cisplatin. Hair cells were labeled with Myosin7a (green fluorescence), and SGNs were labeled with Tuj1 (red fluorescence). Figure 25 B represents the density of neural neurites per 100 μm length (n = 6). Figure 25 C represents the quantitative analysis of neurite growth length (n=6). The counts in the figure are mean ± SEM, ****, P<0.0001.

[0047] Figure 26 The relative mRNA levels of apoptosis-related genes in a cisplatin-induced cochlear explant model were detected by qRT-PCR. The x-axis represents the names of apoptosis-related genes (Bax, Bcl2, Caspase3), and the y-axis represents the relative gene expression levels. Counts in the figure are mean ± SEM. * / #, P<0.05; ** / ##, P<0.01; *** / ###, P<0.001.

[0048] Figure 27 A represents hair cell apoptosis as determined by cleaved-Caspase3 immunofluorescence staining (red fluorescence); Figure 27 B represents the quantitative statistics of caspase-3 positive hair cells. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the number of caspase-3 positive hair cells per 100 μm. The counts in the figure are mean ± SEM, ***, P < 0.001.

[0049] Figure 28 A represents the determination of apoptosis in the spiral ganglia of explanted cochlear neurons in newborn mice by caspase-3 immunofluorescence staining (red fluorescence); Figure 28 B represents the quantitative fluorescence statistics of caspase-3, with the horizontal axis representing the corresponding location in the cochlea and the vertical axis representing the red fluorescence intensity of caspase-3. **, P<0.01.

[0050] Figure 29 ABR hearing was assessed in mice after two cycles of cisplatin-induced injury. A represents the ABR threshold in mice, with the x-axis representing the corresponding frequency and the y-axis representing the threshold in decibels. The ABR hearing threshold in the linalool-treated group (blue line) was lower than that in the cisplatin-induced injury group (red line) at frequencies of 8kHz, 16kHz, and 24kHz. B represents the ABR I-wave amplitude analysis at 90dB sound intensity stimulation, with the x-axis representing the corresponding frequency and the y-axis representing the I-wave amplitude. C represents the ABR I-wave latency at 90dB sound intensity stimulation, with the x-axis representing the corresponding frequency and the y-axis representing the statistical value of the I-wave latency. D represents the ABR threshold shift before and after injury in each mouse, with the x-axis representing the corresponding frequency and the y-axis representing the threshold shift in decibels. Statistical analysis: *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. Data are shown as SEM ± mean.

[0051] Figure 30 A shows confocal images of mouse cochlea after two drug administration cycles following immunohistochemistry, with hair cells labeled with Myosin7a (red fluorescence); B shows the hair cell count, with the x-axis representing the corresponding location in the cochlea and the y-axis representing the number of Myosin7a-positive hair cells per 100 μm. The counts in the figures are mean ± SEM, **** / ####, P<0.0001.

[0052] Figure 31 A is a confocal image of the mouse cochlea after immunohistochemistry following two drug administration cycles. Synapses are labeled with CtBP2 (green fluorescence), and the outlines of inner hair cells are delineated with white lines. Figure 31 B represents the count statistics of CtBP2 positive synapses. The horizontal axis represents the corresponding location in the cochlea, and the vertical axis represents the synapse count on each inner hair cell. The counts in the figure are mean ± SEM, **** / ####, P<0.0001.

[0053] Figure 32 A shows frozen sections of mouse cochlea stained after two administration cycles. Hair cells were labeled with Myosin7a (red fluorescence) and SGNs were labeled with Tuj1 (green fluorescence). Figure 32 B represents spiral ganglion neurons labeled with Tuj1 (green fluorescent). Figure 32 C represents the SGN count statistics, with the horizontal axis representing the corresponding location in the cochlea and the vertical axis representing the number of micrometers per 10,000 μm. 2 The number of Tuj1-positive SGNs within the range is shown in the figure as mean ± SEM. Statistical analysis: *** / ###, P<0.001. Detailed Implementation

[0054] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0055] Example 1: Experimental Materials and Methods

