Construction and application of multiple electron transport pathway escherichia coli

By constructing a multi-electron transport pathway for Escherichia coli, combining direct and indirect electron transport pathways, the problem of weak electron transport capacity in E. coli was solved, and the efficiency of electron transport and electrosynthesis was improved.

CN115786224BActive Publication Date: 2026-05-29NANJING TECH UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING TECH UNIV
Filing Date
2022-12-12
Publication Date
2026-05-29

Smart Images

  • Figure CN115786224B_ABST
    Figure CN115786224B_ABST
Patent Text Reader

Abstract

The application discloses construction and application of multiple electron transfer pathway Escherichia coli, selects non-natural electrically active microorganism Escherichia coli as a research object, and introduces the electron transfer pathway of natural electrically active microorganism into the Escherichia coli. In the Escherichia coli with the Mtr pathway, the appropriate endogenous electron mediator is introduced, and the multiple electron transfer pathways are used to strengthen the transmembrane electron transfer of the Escherichia coli. In order to further improve the electron transfer capacity, the IPTG concentration, the induction temperature, the induction time, the induction initial OD are optimized, the best fermentation condition is selected, the production of phenazine-1-carboxylic acid is improved, and the electron transfer efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the construction and application of a multi-electron transport pathway in Escherichia coli. Background Technology

[0002] Naturally electroactive microorganisms, such as Shewanella and Clostridium butyricum, possess excellent electron transfer capabilities, but their carbon source spectrum is narrow, gene editing techniques are limited, and product variety is scarce. In contrast, non-naturally electroactive microorganisms, such as Escherichia coli and yeast, have mature chemical production systems and abundant molecular biology and synthetic biology tools, but their own electron transfer capabilities are limited. Therefore, introducing the electron transfer pathways of naturally electroactive microorganisms into non-naturally electroactive microorganisms such as Escherichia coli is of great significance for expanding the application prospects of microbial electrosynthesis.

[0003] Currently, the electron transfer pathways discovered in naturally electroactive microorganisms can be mainly divided into two types: direct electron transfer and indirect electron transfer. Direct electron transfer refers to the process by which electrons are transferred across the cell membrane and between the microorganism and the electrode through direct contact between the microorganism and the electrode via cytochromes or conductive flagella on the cell membrane after the formation of a biofilm on the electrode. This is the main way that naturally electroactive microorganisms acquire electrons in microbial electrosynthesis, and it is more energy-efficient and sustainable compared to the high energy requirements of indirect electron acquisition.

[0004] Currently, the weak extracellular electron transport capacity of microorganisms is a limiting factor in MES (Molecular Electron Transport System) systems. With the continuous development of molecular biology and synthetic biology, technical means have been provided for modifying electron transport pathways and improving extracellular electron transport capacity. In recent years, some achievements have been made in the design, reconstruction, and functional enhancement of electron transport pathways using synthetic biology strategies. Electron transport pathways of naturally electroactive microorganisms have been constructed from non-naturally electroactive microorganisms, successfully yielding a series of new electroactive microorganisms.

[0005] The lack of synergistic electron mediators in E. coli constructing a single Mtr pathway leads to low transmembrane electron transport efficiency. While adding exogenous electron mediators can enhance electron transport efficiency, their biocompatibility and adaptability are low. Therefore, introducing suitable endogenous electron mediators into E. coli constructing the Mtr pathway and leveraging the synergistic effect of multiple electron transport pathways to enhance transmembrane electron transport in E. coli is a more ideal solution. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method for constructing and applying a multiple electron transport pathway in *E. coli*. This method improves the electron transport efficiency of *E. coli* by constructing multiple electron transport pathways where direct and indirect electron transport coexist.

