Use of phzB-g gene in synthesis of phenazine-1,6-dicarboxylic acid
By integrating the phzB-G gene into Streptomyces and testing different promoters, an engineered Streptomyces strain was constructed, which solved the problems of low yield and high by-products in the synthesis of phenazine-1,6-dicarboxylic acid, and achieved efficient synthesis and low by-product production of phenazine-1,6-dicarboxylic acid.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI JIAOTONG UNIV
- Filing Date
- 2022-02-21
- Publication Date
- 2026-05-12
AI Technical Summary
The existing technology for synthesizing phenazine-1,6-dicarboxylic acid has low yield and accumulates a lot of byproducts, making it difficult to reach the level of application.
By cloning the phzB-G gene fragment into an integrative plasmid and integrating it into the genome of Streptomyces cerevisiae M1152, and combining it with different constitutive promoters, an engineered Streptomyces strain was constructed to achieve stable and efficient synthesis of phenazine-1,6-dicarboxylic acid.
A high yield of phenazine-1,6-dicarboxylic acid was achieved, reaching 586.7 mg/L, while the byproduct phenazine-1-carboxylic acid was only 4.9 mg/L, resulting in a significant increase in yield and a decrease in the proportion of byproducts.
Smart Images

Figure CN116656713B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of Streptomyces, specifically relating to the application of a phzB-G gene in the synthesis of phenazine-1,6-dicarboxylic acid. Background Technology
[0002] Phenrazines are a class of nitrogen-containing heterocyclic compounds with broad-spectrum antibacterial activity. Naturally occurring phenrazines are mainly synthesized by *Pseudomonas* and *Streptomyces*. Phenrazines synthesized by *Pseudomonas* generally have simpler structures and are primarily used for the control of agricultural pests and diseases. Phenrazines synthesized by *Streptomyces* have more complex side-chain modifications, resulting in more diverse biological activities. For example, Arai et al. found that lomofungin has a strong inhibitory effect on hepatocellular carcinoma cells, and Tunac et al. found that methyl 6-formyl-4,7,9-trihydroxy-8-methylphenazine-1-carboxylate has a good inhibitory effect on human colon cancer cell lines. Endophenes derived from *Streptomyces cinnamon* also have good antibacterial effects. Therefore, how to efficiently synthesize complex phenrazines is a pressing scientific problem that needs to be solved.
[0003] Most complex phenazine compounds are derived from further modifications of phenazine-1,6-dicarboxylic acid (PFA). For example, PFA is a direct precursor for the synthesis of colistin (Zhao et al., 2016) and an intermediate in the biosynthesis of esmeraldin, phencomycin, and grombin. Therefore, establishing a high-yield PFA cell factory would be beneficial for promoting the efficient biosynthesis of complex phenazine compounds. In previous reports, Guo et al. achieved the synthesis of PFA in Pseudomonas by knocking out the phzA gene; however, the yield was low and accompanied by the accumulation of large amounts of PFA and phenazine-1-carboxamide, which was not conducive to its isolation, purification, and further synthetic biology research. In addition, Guo et al. studied the effects of the phzG gene and oxygen supply on the synthesis of PFA, further improving the yield of PFA, but still resulting in the accumulation of a large amount of byproducts. Therefore, the two major challenges in the synthesis of phenazine-1,6-dicarboxylic acid are low yield and large accumulation of byproducts, making it difficult to reach the level of application. Summary of the Invention
[0004] The purpose of this invention is to address the problems in the synthesis of phenazine-1,6-dicarboxylic acid in the prior art by providing an application of the phzB-G gene in the synthesis of phenazine-1,6-dicarboxylic acid.
[0005] This invention constructs an engineered strain of Streptomyces cerevisiae by cloning the phzB-G gene fragment from the genome of Streptomyces lomonde S015 into an integrative plasmid, followed by conjugation transfer and integration into the genome of Streptomyces cerevisiae M1152, thereby achieving stable and specific synthesis of phenazine-1,6-dicarboxylic acid. Furthermore, by testing different constitutive promoters, the optimal promoter was selected to achieve its efficient synthesis.
[0006] The objective of this invention can be achieved through the following methods:
[0007] This invention provides an application of the phzB-G gene in the synthesis of phenazine-1,6-dicarboxylic acid. Specifically, the phzB-G gene is linked to an integrative plasmid and then integrated into the Streptomyces genome to construct an engineered Streptomyces strain for the synthesis of phenazine-1,6-dicarboxylic acid.
[0008] As one embodiment of the present invention, the phzB-G gene sequence is shown in SEQ ID NO.1. The phzB-G gene fragment is derived from the genome of Streptomyces lomondii S015.
[0009] In one embodiment of the present invention, the integrative plasmid is obtained by inserting a backbone plasmid into the promoter.