[0056] 1.1 Experimental Materials:

[0057] Mouse cochlear hair cell line (HEI-OC1). Newborn C57 / BL6 mice aged 2 days (P2) and adult C57 / BL6 mice aged 5-6 weeks (JSJ Biotechnology and Lingchang Biotechnology). All animals were handled strictly in accordance with the "Guidelines for Humane Treatment of Laboratory Animals" issued by the Ministry of Science and Technology of the People's Republic of China in 2006. In this invention, epalrestat and linaloside were used as aldose reductase inhibitors to verify the effect of aldose reductase inhibitors on the treatment or prevention of drug-induced deafness. Both epalrestat and linaloside were purchased from Selleck.

[0058] 1.2 Experimental Methods

[0059] 1.2.1 Culture of explants of cochlea in newborn mice

[0060] Sensory epithelium from P2 C57 / BL6 neonatal mice was cultured in vitro. The experimental procedure is as follows:

[0061] 1) In a clean cell chamber, mice were first disinfected with 75% alcohol, decapitated with sterilized scissors, and the skull was cut along the midline of the sagittal plane of the brain. Excess brain tissue was removed, while the cochlea and surrounding tissue were preserved. After being placed in 75% alcohol, the mice were quickly transferred to PBS buffer.

[0062] 2) Dissect the sensory epithelium of the cochlea under an anatomical microscope. First, remove the cochlear shell, probe to the bottom of the cochlear axis, and separate the cochlear axis together with the sensory epithelium and spiral ligament from the temporal bone. Then, carefully separate the spiral ligament and sensory epithelium from the bottom of the basal circle, and slowly remove the spiral ligament in the order from the bottom circle to the top circle.

[0063] 3) Finally, transfer the separated sensory epithelium onto a slide coated with Cell-Tek, flatten it, and place it on ice for 5-10 minutes to ensure it adheres tightly to the slide;

[0064] 4) After it stabilizes, add 100 μL of culture medium consisting of DMEM / F12 (Hyclone), N2 (Life Technology), B27 (Life Technology), and 5 mg / ml ampicillin;

[0065] 5) Incubate overnight at 37°C in 5% CO2. All procedures must be performed under aseptic conditions.

[0066] 1.2.2 Cisplatin-induced injury model of cochlear explants and drug administration grouping

[0067] After the cochlear explants were cultured stably overnight, they were cultured with different concentrations of cisplatin for 24 hours. The dose response was observed, and the peak value of hair cell damage was found to be 30 μM. Based on previous literature experience, 30 μM treatment for 24 hours was selected as the damage model for cochlear explant experiments.

[0068] The cultured cochlear explants were grouped:

[0069] 1) Drug treatment group: 2 hours before injury, the medium was pretreated with different concentrations of aldose reductase inhibitor. 2 hours later, the medium was changed to aldose reductase inhibitor (epalrestat and linalool in this invention) and cisplatin. 24 hours later, the medium was changed to aldose reductase inhibitor only and the treatment continued for 24 hours.

[0070] 2) Simple damage group: After treatment with 30μM cisplatin for 24 hours, the medium was replaced and the treatment continued for another 24 hours.

[0071] 3) Control group: Only culture medium was used, and the medium was changed at the same time as the other groups. Each group had at least 4 basement membranes.

[0072] 1.2.3 Immunohistochemistry

[0073] 1) Remove the cultured basement membrane, wash away the residual culture medium with PBS, replace it with 4% PFA to fix the basement membrane, and incubate at room temperature for half an hour (or at 4°C for 2-24 hours);

[0074] 2) After fixation, remove PFA, wash 3 times with PBS, place on a shaker, and wash for 10 minutes each time;

[0075] 3) Use PBS containing 10% donkey serum and 1% Triton for blocking permeabilization, remove the PBS, add the prepared blocking permeabilization solution, and incubate overnight at 4°C.

[0076] 4) Primary antibody staining: Prepare PBS containing 1% donkey blood and 1% Triton as antibody dilution buffer. The dilution ratio of anti-rabbit-Myosin7a and anti-mouse-AR is 1:500. After adding approximately 50 μL of the prepared antibody to each well, incubate overnight at 4°C in the dark.