[0007] The construction of an Escherichia coli with a multiple electron transport pathway includes the following steps:

[0008] Step 1: Construct recombinant plasmids ptrc99a-phzAG, ptrc99a-Lac-phzAG, ptrc99a-tac-phzAG, or ptrc99a-LacUV5-phzAG;

[0009] Step 2: Construct the recombinant plasmid PBBR1MCS-5-CBA;

[0010] Step 3: Electroporate recombinant plasmids ptrc99a-phzAG, ptrc99a-Lac-phzAG, ptrc99a-tac-phzAG or ptrc99a-LacUV5-phzAG and recombinant plasmid PBBR1MCS-5-CBA into the strain to obtain Escherichia coli with multiple electron transport pathway.

[0011] As an improvement, the strain mentioned in step 3 is an Escherichia coli strain. E. coli BL21 E. coli BL21(DE3), E. coli MG1655 E. coli K12, or E. coli K12 (△ldh,△pfl,△ptsG).

[0012] A further improvement is that the E. coli strain K12 (Δldh, Δpfl, ΔptsG) is deposited at the China Center for Type Culture Collection (CCTCC) with accession number M2018743, address: Wuhan University, Wuhan, China, and date of deposit: November 1, 2018.

[0013] The specific steps for applying the above-mentioned multiple electron transport pathways to enhance the electron transport capacity of E. coli are as follows:

[0014] The first step was to select positive clones of Escherichia coli with multiple electron transport pathways, and after LB activation and shaking culture, transfer them to shake flasks for 37°C shaking culture.

[0015] Step 2, Cellular OD 600 The OD was induced with IPTG between 0.4 and 0.6, and then incubated in a shaker at 30°C for 12 hours. Samples were then taken to measure the OD. 600 and the yield of phenazine-1-carboxylic acid;

[0016] The third step is to use the initial OD 600 0.5 μL was transferred to anaerobic culture, and 10 mM ferric citrate was added simultaneously. OD was monitored by sampling at specified time intervals. 600The content of ferrous ions is used to detect electroactivity.

[0017] Beneficial effects:

[0018] Compared with existing technologies, this invention describes the construction and application of a multi-electron transport pathway in *E. coli*. It constructs an electron transport pathway in *E. coli*, specifically the direct electron transport pathway (Mtr pathway), and introduces a suitable endogenous electron mediator to enhance electron transport capacity and improve the reduction of soluble Fe by recombinant *E. coli*. 3+ The ability of ions. Attached Figure Description

[0019] Figure 1 To reduce soluble Fe by promoters of different strengths 3+ The effect of ions

[0020] Figure 2 For multiple electronic pathways to reduce soluble Fe 3+ Effects of ions (a) and cell growth (b);

[0021] Figure 3 IPTG concentration (a), temperature (b), and initial OD 600 (c) Effects on cell growth and phenazine-1-carboxylic acid production;

[0022] Figure 4 The effect of induction time on cell growth and phenazine-1-carboxylic acid production. Detailed Implementation

[0023] The present invention will be further described below through specific embodiments, but this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention, but as long as they do not depart from the basic idea of ​​the present invention, they are all within the scope of the present invention.

[0024] Example 1: Construction of Escherichia coli with multiple electron transport pathways

[0025] Step 1: Construct recombinant plasmids ptrc99a-Lac-phzAG, ptrc99a-tac-phzAG, or ptrc99a-LacUV5-phzAG;

[0026] Step 2: Construct the recombinant plasmid PBBR1MCS-5-CBA according to patent ZL201910994832.2;

[0027] Step 3: Electroporate the recombinant plasmid ptrc99a-phzAG and recombinant plasmid PBBR1MCS-5-CBA into E. coli strain. E. coliK12 (△ldh, △pfl, △ptsG) (the aforementioned Escherichia coli strain) E. coli K12 (△ldh, △pfl, △ptsG) is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M2018743, address: Wuhan University, Wuhan, China, date of deposit: November 1, 2018.

[0028] In step 1 above, the construction of recombinant plasmids ptrc99a-phzAG-Lac, ptrc99a-phzAG-tac, and ptrc99a-phzAG-LacUV5 refers to using the expression vector ptrc99a as a template and replacing the promoter through conventional PCR amplification to obtain recombinant plasmids ptrc99a-phzAG-Lac, ptrc99a-phzAG-tac, and ptrc99a-phzAG-LacUV5.