[0010] As one embodiment of the present invention, the promoters include ermEp*, P 4505 R 5755 P sco5768 One of SP44 and KasOp*. Promoters P4505R5755 (Yi et al., 2016), Psco5768 (Li et al., 2015), SP44 (Bai et al., 2015), and KasOp* (Wang et al., 2013) are obtained by DNA synthesis or PCR.
[0011] As one embodiment of the present invention, the backbone plasmid includes one of pSET152, pIJ101, pSG5, pJV1, and pSAM2.
[0012] As one embodiment of the present invention, linking the phzB-G gene to the integrative plasmid specifically involves inserting the phzB-G sequence after the promoter.
[0013] The pIB139 plasmid of this invention (Wilkinson et al., 2002) contains The integrase is the pSET152 plasmid with the ermEp* promoter inserted. ermEp* is the promoter on the pIB139 plasmid. A phzB-G sequence is inserted after the ermEp* promoter to test its ability to synthesize phenazine-1,6-dicarboxylic acid. The pSET152 plasmid is a backbone plasmid without a promoter. This invention first inserts P… 4505 R 5755 P sco5768 The sequence is SP44 or KasOp*, followed by a phzB-G sequence. The purpose is to test which promoter produces the highest yield of phenazine-1,6-dicarboxylic acid. The pIB139 plasmid carries the promoter ermEp*. Four recombinant plasmids were constructed using the pSET152 plasmid as a backbone, each carrying a P… 4505 R 5755 P sco5768 SP44, KasOp* promoters.
[0014] In one embodiment of the present invention, the Streptomyces includes Streptomyces containing the shikimic acid pathway. The Streptomyces containing the shikimic acid pathway (precursor pathway) includes *Streptomyces aquamarine* M1152.
[0015] The present invention also provides a Streptomyces strain for synthesizing phenazine-1,6-dicarboxylic acid, wherein the Streptomyces strain is constructed by linking the phzB-G gene with an integrative plasmid and then integrating it into the Streptomyces genome.
[0016] The present invention also provides a recombinant plasmid, which is obtained by ligating the phzB-G gene with an integrative plasmid.
[0017] The present invention also provides the application of the recombinant plasmid in constructing a strain that synthesizes phenazine-1,6-dicarboxylic acid.
[0018] The present invention also provides a method for constructing a Streptomyces strain for producing phenazine-1,6-dicarboxylic acid, the preparation method comprising the following steps:
[0019] S1. Ligate the phzB-G gene fragment with the integrative plasmid to construct a recombinant plasmid; transform the recombinant plasmid into Escherichia coli to obtain a strain carrying the recombinant plasmid, and culture the bacterial solution for later use.
[0020] S2. Scrape off the spores from the pre-cultured Streptomyces and activate them to obtain spores for later use.
[0021] S3. Mix the bacterial solution and spores and culture to obtain the conjugate, i.e., the Streptomyces.
[0022] As one embodiment of the present invention, the phzB-G gene sequence in step S1 is obtained by PCR amplification using amplification primers F / R before ligation with the integrative plasmid.
[0023] As one embodiment of the present invention, the gene sequence of the amplification primer F in step S1 is shown in SEQ ID NO.2; the gene sequence of the amplification primer R is shown in SEQ ID NO.3.
[0024] As one embodiment of the present invention, the Escherichia coli in step S1 includes ET12567 (pUZ8002).
[0025] The recombinant plasmid was first transformed into Escherichia coli DH5α, and colony PCR was performed using the F / R method for verification, followed by sequencing verification. The recombinant plasmid with correct sequencing results was transformed into Escherichia coli ET12567(pUZ8002), and the strain carrying the recombinant plasmid was obtained again through PCR verification.
[0026] In one embodiment of the present invention, the culture described in step S1 involves inoculating the bacterial strain carrying the recombinant plasmid into LB medium and culturing it overnight in a shaker; then transferring the bacterial culture to LB medium and culturing it in a shaker until OD... 600 The concentration was set between 0.4 and 0.8; after centrifugation, the culture was washed with antibiotic-free LB medium, resuspended in LB liquid medium, and temporarily stored on ice for later use. Fresh donor bacteria were obtained through culture, subsequently mixed with Streptomyces spores, and then conjugation transfer occurred, whereby the plasmid of the donor bacteria entered the Streptomyces. It integrates into the Streptomyces genome with the assistance of integrase.
[0027] In some embodiments, the culture in step S2 involves inoculating the bacterial strain carrying the recombinant plasmid into LB medium containing resistance to apramycin, kanamycin, and chloramphenicol, and culturing it overnight in a shaker at 37°C and 220 rpm; then transferring the bacterial culture to LB medium and culturing it in a shaker at 37°C and 220 rpm until OD is reached. 600 The concentration should be between 0.4 and 0.8. After centrifugation at 6000 rpm, wash three times with antibiotic-free LB, resuspend in LB liquid medium, and store on ice for later use.