[0077] 5) After incubation at 4℃, allow to warm to room temperature for 1 hour. Then place on a shaker and wash three times with PBS, each time for 10 minutes.

[0078] 6) Secondary antibody staining: Using antibody dilution buffer, dilute the corresponding Alexa Flour488 Donkey anti-Mouse and Alexa Flour cy3 Donkey anti-Rabbit secondary antibodies at a ratio of 1:500. Add approximately 50 μL of the prepared antibody to each well and incubate overnight at 4°C in the dark.

[0079] 7) After incubation at 4℃, wash three times with PBS, each time for 10 minutes;

[0080] 8) Nuclear staining: Dilute DAPI 1:1000 and incubate at room temperature for 10 minutes;

[0081] 9) After washing with PBS 3 times (as above), remove the small round glass slide attached to the basement membrane and place it on a glass slide. Add glycerol and then slowly cover it with a coverslip.

[0082] 1.2.4 Assay for Aldose Reductase Activity

[0083] The aldose reductase activity assay kit (Abcam, ab273276) was used to detect aldose reductase (AR) activity by utilizing its ability to catalyze NADPH oxidation. Newborn mouse cochlear explants were divided into three groups: a control group, a cisplatin-damaged group, and a group treated with both an aldose reductase inhibitor and cisplatin (n=14 cochleas). To detect the decrease in absorbance at 340 nm, cochlear tissue lysates were first prepared according to the instructions, and a small amount was taken for protein concentration quantification using a BCA kit (BCA, Beyotime, Shanghai). Next, NADPH was generated according to the reagent instructions, and a standard curve was constructed. Start and end time points (t1 and t2) were selected within the linear range of the curve to obtain the corresponding absorbance values ​​(OD1 and OD2), and the aldose reductase activity of the test samples was calculated using ΔOD = OD1 - OD2. ΔOD was applied to the NADPH standard curve to estimate the amount of NADPH (B nmol) produced during the reaction (Δt = t2 - t1). The AR activity of each group was determined using the following formula:

[0084]

[0085] Sample AR activity = nmol / min / mg = mU / mg

[0086] B = Amount of NADPH in the standard curve (nmol)

[0087] Δt = reaction time (minutes)

[0088] M = Total protein (mg) added to the reaction wells

[0089] D = Dilution ratio

[0090] 1.2.5 Western blot analysis of related protein expression

[0091] Cultured cochlear explants were homogenized on ice in lysis buffer (RIPA) containing protease inhibitors. The extracted proteins were denatured in a 100°C water bath and then separated by polyacrylamide gel electrophoresis. After transfer, blocking, primary antibody [β-Tubulin, AR] reaction, secondary antibody reaction, exposure, and image acquisition, the proteins were then subjected to the following steps.

[0092] 1.2.6 Acute cisplatin injury experiment in mice

[0093] Five- to six-week-old C57 / BL6 wild-type mice were used for in vivo experiments. Randomly numbered mice were divided into three groups: a simple injury group (n=7), a treatment group receiving both aldose reductase inhibitor and cisplatin (n=5), and a control group treated with poloxamer and saline (n=5). Male and female mice were ensured to be evenly distributed throughout the experimental groups. After baseline hearing was assessed in each mouse, the injury group received a single intraperitoneal injection of cisplatin at a concentration of 30 mg / kg. The treatment group received epalrestat 40 mg / kg / day intraperitoneally for three consecutive days, one day before and two days after cisplatin administration, while the other groups received the same dose of solvent. During the rearing period, mice were provided with soft feed and fresh fruit daily. ABR testing was performed 72 hours after cisplatin administration, followed by sacrifice for histological examination.

[0094] 1.2.7 Image Acquisition and Statistical Analysis

[0095] Images acquired after immunohistochemical staining were obtained using a Leica SP8 confocal microscope. Image processing and counting were performed using Leica software, Adobe Photoshop 2020, and Adobe Illustrator 2020. Statistical analysis of the data was conducted using Graphpad Prism software or Excel spreadsheets. One-way ANOVA was used; if only two conditions were being compared, a two-sample t-test was used.

