Combined haplotype molecular markers of LCd7 gene related to cadmium content in rice grains and its application

Abstract

The present invention discloses a combined haplotype molecular marker of a gene LCd7 related to cadmium content in rice grains and its application. The present invention belongs to the field of biotechnology, and specifically relates to a combined haplotype molecular marker of a gene LCd7 related to cadmium content in rice grains and its application. The cadmium content of rice is identified or assisted in identification by detecting the polymorphism or genotype of rice TagSNP‑14208267 or / and 6 SNPs. The cadmium content of rice with a genotype of AA of TagSNP‑14208267 is lower than that of rice with a genotype of CC. The cadmium content of rice grains with a low-cadmium combined haplotype Multi‑HAP3 is significantly lower than that of Multi‑HAP1 and Multi‑HAP2, indicating that TagSNP‑14208267 and the combined haplotype Multi‑HAP3 can be used for early prediction and screening of cadmium accumulation in rice grains, and for rice breeding and breeding of low-cadmium rice.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a combined haplotype molecular marker of a rice grain cadmium content-related gene LCd7 and an application thereof. Background Art

[0002] Rice is one of the most important food crops in the world, and more than half of the world's population relies on rice as their staple food. Heavy metal pollution in farmland is a major environmental problem facing the world today, and has attracted widespread attention from all walks of life. Heavy metal pollution is complex and hidden, and its harm is long-lasting. It may endanger human health, especially through the enrichment of the food chain. Among them, cadmium is one of the most toxic heavy metal elements to the environment, and it poses a serious threat to the safe production of food crops such as rice.

[0003] Cadmium is extremely toxic to organisms, especially in humans, where its half-life is as long as 30 years. Long-term consumption of rice contaminated with cadmium increases the risk of lung cancer, kidney and liver diseases, and Itai-itai disease. The safety of food crops is closely related to human health, but the treatment of cadmium-contaminated farmland is long and difficult. Therefore, it is particularly important to produce safe food crops without wasting existing farmland.

[0004] Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome. It is the smallest variation unit and is a variation form formed by the substitution, transversion, insertion or deletion of a single nucleotide pair. Haplotype is a group of related SNP alleles located in a certain area on a chromosome. Single nucleotide polymorphism markers have the characteristics of genetic stability, large number, wide distribution and easy detection, and are suitable for large-scale detection and analysis. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to identify or assist in identifying the cadmium accumulation trait of rice or how to identify or assist in identifying the cadmium content of rice grains or how to carry out rice breeding.

[0006] In order to solve the above technical problems, the present invention first provides an application, wherein the application is the following P1, P2 or P3,

[0007] The P1 is an application of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in identifying or assisting in identifying the cadmium content of rice, wherein TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C;

[0008] The P2 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and 6 SNPs in identifying or assisting in identifying the cadmium content of rice, wherein the 6 SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395:

[0009] The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A;

[0010] The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A;

[0011] The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A;

[0012] The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A;

[0013] The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A;

[0014] The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T;

[0015] The P3 is the application of a substance for detecting a combined haplotype in identifying or assisting in identifying the cadmium content in rice, wherein the combined haplotype is a polymorphic combination of the seven SNPs on the rice chromosome, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267.

[0016] In order to solve the above technical problems, the present invention further provides an application, wherein the application is Q1, Q2 or Q3:

[0017] Q1 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in the preparation of a product for identifying or assisting in identifying the cadmium content of rice, wherein TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C;

[0018] Q2 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and other 6 SNPs in the preparation of a product for identifying or assisting in identifying the cadmium content of rice, wherein the 6 SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395:

[0019] The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A;

[0020] The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A;

[0021] The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A;

[0022] The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A;

[0023] The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A;

[0024] The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T;

[0025] The Q3 is the use of a substance for detecting a combined haplotype in the preparation of a product for identifying or assisting in identifying the cadmium content in rice. The combined haplotype is a polymorphic combination of the seven SNPs on the rice chromosome, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267.

[0026] In order to solve the above technical problems, the present invention further provides the following application of E1, E2 or E3:

[0027] The E1 is the application of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in rice breeding or preparing rice breeding products. The TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence table, and is A or C.

[0028] The E2 is an application of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and other 6 SNPs in rice breeding or preparing rice breeding products, wherein the 6 SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395:

[0029] The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A;

[0030] The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A;

[0031] The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A;

[0032] The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A;

[0033] The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A;

[0034] The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T.

[0035] The E3 is the application of a substance for detecting a combined haplotype in rice breeding or preparing a rice breeding product, wherein the combined haplotype is a polymorphic combination of the seven SNPs on the rice chromosome, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267.

[0036] In order to solve the above technical problems, the present invention also provides a product, which contains the above product for detecting the polymorphism or genotype of TagSNP-14208267 in the rice genome, or contains the above substance for detecting the polymorphism or genotype of the seven SNPs of OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267 in the rice genome, or contains the substance for detecting the combined haplotype as claimed in claim 1, and can be any one of the following G1)-G3):

[0037] G1) Products for detecting single nucleotide polymorphisms or genotypes related to cadmium content in rice;

[0038] G2) Products that identify or assist in identifying the cadmium content in rice;

[0039] G3) Products used in rice breeding.

[0040] In order to solve the above technical problems, the present invention also provides a method for identifying or assisting in identifying the cadmium content of rice, the method comprising method A and method B:

[0041] The method A is to detect the polymorphism or genotype of TagSNP-14208267 in the rice genome in the tested rice, and identify or assist in identifying the cadmium content of the rice according to the genotype of the tested rice: the cadmium content of the rice whose genotype of TagSNP-14208267 is AA is lower than or is a candidate to be lower than that of the rice whose genotype of TagSNP-14208267 is CC, wherein AA is a homozygous type of TagSNP-14208267 being A; and CC is a homozygous type of TagSNP-14208267 being C;

[0042] The method B is to detect the polymorphism or genotype of the seven SNPs, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267, in the rice genome of the rice to be tested, and identify or assist in identifying the cadmium content of the rice according to the genotype of the rice to be tested: the cadmium content of the grain of the rice whose genotype of the seven SNPs is genotype AAAAAAGGCCTTAA is lower than or candidate lower than the rice whose genotype of the seven SNPs is genotype GGGGGGAAAACCCC or genotype GGGGAAGGCCTTAA.

[0043] The rice with the genotype AAAAAAGGCCTTAA is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is AA, the genotype of OsHMA2-TagSNP-29481835 is AA, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is AA;

[0044] The rice with the genotype GGGGGGAAAACCCC is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is GG, the genotype of OsHMA2-TagSNP-29481835 is GG, the genotype of OsHMA3-TagSNP-7406920 is GG, the genotype of OsMTP1-TagSNP-1679325 is AA, the genotype of OsNramp1-TagSNP-8965009 is AA, the genotype of OsNramp5-TagSNP-8880395 is CC, and the genotype of TagSNP-14208267 is CC;

[0045] The rice with the genotype GGGGAAGGCCTTAA is a combined genotype of 7 SNPs, including OsCd1-TagSNP-840593 having a genotype of GG, OsHMA2-TagSNP-29481835 having a genotype of GG, OsHMA3-TagSNP-7406920 having a genotype of AA, OsMTP1-TagSNP-1679325 having a genotype of GG, OsNramp1-TagSNP-8965009 having a genotype of CC, OsNramp5-TagSNP-8880395 having a genotype of TT, and TagSNP-14208267 having a genotype of AA.