[0028] As one embodiment of the present invention, the pre-culture in step S3 is to place Streptomyces bluei M1152 on MS medium solid plates for 5-6 days.
[0029] In one embodiment of the present invention, the activation treatment in step S3 involves collecting spores into centrifuge tubes, resuspending them in ddH2O, heat-shocking them in a water bath, adding 2×YT medium, and culturing the suspension in a shaker to pre-germinate the spores. The pre-germinated spores are then collected by centrifugation. The purpose of activation is to put the spores in a pre-germination state, thereby improving the efficiency of subsequent conjugation and transfer.
[0030] In some embodiments, the activation treatment in step S3 involves collecting spores into centrifuge tubes, resuspending them in ddH2O, heat-shocking them in a 50°C water bath for 10 min, then adding an equal volume of 2×YT medium, and culturing the suspension in a shaker at 37°C and 220 rpm for 2.5 h to activate the spores. The activated spores are then collected by centrifugation at 8000 rpm.
[0031] As one embodiment of the present invention, the culture in step S3 involves washing the activated spores with 2×YT medium, centrifuging, resuspending them in LB liquid medium, and temporarily storing them on ice for later use.
[0032] As one embodiment of the present invention, the culture in step S3 involves mixing the bacterial solution and spores, spreading the mixture onto an antibiotic-free MS plate, and then inverting it in a constant temperature incubator for culture. After culture, a solution containing nadolol and apramycin is prepared, evenly covering the plate, and then inverted for further culture in a constant temperature incubator to obtain conjugates.
[0033] In some embodiments, the culture in step S3 involves mixing the bacterial suspension and spores, spreading the mixture onto an antibiotic-free MS plate, and incubating it upside down in a 28°C incubator. After 16-18 hours of incubation, a solution containing 1.6 mg / L naphthylpyrrolidone and 1.6 mg / L apramycin is prepared, evenly spread on the plate, and the plate is incubated upside down at 28°C for another 3-5 days to obtain conjugates. The purpose of naphthylpyrrolidone is to kill *E. coli* (donor bacteria), and the role of apramycin is to kill recipient bacteria that have not undergone conjugation transfer, thereby screening for recombinant bacteria that have successfully undergone conjugation transfer.
[0034] As one embodiment of the present invention, the obtained conjugates are verified by the following method: the grown conjugates are streaked onto MS plates containing apramycin resistance and cultured under constant temperature conditions; subsequently, they are inoculated into YEME liquid medium, cultured on a shaker, and then spread onto MS plates containing apramycin resistance. Genomic samples are then extracted for PCR verification. Correct PCR verification indicates successful construction of the genetically engineered strain.
[0035] In some embodiments, the obtained conjugates are verified by the following method: the grown conjugates are streaked onto MS plates containing apramycin resistance and incubated at 37°C for 2-3 days; then inoculated into 50 mL of YEME liquid medium and incubated at 28°C and 220 rpm for 48 h; finally, they are plated onto MS plates containing apramycin resistance, and samples are taken to extract the genome for PCR verification. Correct PCR verification indicates successful construction of the genetically engineered strain.
[0036] The present invention also provides the application of Streptomyces in the preparation of phenazine-1,6-dicarboxylic acid.
[0037] Compared with the prior art, the present invention has the following beneficial effects:
[0038] (1) This invention is based on the chassis strain Streptomyces cerevisiae M1152, which is derived from the model strain Streptomyces cerevisiae A3 through genetic engineering and is widely used for heterologous expression and high-yield of natural products from various Streptomyces.
[0039] (2) This invention achieves the stable and specific synthesis of phenazine-1,6-dicarboxylic acid by introducing the phzB-G gene fragment from the S015 genome of *Streptomyces lomondii* into *Streptomyces cerevisiae* M1152 using an integrative plasmid. Furthermore, by testing different constitutive promoters, a high yield of phenazine-1,6-dicarboxylic acid was achieved, reaching 586.7 mg / L, while the yield of the byproduct phenazine-1-carboxylic acid was only 4.9 mg / L, less than 1%. Attached Figure Description
[0040] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:
[0041] Figure 1 A schematic diagram illustrating the construction of a recombinant plasmid fusion of the phzB-G gene fragment and the pIB139 plasmid;
[0042] Figure 2 Electrophoresis image for PCR verification of the phzB-G gene;
[0043] Figure 3 HPLC detection of phenazine-1,6-dicarboxylic acid (PDC) in the fermentation broth of genetically engineered strain M1152-phz;
[0044] Figure 4 Mass spectrometry comparison of the synthesized product from the fermentation broth of M1152-phz with the phenazine-1,6-dicarboxylic acid (PDC) standard;
[0045] Figure 5 A schematic diagram of recombinant plasmids assembled with different promoters and the phzB-G genome;
[0046] Figure 6 The effect of different promoters on the fermentation yield of phenazine-1,6-dicarboxylic acid. Detailed Implementation
[0047] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.