[0096] Example 2: Application of epalrestat in the preparation of drugs for the treatment or prevention of drug-induced hearing loss

[0097] 2.1 Increased aldose reductase activity during cisplatin-induced damage

[0098] like Figure 1 As shown, Western blotting was used to detect aldose reductase protein expression. The blot results indicated increased aldose reductase protein levels in the cochlear explants after cisplatin injury, confirming that aldose reductase is highly activated in the cochlea during cisplatin injury. Immunofluorescence staining of AR protein, as shown... Figure 2 As shown, AR expression was increased in cochlear hair cells treated with cisplatin, while epalrestat reduced the increase in aldose reductase expression during cisplatin-induced damage.

[0099] To verify the changes in aldose reductase activity in the cochlea following cisplatin injury, a commercially available aldose reductase activity assay kit was used. The change in AR activity was reflected by detecting changes in NADPH absorbance, utilizing AR's ability to catalyze NADPH oxidation. The AR-positive control group showed the most significant decrease in absorbance. The decrease in AR activity in the cisplatin-injured group was greater than that in the control group, indicating increased AR activity in cisplatin-injured cochlear explants. The effect of epalrestat (EPA) on AR activity in cochlear explant tissue following cisplatin injury was also investigated. Figure 3As shown in the results, aldose reductase activity assays revealed that epalrestat reduced the cisplatin-induced absorbance changes compared to the cisplatin-damaged group. Combined with BCA protein concentration assays, the aldose reductase activity was calculated, showing that the aldose reductase activity in the cisplatin-damaged group was higher than that in the control group. This indicates that cisplatin induces increased AR activity in the cochlear explant tissue, and that epalrestat can alleviate the cisplatin-induced increase in AR activity.

[0100] 2.2 Epastatin plays a protective role in a neonatal mouse cochlear explant cisplatin injury model.

[0101] For in vitro culture of P2 neonatal mouse cochlea, myosin7a and Tuj1 were used for immunofluorescence staining of cochlear hair cells (HCs) and spiral ganglion neurons (SGNs). Cochlear explants were co-cultured using epalrestat and cisplatin. Figure 4 As shown, confocal images obtained after immunofluorescence staining revealed that different concentrations of epalrestat (10 / 50 / 100 μM) had a protective effect against cisplatin-induced hair cell damage.

[0102] 2.3 Protective effect of epalrestat against cisplatin ototoxicity in mice

[0103] To further verify the effect of inhibiting aldose reductase on cisplatin-induced ototoxicity, and based on previous studies demonstrating that epalrestat improves neurological damage when administered in vivo, a systemic administration method was used to explore the protective effect of epalrestat against hearing loss. To avoid excessively high mortality rates in mice with a long-term cisplatin-induced injury model, an acute cisplatin-induced injury model was used in mice. Acute hearing loss was induced by a single administration of a high dose of cisplatin (30 mg / kg), and hearing was measured before and 72 hours after injury. In the epalrestat experimental group, epalrestat was administered intraperitoneally at 40 mg / kg one day before and two days after the acute cisplatin-induced injury, with other treatments the same as the cisplatin-induced injury group. The control group and the cisplatin-induced injury group received the same amount of solvent (DMSO + corn oil) intraperitoneally for three consecutive days. The flowchart is shown below. Figure 5 As shown. Figure 6 As shown, comparing the ABR hearing test data of the three groups of mice after 72 hours revealed that acute cisplatin injury causes hearing loss, and the hearing threshold of the epalrestat group was lower than that of the cisplatin injury group, demonstrating that epalrestat alleviated or slowed the progression of hearing loss after administration to mice. Histological examination of the mouse cochlea, such as... Figure 7 As shown, using myosin7a to label inner ear hair cells, a large number of outer hair cells were observed in the cisplatin-damaged group, especially in the basal ring of the cochlea. The epalrestat group had a higher number of surviving basal ring hair cells than the cisplatin group. Simultaneously, the number of synapses labeled with CtBP2 was also shown... Figure 8 As shown, a higher number of synaptic surviving sites were observed in the inner hair cells after epalrestat treatment.Figure 9 As shown, in the spiral ganglion neuron slices in the cochlea, spiral ganglion neurons were labeled with Tuj1. It was observed that the number of surviving spiral ganglion neurons in the basal circle was greater after epalrestat treatment than that in the cisplatin group.