[0046] The application of the above method for identifying or assisting in identifying the cadmium content in rice in rice breeding also falls within the protection scope of the present invention.

[0047] The present invention also provides a method for rice breeding, which comprises method A and method B:

[0048] The method A is to detect the polymorphism or genotype of the TagSNP-14208267 in the rice genome to be tested, and select the homozygous rice with the genotype of TagSNP-14208267 being AA as the parent for breeding;

[0049] The method B is to detect the polymorphism or genotype of the seven SNPs, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267, in the above-mentioned test rice genome in the test rice, and select the rice with the genotype of the seven SNPs as the genotype AAAAAAGGCCTTAA as the parent for breeding. The rice with genotype AAAAAAGGCCTTAA is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is AA, the genotype of OsHMA2-TagSNP-29481835 is AA, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is AA.

[0050] The rice to be tested mentioned above is a rice inbred line. In the above application, the rice inbred line is selected as a parent for breeding.

[0051] In the above applications and methods, the purpose of rice breeding includes cultivating rice with low cadmium content or selecting rice varieties with low cadmium content.

[0052] In the above applications, methods and products, the substance for detecting the polymorphism or genotype of the seven SNPs, namely, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267, or the substance for detecting the combined haplotype may be the following D1), D2), D3) or D4):

[0053] D1) containing PCR primers for amplifying a rice genomic DNA fragment including the above-mentioned TagSNP-14208267;

[0054] D2) containing PCR primers for amplifying a rice genomic DNA fragment including the OsCd1-TagSNP-840593, the OsHMA2-TagSNP-29481835, the OsHMA3-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagSNP-8965009, the OsNramp5-TagSNP-8880395 and the TagSNP-14208267 of claim 1;

[0055] D3) a PCR reagent containing the PCR primers described in D1) or D2);

[0056] D4) A kit containing the PCR primers described in D1) or D2) or the PCR reagents described in D3).

[0057] In the above application, product or method, the PCR primers contain the TagSNP-14208267 primer set or the 7 primer sets:

[0058] 1) The TagSNP-14208267 primer set consists of TagSNP-14208267-A, TagSNP-14208267-B and TagSNP-14208267-C;

[0059] Primer TagSNP-14208267-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 8 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 8 in the sequence list;

[0060] Primer TagSNP-14208267-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 9 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 9 in the sequence list;

[0061] The primer TagSNP-14208267-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 10 in the sequence list;

[0062] 2) the 7 primer sets consist of the TagSNP-14208267 primer set, the OsCd1-TagSNP-840593 primer set, the OsHMA2-TagSNP-29481835 primer set, the OsHMA3-TagSNP-7406920 primer set, the OsMTP1-TagSNP-1679325 primer set, the OsNramp1-TagSNP-8965009 primer set and the OsNramp5-TagSNP-8880395 primer set,

[0063] The OsCd1-TagSNP-840593 primer set consists of primers OsCd1-TagSNP-840593-A, OsCd1-TagSNP-840593-B and OsCd1-TagSNP-840593-C;

[0064] The primer OsCd1-TagSNP-840593-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 11 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 44th positions of sequence 11 in the sequence list;

[0065] The primer OsCd1-TagSNP-840593-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 12 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 12 in the sequence list;

[0066] The primer OsCd1-TagSNP-840593-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 13 in the sequence list;

[0067] The OsHMA2-TagSNP-29481835 primer set consists of primers OsHMA2-TagSNP-29481835-A, OsHMA2-TagSNP-29481835-B and OsHMA2-TagSNP-29481835-C;

[0068] The primer OsHMA2-TagSNP-29481835-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 14 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of sequence 14 in the sequence list;

[0069] The primer OsHMA2-TagSNP-29481835-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 15 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 48th position of sequence 15 in the sequence list;

[0070] The primer OsHMA2-TagSNP-29481835-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 16 in the sequence list;

[0071] The OsHMA3-TagSNP-7406920 primer set consists of primers OsHMA3-TagSNP-7406920-A, OsHMA3-TagSNP-7406920-B and OsHMA3-TagSNP-7406920-C;

[0072] The primer OsHMA3-TagSNP-7406920-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 17 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 17 in the sequence list;

[0073] The primer OsHMA3-TagSNP-7406920-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 18 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 18 in the sequence list;

[0074] The primer OsHMA3-TagSNP-7406920-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 19 in the sequence list;

[0075] The OsMTP1-TagSNP-1679325 primer set consists of primers OsMTP1-TagSNP-1679325-A, OsMTP1-TagSNP-1679325-B and OsMTP1-TagSNP-1679325-C;

[0076] The primer OsMTP1-TagSNP-1679325-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 20 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 51 of sequence 20 in the sequence list;

[0077] The primer OsMTP1-TagSNP-1679325-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 21 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 50 of sequence 21 in the sequence list;

[0078] The primer OsMTP1-TagSNP-1679325-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 22 in the sequence list;

[0079] The OsNramp1-TagSNP-8965009 primer set consists of primers OsNramp1-TagSNP-8965009-A, OsNramp1-TagSNP-8965009-B and OsNramp1-TagSNP-8965009-C;

[0080] The primer OsNramp1-TagSNP-8965009-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 23 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-47 of sequence 23 in the sequence list;

[0081] The primer OsNramp1-TagSNP-8965009-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 24 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 49 of sequence 24 in the sequence list;

[0082] The primer OsNramp1-TagSNP-8965009-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 25 in the sequence list;

[0083] The OsNramp5-TagSNP-8880395 primer set consists of primers OsNramp5-TagSNP-8880395-A, OsNramp5-TagSNP-8880395-B and OsNramp5-TagSNP-8880395-C;

[0084] The primer OsNramp5-TagSNP-8880395-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 26 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-43 of sequence 26 in the sequence list;

[0085] The primer OsNramp5-TagSNP-8880395-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 27 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 41 of sequence 27 in the sequence list;

[0086] The primer OsNramp5-TagSNP-8880395-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 28 in the sequence list.

[0087] In the above applications and methods, the substance for detecting the polymorphism or genotype of the seven SNPs TagSNP-14208267, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395, or the substance for detecting the combined haplotype can be determined by at least one of the following methods: The nucleotide types of seven sites in the rice genome, namely TagSNP-14208267, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395, were described: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein DNA binding reactions, and chips based on fluorescent molecule DNA binding reactions.

[0088] In the above applications and methods, the PCR primer may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels such as 32 P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., directly reading the sequence).