[0048] Example 1
[0049] This embodiment relates to a method for preparing a genetically engineered Streptomyces strain for the synthesis of phenazine-1,6-dicarboxylic acid, comprising the following steps:
[0050] Primers F (5'CGGTTGGTAGGATCCACATATGATGTCAAAGCCTCGAATACCCACC 3') and R (5'GCGCGGCCGCGGATCCTCTAGATCAGGGCTGGAGGTGGCTGGTA 3') were designed based on the phzB-G gene sequence in the genome of Streptomyces lomondii S015. The phzB-G gene sequence was amplified by PCR, verified by DNA electrophoresis, and purified by gel excision.
[0051] The phzB-G gene fragment was ligated to the pIB139 plasmid (carrying the ermEp* promoter) using the In-Fusion seamless cloning system to construct the recombinant plasmid (5 μL of In-Fusion seamless cloning system, including 1 μL of In-Fusion enzyme, 2 μL of pIB139 plasmid, and 2 μL of the target gene fragment) pIB-phz (see...). Figure 1 The recombinant plasmid was first transformed into *E. coli* DH5α, and colony PCR was performed using the F / R method for verification, followed by sequencing verification. The recombinant plasmid with correct sequencing results was transformed into *E. coli* ET12567(pUZ8002), and the strain carrying the recombinant plasmid was obtained again through PCR verification.
[0052] The bacterial strain ET12567 (pUZ8002) carrying the recombinant plasmid was inoculated into 5 mL of LB medium containing 50 mg / L apramycin, 50 mg / L kanamycin, and 25 mg / L chloramphenicol, and cultured overnight at 37°C and 220 rpm in a shaker. The cultured bacterial solution was then transferred to 50 mL of LB medium and cultured at 37°C and 220 rpm in a shaker until the OD600 reached between 0.4 and 0.8. 10 mL of the bacterial solution was centrifuged at 6000 rpm, washed three times with antibiotic-free LB medium, resuspended in LB liquid medium, and temporarily stored on ice.
[0053] A suitable amount of spores of *Streptomyces cyanobacterium* M1152, pre-cultured on MS agar plates for 5-6 days, were scraped off using a sterile cotton swab in a clean bench. The spores were collected into 50 mL centrifuge tubes, suspended in ddH2O, and heat-shocked in a 50°C water bath for 10 min. An equal volume of 2×YT medium was then added, and the suspension was incubated at 37°C and 220 rpm for 2.5 h to activate the spores. The activated spores were collected by centrifugation at 8000 rpm, washed with 2×YT medium, resuspended in LB liquid medium after centrifugation, and temporarily stored on ice.
[0054] After mixing the bacterial suspension and spores, spread the mixture onto antibiotic-free MS plates and incubate upside down at 28°C. After 16-18 hours of incubation, prepare 1 mL of a solution containing 1.6 mg / L nadolol and 1.6 mg / L apramycin, evenly cover the plates, and continue incubating upside down at 28°C for 3-5 days.
[0055] The grown conjugates were streaked onto MS plates containing apramycin resistance and incubated at 37°C for 2-3 days. Subsequently, they were inoculated into 50 mL of YEME liquid medium and cultured at 28°C and 220 rpm for 48 h. 700 μL of the culture was then plated onto MS plates containing apramycin resistance, and 2 mL was used to extract the genome for PCR verification. Correct PCR verification indicates successful construction of the genetically engineered strain (see results below). Figure 2 The strain was named M1152-phz, and a strain containing the pIB139 empty plasmid was constructed and named M1152-control.
[0056] Example 2
[0057] This embodiment relates to the detection and identification of phenazine-1,6-dicarboxylic acid synthesized by *Streptomyces cerevisiae*. The specific steps are as follows:
[0058] Fermentation broths of wild-type Streptomyces azureense M1152, M1152-control, and M1152-phz were each transferred to 2 mL centrifuge tubes and centrifuged at 12000 rpm for 10 min. The supernatant was then transferred to a new 2 mL centrifuge tube. 500 μL of the supernatant was mixed with an equal volume of acetonitrile (chromatographic grade) and centrifuged at 12000 rpm for 10 min. The supernatant was then filtered through a 0.22 μm organic phase filter into a sample vial. The prepared samples were subjected to preliminary detection by high-performance liquid chromatography (HPLC) and further detection by ultra-high-performance liquid chromatography / supercritical fluid chromatography-quadrupole time-of-flight mass spectrometry (UHPLC / supercritical fluid chromatography-quadrupole time-of-flight mass spectrometry).
[0059] HPLC detection method: The detection wavelength was 254 nm, using an Agilent C18 reversed-phase column at a flow rate of 1 mL / min. Mobile phase: The aqueous phase was 0.1% formic acid water, and the organic phase was acetonitrile. The mixing gradient is shown in Table 1.