[0104] 3.4 Epalrestat prevents cisplatin-induced mitochondrial dysfunction

[0105] The level of reactive oxygen species in mitochondria of cochlear hair cells was detected using a Mito-SOX fluorescent probe. Figure 10 As shown, the results confirmed that cisplatin-induced damage significantly increased the level of mitochondrial reactive oxygen species (ROS) in cochlear hair cells, while epalrestat effectively reduced the production of ROS in mitochondria. Then, as... Figure 11 As shown, changes in mitochondrial membrane potential were detected using the JC-1 fluorescent probe. Cisplatin-induced mitochondrial membrane potential decreased, but no significant decrease was observed in the epalrestat group, demonstrating that epalrestat prevented cisplatin-induced mitochondrial dysfunction. Therefore, epalrestat has potential applications in treating cisplatin-induced kidney damage, gastrointestinal problems, bone marrow transplantation, and neurotoxicity.

[0106] In conclusion, both hearing tests and histological examinations have shown that the aldose reductase inhibitor epalrestat can alleviate cisplatin-induced hearing loss.

[0107] Example 3: Validation of the aldose reductase inhibitor of linaloside

[0108] 3.1 Experimental Methods

[0109] 3.1.1 Structural and conformational search of linalool

[0110] Download the 3D structure of the compound tiliroside from PubChem, PubChem ID: 5320686. Figure 12 Conformation search was performed using the conformation search module of MOE software to generate multi-conformation files of the compound for molecular docking. The final compound Tiliroside generated 173 conformations.

[0111] 3.1.2 Molecular target prediction

[0112] Using the internet-based molecular target prediction tools SwissTargetPrediction (http: / / www.swisstargetprediction.ch) and the Similarity Ensemble Approach (SEA), the most likely protein targets of linalool were predicted based on the structural similarity of known ligand-target binding. These tools compare linalool with all known bioactive compounds and then use the fact that comparable compounds have similar biological activities to predict potential targets.

[0113] 3.1.3 Define protein structure and docking sites

[0114] Several conformational files generated using linalool (PubChem ID: 5320686) were used for molecular docking. Crystal structures of human AKR1B1 protein targets are currently available, such as... Figure 13 As shown, the lowest resolution crystal structure, 4LBS, was selected for subsequent processing. It was found that the protein bound to both the substrate and ligand, and the molecular docking sites were clearly defined.

[0115] 3.1.4 Molecular docking

[0116] Molecular docking of linalool with AKR1B1 protein was performed using MOE software. The protein crystal structure (PDB ID: 4LBS) was downloaded and used as the acceptor for molecular docking. In the AMBER10:EHT force field, the acceptor was protonated, and the 4O8 pocket region of the ligand was set as the docking site. An induced fitting docking scheme was used for molecular docking. The Triangle Match algorithm was used to generate docking patterns of the complex, and the LondonδG function was used to calculate the affinity of each docking posture, retaining the first 1000 docking postures. Then, the binding affinity of the optimal docking posture was calculated using the GBVI / WAS G scoring function and the induced fitting algorithm. Finally, the interaction energy score of the protein and compound in each complex was expressed as the S value; the smaller the value, the stronger the affinity. Based on the conformational rationality of the molecules, the optimal interaction model between linalool and AKR1B1 protein was determined, with an affinity score of -10.00 kcal / mol.

