An AAV carrier and its application

Abstract

This invention provides an AAV vector and its applications. The AAV vector comprises a nucleic acid fragment encoding a tat-degrading peptide. The AAV vector designed in this invention, comprising a nucleic acid fragment encoding a secretory tat-degrading peptide, can be continuously expressed in the peripheral environment. The expressed degrading peptide can cross the blood-brain barrier and cell membrane to achieve long-term intervention in central nervous system diseases, or it can be continuously expressed in the central nervous system and cross the cell membrane to exert its effects in both AAV-infected and non-infected cells. In other words, the AAV vector of this invention achieves broad and long-term delivery of degrading peptide drugs.

Description

Technical Field

[0001] This invention relates to an AAV vector and its application, belonging to the field of adeno-associated virus vector drugs. Background Technology

[0002] Traditional peptide drugs, especially those composed entirely of natural amino acids, are typically prone to rapid degradation in the body, resulting in short-lived effective drug concentrations and hindering their therapeutic efficacy. Furthermore, traditional peptide drugs cannot be taken orally and require repeated intramuscular injections. Additionally, they often fail to effectively cross the blood-brain barrier, making it difficult to reach the central nervous system and exert their therapeutic effects. Traditional degraded peptides are primarily used clinically for acute treatments (such as stroke), but suffer from problems such as difficulty maintaining effective drug concentrations in the body, lower efficacy in treating chronic diseases, and poor patient compliance with long-term injections.

[0003] To address the limitations of peptide drugs composed entirely of natural amino acids, such as rapid degradation in vivo, short duration of effective drug concentration, unstable efficacy, and high individual heterogeneity, adeno-associated virus (AAV) therapy has become a clinical option. The core of this technology is a simple AAV vector drug carrying the target gene, which aims to express the target gene in infected cells to supplement proteins that are missing or reduced. A single administration of the AAV vector drug can provide efficacy for 5-10 years. However, this technology has significant drawbacks: ① Low infection efficiency, with intervention limited to a small number of infected cells. ② Traditional adeno-associated viruses (AAV) or their encoded proteins cannot cross the blood-brain barrier and cell membranes, making it difficult to achieve broad intervention across infected cells, brain regions, and even peripheral centers. Summary of the Invention

[0004] To address the problems existing in the prior art, we propose an AAV carrier and its applications.

[0005] The present invention first provides an AAV vector comprising a nucleic acid fragment encoding a tat-degradation peptide.

[0006] The degradation peptides described in this invention refer to peptides that can target endogenous proteins and cause them to degrade.

[0007] The tat-degrading peptide described in this invention is a secreted tat-degrading peptide. The AAV vector designed in this invention, comprising a nucleic acid fragment encoding a secreted tat-degrading peptide, can be continuously expressed in the peripheral environment. The expressed degrading peptide can cross the blood-brain barrier and cell membrane to achieve long-term intervention in central nervous system diseases, or it can be continuously expressed in the central nervous system and cross the cell membrane to exert its effects in both AAV-infected and non-infected cells. In other words, the AAV vector of this invention achieves broad and long-term delivery of degrading peptide drugs.

[0008] The tat mentioned in this invention refers to human immunodeficiency virus-1 transcription activator, also abbreviated as HIV-1tat, which is a cell-penetrating peptide that enters cells in a non-toxic and efficient manner.

[0009] According to a specific embodiment of the present invention, preferably, the degradation peptide is: a peptide that mediates the degradation of endogenous proteins carrying a deg tag or a CTM tag;

[0010] Preferably, the amino acid sequence of the deg tag is as shown in SEQ ID NO.1;

[0011] SEQ ID NO.1: RRRG;

[0012] Preferably, the amino acid sequence of the CTM tag is as shown in SEQ ID NO.2;

[0013] SEQ ID NO.2: KFERQ.

[0014] According to a specific embodiment of the present invention, preferably, the amino acid sequence of the tat is as shown in SEQ ID NO.3;

[0015] SEQ ID NO.3: YGRKKRRQRRR;

[0016] Preferably, the nucleic acid sequence encoding tat is shown in SEQ ID NO.4;

[0017] SEQ ID NO. 2: TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA.

[0018] According to a specific embodiment of the present invention, preferably, the degradation peptide is βSyn-deg;

[0019] The amino acid sequence of βsyn-deg is shown in SEQ ID NO.5;

[0020] SEQ ID NO.5: YGRKKRRQRRRRTKSGVYLVGRRRG;

[0021] Preferably, the nucleic acid sequence encoding βsyn-deg is shown in SEQ ID NO. 6;

[0022] SEQ ID NO.6:

[0023] CGTACTAAATCTGGTGTTTATTTGGTTGGTCGACGACGAGGC.