[0060] Table 1 Mixing gradient of the mobile phase
[0061]
[0062] HPLC detection results are as follows Figure 3 As shown, according to the HPLC chromatogram of phenazine compound standards, the elution time of phenazine-1,6-dicarboxylic acid was 9.6 min, and that of phenazine-1-carboxylic acid was 13.4 min. After expressing the phzB-G gene fragment, the HPLC chromatogram of the fermentation broth of strain M1152-phz showed a compound with the same elution time as phenazine-1,6-dicarboxylic acid, while no accumulation of this compound was detected in the fermentation broths of strains M1152 and M1152-control. Further mass spectrometry detection results are as follows. Figure 4 As shown, the molecular weight of the target compound in the fermentation broth of M1152-phz is consistent with that of phenazine-1,6-dicarboxylic acid. Therefore, the genetically engineered strain M1152-phz successfully synthesized phenazine-1,6-dicarboxylic acid.
[0063] Example 3
[0064] This embodiment relates to the efficient synthesis of phenazine-1,6-dicarboxylic acid by *Streptomyces aquamarine*. The specific steps are as follows:
[0065] P is obtained through DNA synthesis or PCR. 4505 R 5755 P sco5768 The four promoters SP44, KasOp*, etc., were first cloned into the pSET152 plasmid. Then, the phzB-G gene sequence was assembled downstream of the promoter to construct four recombinant vectors (see [link to pSET152]). Figure 4 The four strains were introduced into Streptomyces cerevisiae M1152 and named M1152-phz4505, M1152-phzSCO, M1152-phzSP, and M1152-phzKa, respectively.
[0066] After activation on MS agar plates, spores of M1152-phz4505, M1152-phzSCO, M1152-phzSP, M1152-phzKa, and M1152-phz were scraped and inoculated into TSBY medium for 48 h as primary seed bottles. These were then inoculated into fresh TSBY medium and incubated for 24 h as secondary seed bottles. The secondary seed bottles were then inoculated into YEME medium and fermented at 28°C and 200 rpm in a shaker. 4 mL of fermentation broth was centrifuged, and the supernatant was used for HPLC analysis. The precipitated mycelium was washed twice with deionized water and dried in an oven for cell dry weight determination. Results are as follows: Figure 5 As shown, when P is used sco5768 With the ermEp* promoter, the dry weight of strain M1152-phzSCO was 4.0 g / L, the yield of phenazine-1,6-dicarboxylic acid was 3.0 mg / L, and phenazine-1-carboxylic acid was undetectable. With the ermEp* promoter, the dry weight of strain M1152-phz was 3.9 g / L, the yield of phenazine-1,6-dicarboxylic acid was 44.7 mg / L, and phenazine-1-carboxylic acid was 1.0 mg / L. With the KasOp* promoter, the dry weight of strain M1152-phzKa was 3.2 g / L, the yield of phenazine-1,6-dicarboxylic acid was 413.6 mg / L, and phenazine-1-carboxylic acid was 10.0 mg / L. With the P… 4505 R 5755 When the SP44 promoter was used, the dry weight of strain M1152-phz4505 was 2.5 g / L, the yield of phenazine-1,6-dicarboxylic acid was 550.2 mg / L, and the yield of phenazine-1-carboxylic acid was 6.7 mg / L. When the SP44 promoter was used, the dry weight of strain M1152-phzSP was 2.4 g / L, but the yield of phenazine-1,6-dicarboxylic acid was the highest, reaching 586.7 mg / L, while the byproduct phenazine-1-carboxylic acid was only 4.9 mg / L, less than 1%.
[0067] like Figure 1 As shown, the recombinant plasmid is the fusion of the phzB-G gene fragment with the pIB139 plasmid. Figure 2 As shown, the phzB-G gene was verified by electrophoresis. Wild Type was verified using F / R primers with the M1152 wild-type genome as a template; Plasmid was verified using F / R primers with the recombinant plasmid pIB-phz as a template; and M1152-phz was verified using F / R primers with the M1152-phz genome as a template. Figure 3 HPLC detection of phenazine-1,6-dicarboxylic acid (PDC) in the fermentation broth of genetically engineered strain M1152-phz. Figure 4 Mass spectrometry comparison of the synthesized product from the fermentation broth of M1152-phz with phenazine-1,6-dicarboxylic acid (PDC) standard. Figure 5A schematic diagram illustrating the construction of recombinant plasmids with different promoters and the phzB-G genome. Figure 6 The effect of different promoters on the fermentation yield of phenazine-1,6-dicarboxylic acid.