[0089] In the above applications and methods, the product may be a reagent or a kit or a system. The system may include a combination product of a reagent or a kit, an instrument and an analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), and a combination product consisting of PCR primers, PARMS master mix reagents, online software SNP decoder and a fluorescence quantitative PCR instrument. The product may include the above-mentioned substances for detecting the polymorphism or genotype of the seven SNPs TagSNP-14208267, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395 in the rice genome.

[0090] In the above applications and methods, the cadmium content in the rice variety with low cadmium content is relative to the hybrid parent rice. If the cadmium content of the two hybrid parent rices is the same, the cadmium content of the rice variety with low cadmium content may be equal to or lower than the cadmium content of the hybrid parent rice; if the cadmium content of the two hybrid parent rices is different, the cadmium content of the rice variety with low cadmium content may be equal to or lower than the hybrid parent rice with higher cadmium content among the two hybrid parent rices.

[0091] The present invention provides a LCd7 gene SNP molecular marker identification or auxiliary identification of rice grain cadmium content. Molecular marker-assisted selection breeding can be selected for target traits at the DNA level, not only with stable results, but also can be selected at the seedling stage, reducing the cost of phenotypic evaluation and improving breeding efficiency. At the same time, the SNP site of the LCd7 gene and the combined haplotype of the other six rice grain cadmium accumulation-related genes can be used to assist in the identification or auxiliary identification of the rice grain cadmium content. DETAILED DESCRIPTION

[0092] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0093] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0094] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0095] The 365 rice materials in the following examples are all provided by the Rice Germplasm Resources, Genomics and Molecular Breeding (RGGMB) Laboratory of the Plant Genetics and Breeding Department of the College of Agronomy and Biotechnology of China Agricultural University. The germplasm resources can be obtained from the China Crop Germplasm Resources Information Network (http: / / icgr.caas.net.cn / pztest.htm), and the specific information of some materials can be found in the formal publication (Research and Utilization of Chinese Rice Seed Resources and Core Germplasm, Li Zichao, China Agricultural University Press; 1st edition, May 1, 2013), and the detailed information of the varieties is shown in Table 1. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0096] Example 1. Molecular marker TagSNP-14208267 of the LCd7 gene related to cadmium content in rice grains and acquisition of a marker primer set

[0097] 1. Discovery of the molecular marker TagSNP-14208267 associated with rice LCd7 gene

[0098] The genome-wide association analysis of rice grain cadmium accumulation traits was performed using the mixed linear model (MLM) using the genome-wide association analysis software TASSEL 5.0. The Nipponbare genome sequence was used as the reference genome. The LCd7 gene was located at positions 14206980-14209164 on chromosome 3 of rice, and the SNP site was located at 14208267bp on chromosome 3 of rice. The SNP site (abbreviated as TagSNP-14208267) and the nucleotides nearby are shown in sequence 1 (antisense strand) of the sequence table. The 19th nucleotide of sequence 1 is the SNP site, which is A / C polymorphic, and there are two genotypes: the CC genotype is the homozygous type of TagSNP-14208267 in the rice genome as C, and the AA genotype is the homozygous type of TagSNP-14208267 in the rice genome as A. The m in sequence 1 in the sequence table represents a or c.

[0099] 2. Obtaining the primer set for SNP marker TagSNP-14208267

[0100] A primer set for detecting SNP polymorphic sites based on KASP technology (i.e., KASP marker TagSNP-14208267) was designed, referred to as KASP primer set. The KASP primer set consists of two upstream primers (TagSNP-14208267-A and TagSNP-14208267-B) and one downstream primer (TagSNP-14208267-C), and the specific sequences are as follows:

[0101] TagSNP-14208267 is located at the 19th nucleotide of the DNA molecule shown in Sequence 1 (antisense strand) of the sequence listing.

[0102] TagSNP-14208267-A: 5'- GAAGGTGACCAAGTTCATGCT CACCCGCGTCGTCACGTGA-3' (sequence 8), a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplify the fragment with SNP site TagSNP-14208267 as A. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0103] TagSNP-14208267-B: 5'- GAAGGTCGGAGTCAACGGATT ACCCGCGTCGTCACGTGC--3' (sequence 9) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site TagSNP-14208267 as C. The fluorescent signal of the VIC group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0104] TagSNP-14208267-C: 5′-TTCGATCGATCGCCCGAACTAACTT-3′ (SEQ ID NO: 10).

[0105] 3. Establishment of a method for detecting the genotype of rice SNP marker TagSNP-14208267 using KASP marker

[0106] 1) Extract genomic DNA from the leaves of the rice to be tested, and dilute to obtain a template solution. The DNA concentration in the template solution is 5-50 ng / μL.

[0107] 2) Conduct KASP

[0108] PCR amplification was performed with a specific primer pair, and detection was performed with a KASP reaction to determine the type of nucleotides labeled by the SNP molecule. The specific primer pair was TagSNP-14208267-A, TagSNP-14208267-B, and TagSNP-14208267-C in step 2. The KASP reaction system (1.622 μL) was: 0.8 μL of rice leaf genomic DNA, 2× Master mix

[0109] 0.4 μL, primer working solution 0.022 μL (Tris-HCl: TagSNP-14208267-A: TagSNP-14208267-B: TagSNP-14208267-C = 23:6:6:15), H2O 0.4 μL.

[0110] Add DNA samples to 96-well PCR plates, place the aliquoted DNA in an oven at 65°C for 30 minutes until the DNA is completely dry, and add one negative control (NTC) to each PCR plate. The KASP reaction program is as follows: denaturation at 94°C for 15 minutes; enrichment of template DNA containing SNP sites, denaturation at 94°C for 20 seconds, annealing and extension at 61-55°C, 60 seconds gradient annealing (0.6°C lowered for each cycle), 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 60 seconds, for a total of 26 cycles; if the typing is not obvious, add 5 more cycles for amplification, and the program for 5 cycles is as follows: denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 60 seconds, for a total of 5 cycles.

[0111] 3) Genotyping

[0112] After the PCR reaction is completed, the fluorescence signal is converted into an analyzable value using a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) to read the fluorescence data of the reaction product. The fluorescence scanning results are graphically displayed using the SNP viewer software package. The AA base type has FAM fluorescence, which is distributed near the x-axis; the CC base type has VIC fluorescence, which is distributed near the y-axis; and samples with no detected signals are distributed near the origin.

[0113] The excitation wavelength of FAM is 485nm, and the emission wavelength is 520nm. The excitation wavelength of VIC is 535nm, and the emission wavelength is 556nm. The excitation wavelength of the system reference fluorescence ROX is 575nm, and the emission wavelength is 610nm.

[0114] If only the fluorescence signal of the FAM group is displayed, the genotype of TagSNP-14208267 of the rice to be tested is AA (i.e., the SNP site TagSNP-14208267 in the rice genome is homozygous for A); if only the fluorescence signal of the VIC group is displayed, the genotype of TagSNP-14208267 of the rice to be tested is CC (i.e., the SNP site TagSNP-14208267 in the rice genome is homozygous for C).