[0024] The deg described in this invention, also known as degron, mediates the binding of α-synuclein (α-syn) to the proteasome within the tat-βsyn-degron structure, inducing α-synuclein degradation. The tat-βsyn-degron of this invention can effectively and specifically reduce α-synuclein levels.

[0025] Physiological synuclein includes three types: α-synuclein, β-synuclein, and γ-synuclein. Physiological α-synuclein is a disordered monomer, while pathological synuclein is a monomer in a pathologically aggregated state, i.e., toxic α-synuclein. The secretory tat-degrading peptide described in this invention can recognize and bind to α-synuclein through its encoded β-synuclein sequence, mediating targeted degradation.

[0026] According to a specific embodiment of the present invention, preferably, the degradation peptide is βsyn-CTM;

[0027] The amino acid sequence of βsyn-CTM is shown in SEQ ID NO.7;

[0028] SEQ ID NO.7: YGRKKRRQRRRRTKSGVYLVGKFERQ.

[0029] According to a specific embodiment of the present invention, preferably, the AAV vector further includes a promoter sequence;

[0030] Preferably, the promoter is a CMV promoter or a cell type-specific promoter;

[0031] Preferably, the cell type-specific promoter is EF1a or hSyn.

[0032] According to a specific embodiment of the present invention, preferably, the serotype of the AAV vector is AAV9, AAV2, AAV5, or AAV8. The present invention does not explicitly limit the serotype of the AAV virus used. In practical applications, the corresponding serotype of AAV virus can be used depending on the injection site. For example, serotype AAV9, which has the ability to cross the blood-brain barrier, can be selected for peripheral injection, while serotypes AAV2, AAV5, or AAV8, which do not have the ability to cross the blood-brain barrier, can be selected for central local injection.

[0033] A second aspect of this invention provides the use of the aforementioned AAV carrier in the preparation of a medicament for intervening in central nervous system diseases. The medicament exhibits broad-spectrum and long-lasting intervention effects on central nervous system diseases.

[0034] A third aspect of the present invention provides a medicament comprising the aforementioned AAV carrier and pharmaceutically acceptable excipients.

[0035] According to a specific embodiment of the present invention, preferably, the drug is an injectable preparation; more preferably, the drug is a brain injectable preparation.

[0036] The beneficial effects of this invention are:

[0037] 1. The AAV vector designed in this invention, comprising a nucleic acid fragment encoding a tat-degradable peptide, is superior to traditional nucleic acid interventions, which suffer from low infection efficiency and limited intervention effects to a small number of infected cells. This AAV vector can achieve broad delivery and long-term intervention by continuously secreting the degradable peptide by infected cells, thereby crossing the blood-brain barrier and cell membrane. In practical applications, the AAV vector of this invention effectively solves the problems of traditional degradable peptide drugs, such as difficulty in maintaining effective drug concentrations in vivo, low efficacy in treating chronic diseases, and poor patient compliance with long-term injections. In other words, the AAV vector of this invention achieves broad and long-term delivery of traditional degradable peptide drugs, expanding their application scenarios.

[0038] 2. The AAV vector designed in this invention, comprising a nucleic acid fragment encoding a tat-degradable peptide, can be injected at specific sites during neurosurgery for sustained expression, thereby enabling cross-cell membrane and cross-brain region intervention for disease. In other words, the AAV vector of this invention achieves injection into a single brain region while exerting its effects in multiple brain regions.

[0039] 3. The AAV vector designed in this invention, comprising a nucleic acid fragment encoding a tat-degradable peptide, can express the target gene for a long period in the host, achieving the goal of long-term central nervous system intervention with a single dose. This also solves the problems of traditional AAV vectors acting only on transfected cells, making it difficult to intervene in central nervous system diseases, and the poor efficacy of traditional natural peptide drugs due to rapid degradation in vivo, which makes it difficult to maintain an effective drug concentration.

[0040] 4. The AAV vector designed in this invention is an improvement on traditional AAV vectors and traditional degraded peptide therapy. It also has the advantages of traditional AAV viral vector therapy, such as good safety, therapeutic potential, long-term efficacy and clinical feasibility, as well as the gene-encoding characteristics of peptide drugs. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the vector structure after inserting the tat-βsyn-degron nucleic acid fragment in this embodiment.

[0042] Figure 2 This diagram shows the expression pattern of the AAV vector constructed in Example 1 in an animal model.