[0068] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention. sequence list <110> Shanghai Jiao Tong University <120> Application of the phzB-G gene in the synthesis of phenazine-1,6-dicarboxylic acid <130> DD12719 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 6156 <212> DNA <213> Artificial Sequence <400> 1 atgtcaaagc ctcgaatacc caccgaccag accgaactgc gcgcccacaa ccgggccatc 60 gtcgagcagt acatgaacac ccgcggcgag gaccggctcc ggcgccacct gctgttcacc 120 gaggacggca ccggcggcct gtggaccacg gagagcggcg aaccgatcgt catccgcggc 180 cgagaccggc tgggcgagca cgccgtctgg tcgctcaagt gcttccccga ctgggtctgg 240 accaacgtcg agatcttcga cactcaggac cccgaccgtt tctgggtcga atgcgacgga 300 gagggagaca ttcttttccc cggatatccc gacggatact accgcaacca cttcctgcac 360 tcgttcctgt tcgagaacgg gaagataaaa cagcagcgcg agttcatgaa cccctgtcag 420 cagttcaagg ccctcggaat agaagtaccg cgcatcgagc gcgaagggat ccccacctga 480 tccgccggcc tgaacgcgcg gtatgccatg acccgaacgt aaatcctctc cacttcacgg 540 gggcactgtc gtgggacacg cacttactga aatccagcgg gccaaggccc tgcaacagcc 600 cgattggccc gacctcggac aggtccggcg ggtgcgggag atcctcaact cccgcccgcc 660 gctcgtcagg ttcgacgacg tccacaccct gaggtcgctg ctcgcctctg tcgccgcggg 720 ggaggcactc gtagtgcagt cgggagactg cgccgaggac ccggaggagt gcacgccggg 780 gcacgtacgg cgcaagtcgg ccgtcctcga cctgctggcc accacgctga agatgctcac 840 cggcaagccc gtactgcgcg tcggacggat ggccggccag ttcgcgaagc cccggtcgaa 900 cgacttcgag cagatcggtg acctggcgct acccgtctac cgcgggcaca tggtcaacag 960 tccggacccc gacccggagg gcaggcgccc cgacccgctg cgcatcctca ccgggtacat 1020 ggcggccgcc gacatcgtgg aacacctcgg ctggcgcgcc ccggcgctgc gcacctggcc 1080 gggcatcgaa cccctggtgt ggacgagcca cgaggcgctc ctgctggact acgaggtccc 1140 gatgatccgc gaactcggcg actccacgcg ctggctgggc tccacgcact ggccgtggat cggtgagcgc acccgccaac tggacggcgc ccacgtcgac ctgctgtccg atgtggtcaa cccggtcgcc tgcaaggtcg gcccgagtgt gaccccgaa gagatcacct cgctgtgccg 1320. gcgcctggac ccgctgcgcg agcccggccg cctcacgctg atctcccgca tgggtgccga 1380. cgcagtcggc gaacgactgc cgtccctggt cgcggcggtc cgctccgcgg gccacccggt 1440 gatctggctg tgcgacccga tgcacggcaa caccatcacc gcacccggcg gcaggaagac ccgcctgctg cccaccatgg cccgcgaggt tcaggaattc ggccacgcgg tcgcggcggc 1560 cggcggggtg gccggagggc tccacctgga gaccaccccg gacgacgtga cggagtgcgc 1620 cgtggacgtc tcggcactcg gccggatcgg cgaacggcac accaccttct gcgacccgcg 1680. cctcaactcc cggcaggccg tctccctggt cactgcctgg gccgacaccc tctgacccac 1740 gccccgccga cgcggccact ccgctggaa ggagctgatc cctggccgg cctacccccc atagagtcgt accccctgcc caccgacgat cgcctgcccg agaacgtggc gggctggacc 1860 ccgcatccgg accgcgccgt cctgctcgtc cacgacatgc agcgctactt cctccaggcg 1920 ctccccgacc ccctgcgcgg cgaactcctc cacaacgccg ccgcgttgcg caagcgcgcc 1980 accgccctcg gcgtcccggt ggcgtacacc gcgcagcccg gccggatgac cgacgaacag 2040 cggggcctgc tcaaggactt ctggggcccc ggcatgcgca ccgatgcggc cgaccgcgag 2100 gtggtagcgg aactcacgcc cgccgagggc gactgggtgc tcaccaagtg gcgctacagc 2160 gccttcttcc gctccgacct gctcgagcgt atgcgggccg cgggccgcga ccaactcgtg 2220 ctgtgtggcg tgtacgccca cgtcggcgtc ctggccaccg cactggaggc gttcaccaac 2280 gacatccaga ccttcctcgc cgccgacgcc ctcggcgact tctccgaggc ccaccaccga 2340 ctggccctgg actacgcggc ccagcgctgc gcggtggttc tcccgtccgc ggaggtgttc 2400 atatgagcgc gtcgcacggc cagaaccccc gaaaccccgg cgatctgctg ggccgtgtac 2460 tggaccttca ggcacccgca ttcgctctgc tacaccgtcc ggagagcggc gtccccgaca 2520 ccgtggacgt cctggtcggc gacgtgacgc tgccagagac cctggccgac attcctctca 2580 ccgatcagcc