[0117] 3.1.5 Quantitative PCR detection

[0118] Using TB Green TM PrimeScript TMQuantitative PCR (qPCR) was performed using the RT-PCR Kit (Takara), the ABI 7500 Real-Time PCR System (Applied Biosystems), and the CFX-96 Real-Time PCR Detection System (Bio-Rad).

[0119] The primer sequences used in this section are shown in Listing 1 below:

[0120] Table 1 Primer sequences

[0121] Gene Forward primer Reverse primer Akr1b1 GTGACTGAGGCCGTGAAAG GCTGACAATGAAGAGATCCTGC Akr1b7 AATCTCCATTACTACGGGGTC TCCAATACTGTCAATCCAAGG Sord CGGCCCAAATGATGTGTTACT CTCCTACTTTTGTGACTGTTCCA Gapdh TCATCATCTCCGCCCCTTC CATGAGCCCTTCCACAATGC

[0122] 3.2 Experimental Results

[0123] 3.2.1 Predicting the target of linalool

[0124] To determine the target sites of linalool, its chemical structure was first submitted to the online prediction programs SwissTargetPrediction and Similarity Ensemble Approach (SEA). Analysis of the first five predicted target sites of linalool was then performed. Figure 14 As shown, aldose reductase (AR) was identified as the most promising target associated with apoptosis.

[0125] 3.2.2 Molecular docking simulation of linaloside and aldose reductase protein

[0126] like Figure 15 As shown, molecular docking simulations were performed to investigate the binding of the compound linalool (PubChem ID: 5320686) to the AKR1B1 (PDB ID: 4LBS) protein. The Induced Fit docking protocol was used for flexible molecular docking of proteins with small molecule compounds. The Triangle Match algorithm was used to generate docking modes of the complex, and the London δG scoring function was used to evaluate the docking affinity between AKR1B1 and linalool. Figure 16 As shown, based on the conformational rationality of the molecules, the optimal interaction model between linalool and AKR1B1 protein was selected, with an affinity score of -10.00 kcal / mol. Figure 15 As shown, molecular docking simulations reveal that the stereoconformation of linalool forms hydrogen bonds with TRP20, GLN49, THR113, and CYS298 of AKR1B1, and exhibits π-π stacking interactions with TRP111.

[0127] 3.2.3 Tilinin has similar binding sites to aldose reductase inhibitors.

[0128] Since the 1990s, aldose reductase has been a key therapeutic target for diabetic complications, and therefore, many aldose reductase inhibitors (ARIs) have been discovered. To investigate the similarities and differences between linalool and known aldose reductase inhibitors and their interaction modes with AKR1B1, two structures of aldose reductase inhibitors, 4O8 and 4JIR, were selected. For example... Figure 17 As shown, molecular docking simulations reveal that the binding sites of these two inhibitors to AKR1B1 are associated with amino acid residues HIS100, TRP111, TYR48, and THR113.

[0129] like Figure 18 As shown in the schematic diagram of the electrostatic surface of the AKR1B1 protein, linalool has a structure similar to ARI and binds within the same pocket of AKR1B1. In addition, as... Figure 19 As shown, in the molecular docking with AKR1B1, linalool and 4O8 share the same binding sites TRP-111 and THR-113. These data indicate that linalool has a stable binding conformation with AKR1B1 and a similar structure and binding position to ARI.

[0130] 3.2.4 Tilinin has an inhibitory effect on aldose reductase.

[0131] The pharmacological effects of TIL on aldose reductase activity were further investigated using a commercially available aldose reductase activity assay kit, where aldose reductase activity was reflected by changes in NADPH absorbance at 340 nm. Figure 20 As shown, the absorbance decrease was most significant in the aldose reductase-positive control group. Compared with the aldose reductase-positive group, the addition of TIL dose-dependently alleviated the decrease in NADPH absorbance, indicating that aldose reductase activity is inhibited by TIL. Simultaneously, the CFDA-approved aldose reductase inhibitor epalrestat (EPA) also alleviated the decrease in NADPH absorbance. These results demonstrate that TIL can inhibit aldose reductase activity.

[0132] 3.2.5 Tilinin can inhibit the increased aldose reductase activity during cisplatin-induced damage.