[0043] Figure 3 This shows the location and coordinates of the intracerebral injection in Experiment Example 1. Figure 3 The right-middle figure shows the expression distribution of green fluorescent protein and tat.

[0044] Figure 4 This shows the levels of α-synuclein in the right substantia nigra and striatum of a Parkinson's disease mouse model three months after injection.

[0045] Figure 5 The study showed the time and distance of movement on the rotarod in Parkinson's disease mice three months after injection.

[0046] Figure 6 This shows the time Parkinson's disease mice spent in the central region of the open field three months after injection. Detailed Implementation

[0047] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0048] Example 1

[0049] This embodiment provides a method for constructing an AAV vector including a tat-βsyn-degron structure. It includes:

[0050] (1) Synthesize the nucleic acid fragment encoding tat-βsyn-degron in vitro. Its sequence is: SEQ ID NO.8: ATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGACGTACTAAATCTGGTGT TTATTTGGTTGGTCGACGACGAGGCTGA.

[0051] (2) Constructing expression carriers.

[0052] AAV expression vector (or pAAV virus) was constructed by using serotypes AAV2 / 9 that infect local tissues, such as local brain regions, and by driving tat-βSyn-degron transcription and expression via the CMV promoter.

[0053] Figure 1 This is a schematic diagram of the vector structure after inserting the tat-βsyn-degron nucleic acid fragment in this embodiment. The vector structure is denoted as: pAAV-CMV-tat-βSyn-Deg-ef1a-egfp-3×flag. This virus can be obtained through Shanghai Heyuan Biotechnology.

[0054] Experimental Example 1

[0055] This experimental example demonstrates the transmembrane expression of the AAV vector constructed in Example 1 within an animal model.

[0056] The schematic diagram of the expression of the AAV vector constructed in Example 1 in an animal model is shown below. Figure 2 As shown. Figure 2 In the middle, the left side indicates injection via local intracerebral injection or intravenous injection (see injection method). Figure 2 (Right side) Cells transfected with AAV can express and secrete the pharmacologically active tat-βsyn-deg degradation peptide for an extended period. This degradation peptide can be secreted from the host cell under the mediation of the tat transmembrane sequence and enter surrounding infected or uninfected cells to exert its pharmacological effect. Based on the characteristic of AAV long-term expression of the target gene, this system has a long-lasting effect. We call this technology an in vivo brain cell pharmaceutical factory.

[0057] like Figure 3 Inject 1 μL of 2 × 10⁻⁶ mg / L solution into the striatum of mice. 12 After injecting the aforementioned pAAV virus at a concentration of vg / ml for 30 days, animal perfusion fixation and staining revealed highly efficient expression of fluorescent protein (EGFP) in the striatum. Furthermore, due to its transmembrane diffusion effect, the distribution of tat was significantly wider than in host cells expressing only EGFP. Figure 3 The enlarged image on the right also shows the phenomenon of red TAt-positive cells emerging from and spreading from green shaping cells, demonstrating the feasibility of the in vivo cell pharmaceutical factory technology.

[0058] Experiment Example 2

[0059] This experimental example demonstrates the effectiveness of the AAV vector constructed in Example 1 in expressing the vector in an animal model.

[0060] Existing literature has demonstrated that tat-βSyn-deg can target and reduce the level of the protein α-synuclein. However, the effect of existing tat-βSyn-deg drugs diminishes rapidly after a single injection, requiring daily intravenous administration. Furthermore, they only provide minor improvement in motor dysfunction and cannot provide long-term and significant improvement in motor and non-motor impairments in central degenerative diseases.

[0061] This experiment explores the efficacy of the AAV vector constructed in Example 1 in animal models from the following two aspects.

[0062] (1) AAV control virus encoding a disordered polypeptide of the same length as tat- was injected into the left substantia nigra of a 9-month-old Parkinson's disease mouse model (A53T mouse), and the aforementioned pAAV-CMV-tat-βSyn-deg-ef1a-egfp-3xflag was injected into the right substantia nigra. The polypeptide with pharmacological effects was continuously produced by the in vivo cellular pharmaceutical factory.

[0063] The results are as follows Figure 4 As shown, three months after injection, compared with the control virus on the left side, the AAV vector of this invention significantly reduced the level of α-synuclein in the right substantia nigra and its downstream striatum in a Parkinson's disease mouse model (A53T mouse), with GAPDH as an internal control. This confirms that the drugs produced in the brain by the AAV vector of this invention through a cell factory can exert their therapeutic effects.