[0115] 4. Determination of cadmium content in rice grains

[0116] Sow 365 rice materials, turn the soil over, irrigate after ridge making, apply pesticides and herbicides, and dry the field for 1-2 days before sowing. Soak the seeds in warm water for three days, and change the water twice a day. When the seeds turn white, start germination, which takes one and a half to two days. Sow after the seed buds are 5mm long. Sow the germinated seeds in the middle of the grid until they grow into seedlings. Two weeks later, pull out the seedlings according to the number, tie the landmark sign and the seedlings together with straw or nylon rope, and gently insert the roots into the mud. Plant 365 materials in two rows with a row spacing of 25cm; plant 8 plants in each row with a plant spacing of 20cm.

[0117] After the seeds matured, the recovered grain samples of 365 rice varieties were dried in the sun or placed in an oven at 60°C for 3 days. After the mass was constant, the rice was husked using a rice husker, and the obtained brown rice samples were placed in 5ml centrifuge tubes. The brown rice samples were then crushed using a high-throughput silent tissue grinder for subsequent cadmium content determination. Three replicates were set for the determination of cadmium content in rice grains of 365 rice varieties.

[0118] The cadmium content in rice grains was determined by single acid digestion method. The instrument used was a far-infrared temperature-controlled digestion furnace and the container was a glass digestion tube. The specific steps are briefly described as follows: (1) Weighing: Accurately weigh 0.2000g (accurate to 0.0001g) of crushed rice grain sample and put it into a glass digestion tube to prevent the powder from sticking to the wall; (2) Adding acid: Add 1ml of high-grade pure nitric acid and cold digest overnight; (3) Digestion: Cover with a bent-necked funnel and digest at 200℃ for 6h until the digestion liquid is colorless and transparent or slightly yellow; (4) Make up the volume: Wash the digestion liquid in the tube with distilled water, transfer the washing liquid to a 15ml fixed volume tube, and make up to 15ml; (5) Filtration: After shaking, use a 0.45μm water filter membrane to filter the liquid after making up to 10ml into a 10ml centrifuge tube for testing. The determination was set up with 3 replicates.

[0119] Quality control: Two blank controls and three rice flour component analysis standard substances (national standard substances, GBW100349, Steel Research Institute Nano-Test Technology Co., Ltd.) were set up for each batch of digestion to ensure that the cadmium content of rice grains was accurate and reliable. The cadmium content of rice grains was determined by inductively coupled plasma mass spectrometry.

[0120] The results are as follows: The TagSNP-14208267 genotypes and rice grain cadmium content of 365 rice varieties are shown in Tables 1 and 2: The average cadmium content of grains of 295 rice varieties with genotype CC is 0.52 mg / kg; the average cadmium content of grains of 70 rice varieties with genotype AA is 0.19 mg / kg, which is significantly lower than that of rice varieties with genotype CC. According to the national standard GB2762-2017, the cadmium limit index of paddy, brown rice and rice is Cd≤0.2 mg / kg. Among the 295 rice varieties with genotype CC, 273 rice varieties with genotype CC have rice grain cadmium content higher than 0.2 mg / kg, accounting for 92.54%. It can be seen from this that the cadmium content of rice with TagSNP-14208267 genotype AA is lower than that of rice with TagSNP-14208267 genotype CC, wherein genotype CC is the homozygous type of TagSNP-14208267 C; genotype AA is the homozygous type of TagSNP-14208267 A. TagSNP-14208267 of the present invention is a SNP molecular marker associated with low cadmium content in rice grains, which can be used for early prediction and screening of cadmium accumulation in rice grains, rice molecular marker-assisted selection breeding, and breeding of low-cadmium rice.

[0121] In breeding rice with low cadmium content, it is best to select rice with the genotype of the SNP site being AA as a parent for breeding.

[0122] Table 1. Cadmium content in rice grains of 365 rice varieties and genotypes of TagSNP-14208267

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134] Table 2. Cadmium content in rice grains of 365 rice varieties according to the genotype of TagSNP-14208267

[0135]

[0136] Example 2: Discovery of low-cadmium joint haplotypes of TagSNP-14208267 and six rice grain cadmium accumulation genes

[0137] A joint haplotype analysis was performed on the SNP molecular markers of six genes related to cadmium content in rice grains, including OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395, and each SNP site was divided into two genotypes (detailed genotypes are shown in Table 3).

[0138] The OsCd1 gene is located at positions 842386-846445 of rice chromosome 3. TagSNP-840593 is a SNP site in the rice genome, located at nucleotide position 840593 on rice chromosome 3 (nucleotide position 24 of sequence 2). It is a G / A polymorphism, and there are two genotypes. Genotype GG is the homozygous type in which OsCd1-TagSNP-840593 in the rice genome is G, and genotype AA is the homozygous type in which OsCd1-TagSNP-840593 in the rice genome is A. The r in sequence 2 in the sequence list represents g or a.

[0139] The SNP marker TagSNP-840593 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-840593 primer set). The TagSNP-840593 primer set consists of two upstream primers (OsCd1-TagSNP-840593-A and OsCd1-TagSNP-840593-B) and one downstream primer (OsCd1-TagSNP-840593-C), and the specific sequences are as follows:

[0140] OsCd1-TagSNP-840593-A: 5'- GAAGGTGACCAAGTTCATGCTAGCAGCAGACATAGTATGTAACG-3' (sequence 11) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsCd1-TagSNP-840593-C amplifies the fragment where the SNP site TagSNP-840593 is G. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0141] OsCd1-TagSNP-840593-B: 5'- GAAGGTCGGAGTCAACGGATT GAGCAGCAGACATAGTATGTAACA-3' (sequence 12) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsCd1-TagSNP-840593-C amplifies the fragment where the SNP site TagSNP-840593 is A. The fluorescent signal of the VIC group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0142] OsCd1-TagSNP-840593-C: 5′-CCCAATAGCCATATACTTATCCCAGATAA-3′ (SEQ ID NO: 13).

[0143] The OsHMA2 gene is located at positions 29477949-29480905 on chromosome 6 of rice. TagSNP-29481835 is a SNP site in the rice genome, located at nucleotide position 29481835 on chromosome 6 of rice (nucleotide position 25 of sequence 3). It is a G / A polymorphism, and there are two genotypes. Genotype GG is the homozygous type in which OsHMA2-TagSNP-29481835 in the rice genome is G, and genotype AA is the homozygous type in which OsHMA2-TagSNP-29481835 in the rice genome is A. The r in sequence 3 in the sequence list represents g or a.

[0144] The SNP marker TagSNP-29481835 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-29481835 primer set). The KASP primer set consists of two upstream primers (primer OsHMA2-TagSNP-29481835-A and primer OsHMA2-TagSNP-29481835-B) and one downstream primer (primer OsHMA2-TagSNP-29481835-C), and the specific sequences are as follows:

[0145] OsHMA2-TagSNP-29481835-A:5'- GAAGGTGACCAAGTTCATGCTATGATTTTACCCAAACAAGGAACCG-3' (sequence 14) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsHMA2-TagSNP-29481835-C amplifies the fragment where the SNP site TagSNP-29481835 is G. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0146] OsHMA2-TagSNP-29481835-B:5'- GAAGGTCGGAGTCAACGGATT TTATGATTTTACCCAAACAAGGAACCA-3' (sequence 15) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsHMA2-TagSNP-29481835-C amplifies the fragment where the SNP site TagSNP-29481835 is A. The fluorescent signal of the VIC group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0147] OsHMA2-TagSNP-29481835-C: 5′-TTTTTCTTCAACCTCCCCACTACTAGATA-3′ (SEQ ID NO: 16).