gacgcccgac agcgcgggga ccgagcacga tgtcctggtc gtagcgccct 2640 accggcagat caccgagcgc ggcttcacgg ctcccgacga cggcgcaccc ctcatcgccc 2700 tgtccgtcat cagccaggac cgggtttccg tgccagagct cctcctccgg ctcccggacg 2760 cgcccacctc cgtgaccgcc ctcggcttcg acatcgacga cgagcagtac gccgaaaccg 2820 tgcgccgcat catcacggac gagattggca ccggcgaggg cgccaacttc gtcgtcaaac 2880 gctccttcct ggccgagatc agcggctact cactccgcga cgcgctcgtg ttcttccgcc 2940 ggctgttggt acgggagcag ggcgtgtact ggaccttcgt catccacacc ggtgaccgca 3000 ccttcgtggg agccaccccc gaacggcaca tctcggtgag tggcgggacc gcggtcatga 3060 acccgatcag cggcacctat cgctacccgc cggccggccc cacgctggaa ggcgtcaccg 3120 agttcctcgc cgaccgcaag gagaccgacg agctgtacat ggtcgtcgac gaggagctga 3180 agatgatggc cggcgtctgc gagggcggcg gccgtgtcct gggcccctat ctcaaggaga 3240 tggcccggct ggcccacacc gagtacttca tcgagggacg caccgaccgg gacgtgcgcg 3300 agatcctgca cgagacgttg ttcgccccca ccgtcacagg cagcccgcag gagagcgcgg 3360 tccggatcat ccgcaagtac gagcccgaag gccgcggtta ctacagtggt ctggccgcgc 3420 tgattggtcg ggacgtgggc ggtgagcgat ccctcgactc tgccatcctc atccgcaccg 3480 ccgacatcga cacccacggc cgagtacgga tcggggtcgg cgccacactg gtccgacatt 3540 ccgacccact gtcggaggtc gccgagaccc gcgccaaggc gtccgggctc ctcagcgccc 3600 tggagaacgg acgtgcccag cgttacggca cccacccgga cgtctgcgcg gccctgaggc 3660 agcgcaacaa cggcatcgcc cggttctggc tcgacgagag cgccagccga cggcccgcag 3720 tgaccgggct ggagggactg agtgccctga tcatcgacgc ggaggacacc ttcaccgcca 3780 tgatcgggct tcaactccgc tctctgggac taaatgtgac ggtccgtcac ttcgatgacc 3840 cctatgcctt tggtgaccat gacctcgttg tgatgggccc ggggccgggg gatccccgcg 3900 cggcggacgc ccccaagatt cgcagcctgc gctcagcgat cgactgcctg ctggccgagc 3960 aacggccctt cgtcgccgtg tgcctgagcc accaggtgct cagcctcgcc ctcggcctcg 4020 acctgatccg ccgggacgtt ccgaaccaag gcgtgcaact ggagatcgac ctgttcggca 4080 gccgggaacg cgtcggcttc tacaacacct tcgccgcccg caacgacgag gacaaacagg 4140 acatcgccgg gatcggcgcc gtggaggtga gccgtgaccc ggagaccggc gaggtacacg 4200 ccctgcgcgg gcccggcttc gcctcgatgc agttccatgc cgagtcggtg ctcaccgtcg 4260 acgggccgcg catcctgggc cgcacgatcc aggaggtact gggccgtgcg ggttgacatc 4320 gcctggtggg acctcgacgg aacgccgcag accatcgact ccctccggga acacctgagg 4380 gacggcgcgg tcgccgcgtg gagcgacgta ccgggtctgc ggctgaagtt ctggatggcg 4440 gaccggcagc gcaaccggtg gggtgcggtg atgctctggg aggcggaccg tcccgcggac 4500 ctgccgccca accgggccgc gcagctgatc ggccgaccgc ccacccaccg cactcgcttc 4560 gacgtcgaag ccacggtcga gggcatgcac atgctgcccc aactcggcgg acttgggccc 4620 gtgttcacgg cacccacctc agcacccgtg cgaattccgg gggacatatc accgtgcacg 4680 aatacatagt cgtcgacgcc ttcgcccgca ccccgctcga aggcaatccc gtggcggtct 4740 tcttcgaagc cgccgatctg accacaggcc tgatgcagcg catcgcccgc gagatgaacc 4800 tctccgaggt caccttcgtc ctgccgcccg aacagggcgg agacgcccgc atccgcatct 4860 tcacccccgt caacgagctg ccgttcgcgg gccatccgct gctgggcacc gcggtggcgc 4920 tgggccgcac gctcaaggag gaccggctcc ggctggagac cgccatgggc gtcattccgt 4980 tcgaaatatc ggacgaggac ggtgtgtcga ccgtacggat gcaacagccc gtccccacct 5040 gggagccgta cgcacactgc gaggaactcc tggcggcgct cggcgtcgaa cagaccgtcg 5100 cgcccgtgga gatctaccgc aacggccccc ggcacgtctt cgtggggctc ccgaccgtca 5160 cggcactgtc cgctctccgg cccgatcacc gcgcactcgg ccgcttcccg gacatggccg 5220 ccaactgctt cgccggcgcg ggcatccact ggcggacccg tatgttctcg cccgcctacg 5280 gcgtggtcga ggacgcggcg acgggctctg ccgccggccc cctcgccatc cacctggccc 5340 ggcaccgact cgccgcctac gggcagcacc tggagatcct ccagggcgtc gagatgggcc 5400 gtccgtccct catgctcgcc accgccgagg