[0064] (2) A53T mice aged 3 months, 6 months, and 9 months were selected. The left substantia nigra of these mice (3 months, 6 months, and 9 months) was injected with the control virus (ctl), and the right substantia nigra was injected with the aforementioned pAAV-CMV-tat-βSyn-deg-ef1a-egfp-3xflag virus (deg). Three months later, compared with the age-matched control A53T mice with the right substantia nigra injected with the control virus, the 6-month-old, 9-month-old, and 12-month-old mice showed significantly higher levels of rotator cirrus (e.g., thrombocytopenia) in the rotator cirrus. Figure 5 The level of exercise improved significantly in the open field (5 times) and in the open field ( Figure 6 Anxiety levels were significantly reduced within 10 minutes. Specifically:

[0065] Figure 5 Compared to the control group, 3-month-old and 6-month-old A53T mice injected with the control virus in the left substantia nigra and the aforementioned pAAV-CMV-tat-βSyn-deg-ef1a-egfp-3xflag virus in the right substantia nigra showed a significant increase in rotarod movement time and distance after 3 months. In the 9-month-old group, due to the late intervention, a large number of dopamine neurons in the substantia nigra had already died before the intervention; therefore, tat-βSyn-deg had no significant effect on improving motor dysfunction in the 9-month-old A53T mice. This suggests that the degradation of toxic proteins by tat-βSyn-deg is more suitable for improving motor dysfunction in early to mid-stage Parkinson's disease (PD).

[0066] Figure 6Compared with the control group, A53T mice in the 3-month (3M), 6-month (6M), and 9-month (9M) age groups, after being injected with the control virus (ctl) in the left substantia nigra and the aforementioned pAAV-CMV-tat-βSyn-deg-ef1a-egfp-3xflag virus (deg) in the right substantia nigra, showed a significant increase in the proportion of time spent in the central open field after 3 months. This indicates that the tat-βSyn-deg drug can significantly improve non-motor impairments in PD that have a low dependence on dopaminergic neurons in the substantia nigra, making it suitable for late-stage PD treatment.

[0067] The above experimental results not only demonstrate the feasibility of the technology provided by this invention, but also confirm that the AAV carrier drug of this invention can significantly improve motor and non-motor impairments in Parkinson's disease model mice. The AAV carrier drug of this invention achieves the effect of long-term treatment with a single dose, and solves the problem that ordinary AAV carrier drugs cannot penetrate transfected cells, enabling them to penetrate transfected cells and exert therapeutic effects in multiple brain regions throughout the brain. Furthermore, the AAV carrier drug of this invention also solves the problem that traditional natural polypeptide drugs suffer from poor efficacy due to rapid degradation in vivo, making it difficult to maintain effective drug concentrations for a long period, thus resulting in insignificant improvement in motor and non-motor impairments.

Claims

1. An AAV vector, said AAV vector comprising a nucleic acid fragment encoding a tat-degradable peptide; The amino acid sequence of the tat is shown in SEQ ID NO. 3; SEQ ID NO.3: YGRKKRRQRRR; The degradation peptide is βSyn-deg, and the amino acid sequence of βSyn-deg is shown in SEQ ID NO. 5; SEQ ID NO. 5: RTKSGVYLVGRRRG; The serotype of the AAV vector is: AAV2 / 9; The AAV vector also includes a promoter sequence, which includes the CMV promoter and EF1a; After local intracerebral injection or intravenous injection, the AAV vector causes cells in the whole brain to be transfected and infected to express and secrete tat-βsyn-deg degradative peptides with pharmacological effects. The tat-βsyn-deg degradative peptides expressed and secreted by the cells in the whole brain can also be secreted from the transfected cells and then enter the surrounding uninfected cells.

2. The AAV carrier according to claim 1, wherein The nucleic acid sequence encoding the tat is shown in SEQ ID NO. 4; SEQ ID NO.4: TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA.

3. The AAV vector according to claim 1, wherein the nucleic acid sequence encoding the βsyn-deg is shown in SEQ ID NO. 6; SEQ ID NO.6: CGTACTAAATCTGGTGTTTATTTGGTTGGTCGACGACGAGGC.

4. The use of the AAV carrier according to any one of claims 1-3 in the preparation of a medicament for broad and long-term intervention in Parkinson's disease.

5. A medicament comprising the AAV carrier as described in any one of claims 1-3, and pharmaceutically acceptable excipients.

6. The medicament according to claim 5, wherein, The drug is an injectable form.

7. The drug according to claim 6, wherein, The drug is a brain injection or an intravenous injection.

Images