[0148] The OsHMA3 gene is located at positions 7405270-7410459 of chromosome 7 of rice. TagSNP-7406920 is a SNP site in the rice genome, located at nucleotide position 7406920 on chromosome 7 of rice (nucleotide position 19 of sequence 4). It is a G / A polymorphism, and there are two genotypes. Genotype GG is the homozygous type in which OsHMA3-TagSNP-7406920 in the rice genome is G, and genotype AA is the homozygous type in which OsHMA3-TagSNP-7406920 in the rice genome is A. The r in sequence 4 in the sequence list represents g or a.

[0149] The SNP marker TagSNP-7406920 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-7406920 primer set). The KASP primer set consists of two upstream primers (primer OsHMA3-TagSNP-7406920-A and primer OsHMA3-TagSNP-7406920-B) and one downstream primer (primer OsHMA3-TagSNP-7406920-C), and the specific sequences are as follows:

[0150] OsHMA3-TagSNP-7406920-A: 5'- GAAGGTGACCAAGTTCATGCTGACAAGGTCCGGCTCGTCA-3' (sequence 17) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsHMA3-TagSNP-7406920-C amplifies the fragment where the SNP site TagSNP-7406920 is A. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0151] OsHMA3-TagSNP-7406920-B: 5'- GAAGGTCGGAGTCAACGGATT ACAAGGTCCGGCTCGTCG-3' (sequence 18) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsHMA3-TagSNP-7406920-C amplifies a fragment where the SNP site TagSNP-7406920 is G. The fluorescent signal of the VIC group can be read using an ELISA reader or a fluorescent quantitative PCR instrument.

[0152] OsHMA3-TagSNP-7406920-C: 5′-TCATCCCGTCCCCGACCATCAT-3′ (SEQ ID NO: 19).

[0153] The OsMTP1 gene is located at positions 1675397-1679169 of chromosome 5 of rice. TagSNP-1679325 is a SNP site in the rice genome, located at nucleotide position 1679325 on chromosome 5 of rice (nucleotide position 30 of sequence 5). It is a G / A polymorphism, and there are two genotypes. Genotype AA is the homozygous type of OsMTP1-TagSNP-1679325 in the rice genome is A, and genotype GG is the homozygous type of OsMTP1-TagSNP-1679325 in the rice genome is G. The r in sequence 5 in the sequence list represents g or a.

[0154] The SNP marker TagSNP-1679325 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-1679325 primer set). The KASP primer set consists of two upstream primers (primer OsMTP1-TagSNP-1679325-A and primer OsMTP1-TagSNP-1679325-B) and one downstream primer (primer OsMTP1-TagSNP-1679325-C), and the specific sequences are as follows:

[0155] OsMTP1-TagSNP-1679325-A: 5'- GAAGGTGACCAAGTTCATGCTCCCATATGACAAATTTAAAGGACTTATTTA-3' (sequence 20) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsMTP1-TagSNP-1679325-C amplifies the fragment where the SNP site TagSNP-1679325 is A. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0156] OsMTP1-TagSNP-1679325-B: 5'- GAAGGTCGGAGTCAACGGATT CCATATGACAAATTTAAAGGACTTATTTG-3' (sequence 21) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsMTP1-TagSNP-1679325-C amplifies the fragment with SNP site TagSNP-1679325 as G. The fluorescent signal of the VIC group can be read using an ELISA reader or a fluorescence quantitative PCR instrument.

[0157] OsMTP1-TagSNP-1679325-C: 5'-GGTCCTTAAAATTTTGTTCCTGGGTCATT-3' (sequence 22).

[0158] The OsNramp1 gene is located at positions 8965791-8971843 of rice chromosome 7. TagSNP-8965009 is a SNP site in the rice genome, located at nucleotide position 8965009 on rice chromosome 7 (nucleotide position 26 of sequence 6). It is a C / A polymorphism, and there are two genotypes. Genotype AA is the homozygous type in which OsNramp1-TagSNP-8965009 in the rice genome is A, and genotype CC is the homozygous type in which OsNramp1-TagSNP-8965009 in the rice genome is C. The m in sequence 6 in the sequence list represents c or a.

[0159] The SNP marker TagSNP-8965009 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-8965009 primer set). The KASP primer set consists of two upstream primers (primer OsNramp1-TagSNP-8965009-A and primer OsNramp1-TagSNP-8965009-B) and one downstream primer (primer OsNramp1-TagSNP-8965009-C), and the specific sequences are as follows:

[0160] OsNramp1-TagSNP-8965009-A:5'- GAAGGTGACCAAGTTCATGCTTTTGAAGAGCGTTTATCCTATATACC-3' (sequence 23) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsNramp1-TagSNP-8965009-C amplifies the fragment with SNP site TagSNP-8965009 as C. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0161] OsNramp1-TagSNP-8965009-B:5'- GAAGGTCGGAGTCAACGGATT CTTTTGAAGAGCGTTTATCCTATATACA-3' (sequence 24) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsNramp1-TagSNP-8965009-C amplifies the fragment with SNP site TagSNP-8965009 as A. The fluorescent signal of the VIC group can be read using an enzyme reader or a fluorescent quantitative PCR instrument.

[0162] OsNramp1-TagSNP-8965009-C: 5′-GCAGAGATTTCCTAGTAGTGGGGAT-3′ (SEQ ID NO: 25).

[0163] The OsNramp5 gene is located at positions 8871208-8879186 of rice chromosome 7. TagSNP-8880395 is a SNP site in the rice genome, located at nucleotide position 8880395 on rice chromosome 7 (nucleotide position 22 of sequence 7). It is a C / T polymorphism and there are two genotypes. Genotype CC is the homozygous type in which OsNramp5-TagSNP-8880395 in the rice genome is C, and genotype TT is the homozygous type in which OsNramp5-TagSNP-8880395 in the rice genome is T. The y in sequence 7 in the sequence list represents c or t.

[0164] The SNP marker TagSNP-8880395 primer set is a primer set designed based on the KASP technology to detect SNP polymorphic sites (i.e., the KASP marker TagSNP-8880395 primer set). The KASP primer set consists of two upstream primers (primer OsNramp5-TagSNP-8880395-A and primer OsNramp5-TagSNP-8880395-B) and one downstream primer (primer OsNramp5-TagSNP-8880395-C), and the specific sequences are as follows:

[0165] OsNramp5-TagSNP-8880395-A:5'- GAAGGTGACCAAGTTCATGCTGTGTGGCGCGCTTTGTTTTCCT-3' (sequence 26) is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and OsNramp5-TagSNP-8880395-C amplifies the fragment where the SNP site TagSNP-8880395 is T. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0166] OsNramp5-TagSNP-8880395-B:5'- GAAGGTCGGAGTCAACGGATT GTGGCGCGCTTTGTTTTCCC-3' (sequence 27) is a primer with a VIC fluorescent tag sequence (underlined bases) at the 5' end, and OsNramp5-TagSNP-8880395-C amplifies a fragment with SNP site TagSNP-8880395 as C. The fluorescent signal of the VIC group can be read using an ELISA reader or a fluorescence quantitative PCR instrument.