gcgccggcga gacggtccgg tcggtcgagg 5460 tcggcggaca cggcgtcgtc gccgcccgcg gcaccctcca cgtctagcga ggaacgcgtg 5520 aacagcagcc gattcgaaag cctcaccggc gaagtcgacc tggacttccc cgagtacgac 5580 gatccgccgg ccgagccgat ggccctcgtc caccagtgga tcaccgaagc gaccgcacgc 5640 gaggtgcgcg aaccacgcgc tctggcgctc gccaccgccg acagccgggg acgggcctcc 5700 aaccgcatcg tctccgtcac cgacatcacc gctcgcggac tggtgttcgc cagccactcc 5760 accagccaga agggccggga gatgaccgcc accggctggg cgtccggcct cctctactgg 5820 cgcgagacgg gccagcagct cgtcctctcc ggccccgtgg cccagttgag cgacgccgac 5880 tccgacgccc tctggtccgg ccgcccgatc cccatgcact ccatgtccgc ggcctcccgg 5940 cagagcgaac ccctgcggga cgtggccgcc ctgcgcgccg aggcggaccg cctagccgcc 6000 ccaggagccc cgctgccgcg ccccgcccgc ttcgtcggat acctgctcgc cccggtcgcc 6060 gtggagttct ggtgcgccga ctcggaccga ctgcaccgca gactgcgcta cgaccgccac 6120 6156. ggcacgggt ggcataccag cccctccag ccctga <210> 2 <211> 46 <212> DNA <213> Artificial Sequence <400> 2 cggttggtag gatccacata tgatgtcaaa gcctcgata cccacc <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <400> 3 gcgcggccgc ggatcctcta gatcagggct ggaggtggct ggta 44
Claims
1. A kind phzB-G The application of genes in the synthesis of phenazine-1,6-dicarboxylic acid is characterized by, The specific application is to... phzB-G The gene was linked to an integrative plasmid and then integrated into the genome of Streptomyces blueis M1152 to construct an engineered Streptomyces strain for the synthesis of phenazine-1,6-dicarboxylic acid. The phzB-G The gene sequence is shown in SEQ ID NO.1; The integrative plasmid is obtained by inserting a backbone plasmid into a promoter; The promoter is SP44; The backbone plasmid is pSET152; Will phzB-G The ligation of genes with integrative plasmids specifically involves inserting a plasmid after the promoter. phzB-G Gene.
2. A Streptomyces strain for the synthesis of phenazine-1,6-dicarboxylic acid, characterized in that, The Streptomyces is... phzB-G The gene was linked to an integrative plasmid and then integrated into the genome of Streptomyces cerevisiae M1152 to construct the gene. The phzB-G The gene sequence is shown in SEQ ID NO.1; the integrative plasmid is obtained by inserting a backbone plasmid into a promoter; the promoter is SP44; the backbone plasmid is pSET152; phzB-G The ligation of genes with integrative plasmids specifically involves inserting a plasmid after the promoter. phzB-G Gene.
3. A method for constructing Streptomyces as described in claim 2, characterized in that, The construction method includes the following steps: S1, will phzB-G The gene is ligated to the integrative plasmid to construct the recombinant plasmid; the recombinant plasmid is transformed into Escherichia coli to obtain a strain carrying the recombinant plasmid, and the bacterial culture is prepared for later use. S2. Scrape off the spores of the pre-cultured Streptomyces blue M1152 and activate them to obtain spores for later use. S3. Mix the bacterial solution and spores and culture to obtain the conjugate, i.e., the Streptomyces; The phzB-G The gene sequence is shown in SEQ ID NO.1; The integrative plasmid is obtained by inserting a backbone plasmid into a promoter; The promoter is SP44; The backbone plasmid is pSET152; Will phzB-G The ligation of genes with integrative plasmids specifically involves inserting a plasmid after the promoter. phzB-G Gene.