[0133] The changes in RNA levels of aldose reductase and sorbitol dehydrogenase in cochlear explants during cisplatin injury were detected using qPCR. Figure 21Using a commercially available aldose reductase activity assay kit, changes in AR activity were reflected by detecting changes in NADPH absorbance, leveraging AR's ability to catalyze NADPH oxidation. The AR-positive control group showed the most significant decrease in absorbance. The decrease in AR activity was greater in the cisplatin-damaged group than in the control group, indicating increased AR activity in cisplatin-damaged cochlear explants. The effects of linalool (TIL) and the aldose reductase inhibitor epalrestat (EPA) on AR activity in cochlear explant tissue after cisplatin damage were also investigated. Figure 3 As shown, the aldose reductase activity assay results indicated that, compared to the cisplatin-damaged group, the use of TIL and EPA alleviated the cisplatin-induced change in absorbance. Combined with BCA protein concentration assays, the aldose reductase activity was calculated, showing that the aldose reductase activity in the cisplatin-damaged group was higher than that in the control group. This indicates that cisplatin induces increased AR activity in the cochlear explant tissue, and that TIL or EPA can alleviate the cisplatin-induced increase in AR activity.

[0134] 3.2.6 Lindenidine reduces the expression of aldose reductase in cisplatin-induced damage in mouse cochlear explants.

[0135] Western blot analysis of aldose reductase protein expression revealed increased aldose reductase levels in cochlear explants following cisplatin injury, confirming that aldose reductase is highly activated in the cochlea during cisplatin injury. The use of TIL and EPA reduced cisplatin-induced aldose reductase expression. Figure 1 Immunofluorescence staining of AR protein revealed increased AR expression in cochlear hair cells treated with cisplatin, while linalool and epalrestat reduced the increase in aldose reductase expression following cisplatin injury. Figure 2 ).

[0136] Example 4: Application of linalool in the preparation of drugs for the treatment or prevention of drug-induced deafness

[0137] 4.1 Tilinin can alleviate cisplatin-induced apoptosis in HEI-OC1 cells.

[0138] Oxidative stress and ROS accumulation-induced apoptosis are the main mechanisms of cisplatin-induced damage. To confirm whether linalool has a protective effect against cisplatin-induced apoptosis, HEI-OC1 cells were treated with different concentrations of linalool and 30 μM cisplatin, and cell viability was then measured using a CCK8 assay. Figure 22 As shown, the ototoxicity of cisplatin began to decrease with the addition of 5 μM (300 ng) linaloside, and the protective effect was most significant at 3.5-6 μg linaloside. Figure 23 As shown, flow cytometry results related to apoptosis indicate that linalool can alleviate cisplatin-induced apoptosis.

[0139] 4.2 Linalool plays a protective role in a neonatal rat cochlear explant cisplatin injury model.

[0140] For in vitro culture of P2 neonatal mouse cochlea, Myosin7a and Tuj1 were used for immunofluorescence staining of cochlear hair cells (HCs) and spiral neuronal ganglia (SGNs). Figure 24-25 As shown in the confocal images, the number of HCs and SGNs in the cochlear explants of mice treated with linaloside was significantly greater than that in the cisplatin-damaged group, confirming that linaloside can play a protective role in otoprotection.

[0141] 4.3 Tilinin can alleviate cisplatin-induced apoptosis.

[0142] To investigate apoptosis during cisplatin-induced cell damage, changes in the mRNA levels of key apoptosis-related genes (Bax, Bcl2, Caspase3) were measured. Figure 26 As shown, qPCR results revealed increased expression of Bax and Caspase3 apoptosis factors and decreased expression of Bcl2 anti-apoptotic factor in cochlear tissue 24 hours after cisplatin treatment. Treatment with linalool slowed the changes in mRNA levels of apoptosis-related genes.