[0167] OsNramp5-TagSNP-8880395-C: 5′-CCAAAGAAGTGCTATAGCGATGTGATTAT-3′ (SEQ ID NO: 28).

[0168] Table 3. Location information of 7 genes and their SNP sites

[0169]

[0170] The SNP molecular marker TagSNP-14208267 obtained in Example 1 was subjected to a combined haplotype analysis with the SNP molecular markers of the above six genes. The results showed that TagSNP-14208267 and the above six SNP molecular markers had three combined haplotypes:

[0171] 1) The combined haplotype Multi-HAP1 is the combined haplotype of the 7 SNP molecular markers in the rice genome (OsCd1-OsHMA2-OsHMA3-OsMTP1-OsNramp1-OsNramp5-LCd7) GG-GG-GG-AA-AA-CC-CC. That is, the genotype of the combined haplotype Multi-HAP1 is GGGGGGAAAACCCC, the genotype of OsCd1-TagSNP-840593 is GG, the genotype of OsHMA2-TagSNP-29481835 is GG, the genotype of OsHMA3-TagSNP-7406920 is GG, the genotype of OsMTP1-TagSNP-1679325 is AA, the genotype of OsNramp1-TagSNP-8965009 is AA, the genotype of OsNramp5-TagSNP-8880395 is CC, and the genotype of TagSNP-14208267 is the combined genotype of 7 SNPs.

[0172] 2) The combined haplotype Multi-HAP2 is a combined haplotype of the seven SNP molecular markers in the rice genome (OsCd1-OsHMA2-OsHMA3-OsMTP1-OsNramp1-OsNramp5-LCd7) GG-GG-AA-GG-CC-TT-AA. That is, the genotype of the combined haplotype Multi-HAP2 is GGGGAAGGCCTTAA, the genotype of OsCd1-TagSNP-840593 is GG, the genotype of OsHMA2-TagSNP-29481835 is GG, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is AA, which is a combined genotype of 7 SNPs.

[0173] 3) The combined haplotype Multi-HAP3 is a combined haplotype of the seven SNP molecular markers in the rice genome (OsCd1-OsHMA2-OsHMA3-OsMTP1-OsNramp1-OsNramp5-LCd7) AA-AA-AA-GG-CC-TT-AA. That is, the genotype of the combined haplotype Multi-HAP3 is AAAAAAGGCCTTAA, the genotype of OsCd1-TagSNP-840593 is AA, the genotype of OsHMA2-TagSNP-29481835 is AA, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is a combined genotype of 7 SNPs.

[0174] The cadmium content of rice grains was determined according to the method of step 4 in Example 1, and the results were as follows: the cadmium content of the combined haplotypes of 365 rice varieties is shown in Table 4, the average cadmium content of rice grains of the combined haplotype Multi-HAP1 is 0.52 mg / kg, the average cadmium content of rice grains of the combined haplotype Multi-HAP2 is 0.45 mg / kg, and the average cadmium content of rice grains of the combined haplotype Multi-HAP3 is 0.15 mg / kg. Among them, the cadmium content of rice grains of Multi-HAP3 is significantly lower than that of Multi-HAP1 and Multi-HAP2. Among the 60 Multi-HAP3 rice varieties, the cadmium content of rice grains of 45 rice varieties is lower than 0.2 mg / kg, accounting for 75%, indicating that Multi-HAP3 is a low-cadmium combined haplotype, which can be used for early prediction and screening of cadmium accumulation in rice grains, and for rice molecular marker-assisted selection breeding and breeding of low-cadmium rice. In breeding of rice with low cadmium content, it is best to select rice with a combined genotype of Multi-HAP3, a genotype of OsCd1-TagSNP-840593 of AA, a genotype of OsHMA2-TagSNP-29481835 of AA, a genotype of OsHMA3-TagSNP-7406920 of AA, a genotype of OsMTP1-TagSNP-1679325 of GG, a genotype of OsNramp1-TagSNP-8965009 of CC, a genotype of OsNramp5-TagSNP-8880395 of TT, and a genotype of TagSNP-14208267 of AA as a parent for breeding.

[0175] Table 4 Cadmium content in rice grains of three combined haplotypes

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187] Table 5. Cadmium content in rice grains of 365 rice varieties according to combined haplotypes

[0188]

[0189] In addition, compared with the rice variety with the AA genotype of TagSNP-14208267, the average cadmium content in the grains of the Multi-HAP3 rice variety was 0.15 mg / kg, which was significantly lower than that of the rice variety with the AA genotype of TagSNP-14208267 (0.19 mg / kg), indicating that the Multi-HAP3 low-cadmium combined haplotype is a more accurate and efficient way to identify or assist in the identification of the cadmium content in rice grains and the breeding of low-cadmium rice.

[0190] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application, characterized in that: The application is P1 or P2, The P1 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in identifying or assisting in identifying the cadmium content of rice grains, wherein TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; The P2 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and 6 SNPs in identifying or assisting in identifying the cadmium content of rice grains, wherein the 6 SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395: The TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A; The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A; The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A; The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A; The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A; The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T.

2. Application, characterized in that: The application is Q1 or Q2, Q1 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in the preparation of a product for identifying or assisting in identifying the cadmium content of rice grains, wherein TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; Q2 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and other six SNPs in the preparation of a product for identifying or assisting in identifying the cadmium content of rice grains, wherein the six SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395, The TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A; The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A; The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A; The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A; The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A; The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T.

3. Application, characterized in that: The application is E1 or E2, The E1 is the use of a substance for detecting the polymorphism or genotype of TagSNP-14208267 in rice breeding or preparing rice breeding products, wherein TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; The E2 is an application of a substance for detecting the polymorphism or genotype of TagSNP-14208267 and other 6 SNPs in rice breeding or preparing rice breeding products, wherein the 6 SNPs are OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009 and OsNramp5-TagSNP-8880395, The TagSNP-14208267 is a SNP in the rice genome, which is the 19th nucleotide of sequence 1 in the sequence list, and is A or C; The OsCd1-TagSNP-840593 is a SNP in the rice genome, which is the 24th nucleotide of sequence 2 in the sequence list, and is G or A; The OsHMA2-TagSNP-29481835 is a SNP in the rice genome, which is the 25th nucleotide of sequence 3 in the sequence list, and is G or A; The OsHMA3-TagSNP-7406920 is a SNP in the rice genome, which is the 19th nucleotide of sequence 4 in the sequence list, and is G or A; The OsMTP1-TagSNP-1679325 is a SNP in the rice genome, which is the 30th nucleotide of sequence 5 in the sequence list, and is G or A; The OsNramp1-TagSNP-8965009 is a SNP in the rice genome, which is the 26th nucleotide of sequence 6 in the sequence list, and is C or A; The OsNramp5-TagSNP-8880395 is a SNP in the rice genome, which is the 22nd nucleotide of sequence 7 in the sequence list, and is C or T; The purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

4. The use according to any one of claims 1 to 3, characterized in that: The substance is as follows (D1), (D2), (D3) or (D4): D1) containing PCR primers for amplifying a rice genomic DNA fragment including the TagSNP-14208267 of claim 1; D2) containing PCR primers for amplifying a rice genomic DNA fragment including the OsCd1-TagSNP-840593, the OsHMA2-TagSNP-29481835, the OsHMA3-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagSNP-8965009, the OsNramp5-TagSNP-8880395 and the TagSNP-14208267 of claim 1; D3) a PCR reagent containing the PCR primers described in D1) or D2); D4) A kit containing the PCR primers described in D1) or D2) or the PCR reagents described in D3).

5. The use according to claim 4, characterized in that: The PCR primers contain TagSNP-14208267 primer set or 7 primer sets, 1) The TagSNP-14208267 primer set consists of TagSNP-14208267-A, TagSNP-14208267-B and TagSNP-14208267-C; Primer TagSNP-14208267-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 8 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 8 in the sequence list; Primer TagSNP-14208267-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 9 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 9 in the sequence list; The primer TagSNP-14208267-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 10 in the sequence list; 2) The 7 primer sets consist of the TagSNP-14208267 primer set, OsCd1-TagSNP-840593 primer set, OsHMA2-TagSNP-29481835 primer set, OsHMA3-TagSNP-7406920 primer set, OsMTP1-TagSNP-1679325 primer set, OsNramp1-TagSNP-8965009 primer set and OsNramp5-TagSNP-8880395 primer set, The OsCd1-TagSNP-840593 primer set consists of primers OsCd1-TagSNP-840593-A, OsCd1-TagSNP-840593-A and OsCd1-TagSNP-840593-C; The primer OsCd1-TagSNP-840593-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 11 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 44th positions of sequence 11 in the sequence list; The primer OsCd1-TagSNP-840593-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 12 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 12 in the sequence list; The primer OsCd1-TagSNP-840593-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 13 in the sequence list; The OsHMA2-TagSNP-29481835 primer set consists of primers OsHMA2-TagSNP-29481835-A, OsHMA2-TagSNP-29481835-A and OsHMA2-TagSNP-29481835-C; The primer OsHMA2-TagSNP-29481835-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 14 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of sequence 14 in the sequence list; The primer OsHMA2-TagSNP-29481835-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 15 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 48th position of sequence 15 in the sequence list; The primer OsHMA2-TagSNP-29481835-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 16 in the sequence list; The OsHMA3-TagSNP-7406920 primer set consists of primers OsHMA3-TagSNP-7406920-A, OsHMA3-TagSNP-7406920-A and OsHMA3-TagSNP-7406920-C; The primer OsHMA3-TagSNP-7406920-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 17 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 17 in the sequence list; The primer OsHMA3-TagSNP-7406920-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 18 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 18 in the sequence list; The primer OsHMA3-TagSNP-7406920-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 19 in the sequence list; The OsMTP1-TagSNP-1679325 primer set consists of primers OsMTP1-TagSNP-1679325-A, OsMTP1-TagSNP-1679325-A and OsMTP1-TagSNP-1679325-C; The primer OsMTP1-TagSNP-1679325-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 20 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 51 of sequence 20 in the sequence list; The primer OsMTP1-TagSNP-1679325-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 21 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 50 of sequence 21 in the sequence list; The primer OsMTP1-TagSNP-1679325-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 22 in the sequence list; The OsNramp1-TagSNP-8965009 primer set consists of primers OsNramp1-TagSNP-8965009-A, OsNramp1-TagSNP-8965009-A and OsNramp1-TagSNP-8965009-C; The primer OsNramp1-TagSNP-8965009-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 23 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-47 of sequence 23 in the sequence list; The primer OsNramp1-TagSNP-8965009-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 24 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 49 of sequence 24 in the sequence list; The primer OsNramp1-TagSNP-8965009-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 25 in the sequence list; The OsNramp5-TagSNP-8880395 primer set consists of primers OsNramp5-TagSNP-8880395-A, OsNramp5-TagSNP-8880395-A and OsNramp5-TagSNP-8880395-C; The primer OsNramp5-TagSNP-8880395-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 26 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 43rd position of sequence 26 in the sequence list; The primer OsNramp5-TagSNP-8880395-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 27 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 41 of sequence 27 in the sequence list; The primer OsNramp5-TagSNP-8880395-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 28 in the sequence list.

6. The product is characterized by: The product contains the substance for detecting the polymorphism or genotype of TagSNP-14208267 in the rice genome as described in claim 1, or contains the substance for detecting the polymorphism or genotype of the seven SNPs of OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267 in the rice genome as described in claim 1, and can be any one of the following G1)-G3): G1) Products for detecting single nucleotide polymorphisms or genotypes related to cadmium content in rice grains; G2) Products for identifying or assisting in identifying the cadmium content in rice grains; G3) Products used for rice breeding, wherein the purpose of rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

7. The product according to claim 6, characterized in that: The substance is as follows (D1), (D2), (D3) or (D4): D1) containing PCR primers for amplifying a rice genomic DNA fragment including the TagSNP-14208267 of claim 1; D2) containing PCR primers for amplifying a rice genomic DNA fragment including the OsCd1-TagSNP-840593, the OsHMA2-TagSNP-29481835, the OsHMA3-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagSNP-8965009, the OsNramp5-TagSNP-8880395 and the TagSNP-14208267 of claim 1; D3) a PCR reagent containing the PCR primers described in D1) or D2); D4) A kit containing the PCR primers described in D1) or D2) or the PCR reagents described in D3).