[0143] Cleaved-Caspase 3 is a key factor in the apoptosis process. To investigate apoptosis in newborn mouse cochlear explants, such as... Figure 27 As shown, immunohistochemical analysis using cleaved-Caspase3-based fluorescent labeling revealed a significant increase in the number of cleaved-Caspase3-positive HCs after cisplatin injury, followed by a decrease in the linalool group. Meanwhile, as... Figure 28 As shown, confocal fluorescence intensity analysis of SGNs also revealed a significant decrease in cleaved-Caspase 3 fluorescence intensity in the linalool group. This further demonstrates that linalool can alleviate cisplatin-induced apoptosis.

[0144] 4.4 Lindenin protects mice from cisplatin ototoxicity.

[0145] To verify the in vivo effects of linalool, 5-6 week old C57 mice were used to further evaluate its protective effect. First, a cisplatin-induced hearing loss model was established in mice. Cisplatin was administered intraperitoneally at a dose of 3.5 mg / kg / day for 4 consecutive days, followed by a 10-day recovery period, and then repeated for two cycles. This regimen is similar to the clinical course of cancer chemotherapy, reducing mortality in mice while inducing significant hearing loss. Two hours before each cisplatin administration cycle, a mixture of linalool and poloxamer was administered intratympanically to both middle ear canals of the mice, with linalool dosage at 0.3 mg / kg per ear. Poloxamer is a delivery carrier that provides sustained-release drug delivery, allowing the compound to be slowly absorbed within the ear. Simultaneously, the control and cisplatin-induced hearing loss groups received poloxamer alone via the tympanic membrane to exclude the influence of the delivery carrier and tympanic membrane perforation on hearing.

[0146] After two cycles of drug administration, the mice underwent ABR testing to observe changes in their hearing. Figure 29 As shown, the results indicated that the ABR hearing thresholds in the linalool-treated group were lower than those in the cisplatin-damaged group at frequencies of 8kHz, 16kHz, and 24kHz. However, at 32kHz, the hearing thresholds in both the linalool-treated and cisplatin-damaged groups were higher than the 90dB upper limit, suggesting that intra-ear administration of linalool to mice can alleviate cisplatin-induced hearing loss. Analysis of the ABR waveforms revealed that, compared to the control group, the amplitude of wave I in the ABR waveform after cisplatin damage decreased at frequencies of 8kHz and 16kHz under 90dB sound intensity stimulation, while there was no significant difference in wave I amplitude between the linalool-treated and cisplatin-damaged groups. Simultaneous analysis of the ABR wave I latency, representing the peripheral conduction time of the auditory pathway, revealed that compared to the control group, the wave I latency was prolonged in the cisplatin-damaged group, while the latency in the linalool-treated group was not prolonged at 16kHz. When the ABR waveform was undetectable, amplitude and latency calculations were not possible.

[0147] Subsequently, the inner ear of the mice was dissected and immunofluorescence stained. Hair cells were labeled with Myosin7a, and it was found that there was significant loss of outer hair cells in the cisplatin-damaged group, with the most severe damage to hair cells in the basal cochlea. The hair cell loss in the linalool group was less severe than that in the cisplatin-damaged group. Figure 30 To investigate changes in synapses and SGNs in the sensorimotor pathway, CTBP2 was used to label synaptic points on hair cells in the basal loop of the cochlea. The results showed that cisplatin-induced damage significantly reduced the number of synapses, while the linalool-treated group showed a significantly increased number of surviving synapses compared to the cisplatin-treated group. Figure 31 ). Observation of Tuj1-labeled SGN changes through frozen sections of cochlear tissue showed that cisplatin reduced the number of SGNs in the basal cochlea, and the number of surviving SGNs was higher in the linalool group compared to the damaged group. Figure 32 ).

[0148] The above description is only a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of aldose reductase inhibitors, which are ulinastatin and / or epalrestat, as a medicament for treating or preventing drug-induced hearing loss, wherein the drug-induced hearing loss is caused by cisplatin, a platinum-based drug.

2. Use according to claim 1, wherein The epalrestat is administered intraperitoneally at a dose of 20-40 mg / kg, and the ulinastatin is administered intratympanically at a dose of 0.175-0.3 mg / kg per ear.

Images