8. The product according to claim 7, characterized in that: The PCR primers contain TagSNP-14208267 primer set or 7 primer sets, 1) The TagSNP-14208267 primer set consists of TagSNP-14208267-A, TagSNP-14208267-B and TagSNP-14208267-C; Primer TagSNP-14208267-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 8 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 8 in the sequence list; Primer TagSNP-14208267-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 9 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 9 in the sequence list; The primer TagSNP-14208267-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 10 in the sequence list; 2) The 7 primer sets consist of a TagSNP-14208267 primer set, an OsCd1-TagSNP-840593 primer set, an OsHMA2-TagSNP-29481835 primer set, an OsHMA3-TagSNP-7406920 primer set, an OsMTP1-TagSNP-1679325 primer set, an OsNramp1-TagSNP-8965009 primer set, and an OsNramp5-TagSNP-8880395 primer set, The TagSNP-14208267 primer set consists of TagSNP-14208267-A, TagSNP-14208267-B and TagSNP-14208267-C; Primer TagSNP-14208267-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 8 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 8 in the sequence list; Primer TagSNP-14208267-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 9 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 9 in the sequence list; The primer TagSNP-14208267-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 10 in the sequence list; The OsCd1-TagSNP-840593 primer set consists of primers OsCd1-TagSNP-840593-A, OsCd1-TagSNP-840593-A and OsCd1-TagSNP-840593-C; The primer OsCd1-TagSNP-840593-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 11 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 44th positions of sequence 11 in the sequence list; The primer OsCd1-TagSNP-840593-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 12 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 12 in the sequence list; The primer OsCd1-TagSNP-840593-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 13 in the sequence list; The OsHMA2-TagSNP-29481835 primer set consists of primers OsHMA2-TagSNP-29481835-A, OsHMA2-TagSNP-29481835-A and OsHMA2-TagSNP-29481835-C; The primer OsHMA2-TagSNP-29481835-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 14 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of sequence 14 in the sequence list; The primer OsHMA2-TagSNP-29481835-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 15 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 48th position of sequence 15 in the sequence list; The primer OsHMA2-TagSNP-29481835-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 16 in the sequence list; The OsHMA3-TagSNP-7406920 primer set consists of primers OsHMA3-TagSNP-7406920-A, OsHMA3-TagSNP-7406920-A and OsHMA3-TagSNP-7406920-C; The primer OsHMA3-TagSNP-7406920-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 17 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 40th position of sequence 17 in the sequence list; The primer OsHMA3-TagSNP-7406920-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 18 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th positions of sequence 18 in the sequence list; The primer OsHMA3-TagSNP-7406920-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 19 in the sequence list; The OsMTP1-TagSNP-1679325 primer set consists of primers OsMTP1-TagSNP-1679325-A, OsMTP1-TagSNP-1679325-A and OsMTP1-TagSNP-1679325-C; The primer OsMTP1-TagSNP-1679325-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 20 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 51 of sequence 20 in the sequence list; The primer OsMTP1-TagSNP-1679325-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 21 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 50 of sequence 21 in the sequence list; The primer OsMTP1-TagSNP-1679325-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 22 in the sequence list; The OsNramp1-TagSNP-8965009 primer set consists of primers OsNramp1-TagSNP-8965009-A, OsNramp1-TagSNP-8965009-A and OsNramp1-TagSNP-8965009-C; The primer OsNramp1-TagSNP-8965009-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 23 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-47 of sequence 23 in the sequence list; The primer OsNramp1-TagSNP-8965009-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 24 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 49 of sequence 24 in the sequence list; The primer OsNramp1-TagSNP-8965009-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 25 in the sequence list; The OsNramp5-TagSNP-8880395 primer set consists of primers OsNramp5-TagSNP-8880395-A, OsNramp5-TagSNP-8880395-A and OsNramp5-TagSNP-8880395-C; The primer OsNramp5-TagSNP-8880395-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 26 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 43rd position of sequence 26 in the sequence list; The primer OsNramp5-TagSNP-8880395-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 27 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22 to 41 of sequence 27 in the sequence list; The primer OsNramp5-TagSNP-8880395-C is a single-stranded DNA molecule whose nucleotide sequence is sequence 28 in the sequence list.

9. A method for identifying or assisting in identifying the cadmium content of rice grains, the method comprising method A or method B: Method A: Detecting the polymorphism or genotype of the rice genome TagSNP-14208267 as described in claim 1 in the rice to be tested, and identifying or assisting in identifying the cadmium content of rice grains according to the genotype of the rice to be tested: the cadmium content of rice grains whose genotype of TagSNP-14208267 is AA is lower than that of rice whose genotype of TagSNP-14208267 is CC, wherein AA is a homozygous type of TagSNP-14208267 A; and CC is a homozygous type of TagSNP-14208267 C; Method B: Detecting the OsCd1-TagSNP-840593, the OsHMA2-TagSNP-29481835, the OsHMA3-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagSNP-8965009, the OsNramp5 ...Nramp5-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagSNP-8965009, the OsNramp5-TagSNP-7406920, the OsNramp5-TagSNP-7406920, the OsMTP1-TagSNP-1679325, the OsNramp1-TagS The polymorphism or genotype of the seven SNPs, NP-8880395 and TagSNP-14208267, is used to identify or assist in identifying the cadmium content of rice grains according to the genotype of the rice to be tested: the cadmium content of rice grains whose genotype is AAAAAAGGCCTTAA is lower than that of rice whose genotype is GGGGGGAAAACCCC or GGGGAAGGCCTTAA, The rice with the genotype AAAAAAGGCCTTAA is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is AA, the genotype of OsHMA2-TagSNP-29481835 is AA, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is AA; The rice with the genotype GGGGGGAAAACCCC is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is GG, the genotype of OsHMA2-TagSNP-29481835 is GG, the genotype of OsHMA3-TagSNP-7406920 is GG, the genotype of OsMTP1-TagSNP-1679325 is AA, the genotype of OsNramp1-TagSNP-8965009 is AA, the genotype of OsNramp5-TagSNP-8880395 is CC, and the genotype of TagSNP-14208267 is CC; The rice with the genotype GGGGAAGGCCTTAA is a combined genotype of 7 SNPs, including OsCd1-TagSNP-840593 having a genotype of GG, OsHMA2-TagSNP-29481835 having a genotype of GG, OsHMA3-TagSNP-7406920 having a genotype of AA, OsMTP1-TagSNP-1679325 having a genotype of GG, OsNramp1-TagSNP-8965009 having a genotype of CC, OsNramp5-TagSNP-8880395 having a genotype of TT, and TagSNP-14208267 having a genotype of AA.

10. Use of the method according to claim 9 in rice breeding, wherein the purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

11. A method for rice breeding, comprising method A or method B: Method A: detecting the polymorphism or genotype of TagSNP-14208267 in the rice genome as claimed in claim 1 in the rice to be tested, and selecting homozygous rice with the genotype of TagSNP-14208267 being AA as parent breeding; Method B: Detecting the polymorphism or genotype of the seven SNPs, OsCd1-TagSNP-840593, OsHMA2-TagSNP-29481835, OsHMA3-TagSNP-7406920, OsMTP1-TagSNP-1679325, OsNramp1-TagSNP-8965009, OsNramp5-TagSNP-8880395 and TagSNP-14208267, in the rice to be tested as claimed in claim 1, and selecting the rice with the genotype of the seven SNPs as AAAAAAGGCCTTAA as the parent for Breeding, the rice with the genotype AAAAAAGGCCTTAA is a combined genotype of 7 SNPs, namely, the genotype of OsCd1-TagSNP-840593 is AA, the genotype of OsHMA2-TagSNP-29481835 is AA, the genotype of OsHMA3-TagSNP-7406920 is AA, the genotype of OsMTP1-TagSNP-1679325 is GG, the genotype of OsNramp1-TagSNP-8965009 is CC, the genotype of OsNramp5-TagSNP-8880395 is TT, and the genotype of TagSNP-14208267 is AA; The purpose of the rice breeding is to cultivate rice with low cadmium content in grains or to select rice varieties with low cadmium content in grains.

Images