[0029] The Lac-F upstream primer used has the sequence shown in SEQ ID No. 1:

[0030] Tttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaa

[0031] The downstream primer used for Lac-R has the following sequence as shown in SEQ ID No. 2:

[0032] caacatacgagccggaagcataaagtgtaaacagctcatttcagaatatttgccagaaccgttatgatgtc

[0033] The upstream primer used for tac-F has the sequence shown in SEQ ID No. 3:

[0034] ttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcaca

[0035] The downstream primer used for tac-R has the sequence shown in SEQ ID No. 4:

[0036] cattatacgagccgatgattaattgtcaacagctcatttcagaatatttgccagaacc

[0037] The upstream primer LacUV5-F used has the sequence shown in SEQ ID No. 5:

[0038] tttacactttatgcttccggctcgtataatgtgtggaattgtgagcg

[0039] The downstream primer used, LacUV5-R, has the sequence shown in SEQ ID No. 6:

[0040] cattatacgagccggaagcataaagtgtaaacagctcatttcagaatatttgccagaaccgttat

[0041] The reaction conditions were: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 5 min, and 72℃ for 5 min, for a total of 30 cycles. The obtained sequences were recovered by 1% agarose gel electrophoresis.

[0042] The recovered fragment was digested at 37°C for 2 h. The digestion system consisted of 10×buffer 2 μL. Dpn I. 1 μL of the digested product was used to recover 17 μL of the fragment. The product was then transformed into E. coli Trans1-T1. Positive strains were screened by colony PCR to verify the correct construction of the recombinant plasmid.

[0043] The positive strain was inoculated into 5 mL of LB / Gm liquid medium, which consisted of 10 g / L peptone, 5 g / L yeast extract, and 5 g / L sodium chloride. The medium was incubated overnight at 37 ℃ with shaking at 200 rpm. After 24 hours, plasmids ptrc99a-Lac, ptrc99a-tac, and ptrc99a-LacUV5 were extracted according to the instructions of the Tiangen plasmid extraction kit.

[0044] Using ptrc99a-Lac, ptrc99a-tac, and ptrc99a-LacUV5 as templates, recombinant plasmids ptrc99a-phzAG-Lac, ptrc99a-phzAG-tac, and ptrc99a-phzAG-LacUV5 were constructed according to patent ZL201811344851.2. The recombinant plasmids ptrc99a-phzAG-Lac, ptrc99a-phzAG-tac, ptrc99a-phzAG-LacUV5, and PBBR1MCS-5-CBA were then electroporated into *E. coli* strains. E. coliK12 (△ldh, △pfl, △ptsG), obtained ptrc99a-phzAG-Lac-PBBR1MCS-5-CBA, ptrc99a-phzAG-tac-PBBR1MCS-5-CBA, ptrc99a-phzAG-LacUV5-PBBR1MCS-5-CBA.

[0045] 2. Fermentation verification of recombinant strains

[0046] PTRC99a-phzAG-Lac-PBBR1MCS-5-CBA, PTRC99a-phzAG-tac-PBBR1MCS-5-CBA, and PTRC99a-phzAG-LacUV5-PBBR1MCS-5-CBA were seeded into 5 mL of LB / Gm liquid medium and cultured at 37 ℃ and 200 rpm for 9 h with shaking. The cells were then transferred to 100 mL of LB / Gm liquid medium and cultured at 37 ℃ and 200 rpm. Cell OD... 600 At 0.4-0.6, the cells were induced with 0.025 mM IPTG and then incubated in a shaker at 30°C. OD was measured after 12 hours. 600 and the yield of phenazine-1-carboxylic acid. Then, based on the initial OD... 600 0.5 μL of the solution was transferred to an anaerobic vial containing 50 mL of anaerobic M9 medium. Oxygen was purged with nitrogen for five minutes, and simultaneously 10 µM IPTG and 10 mM ferric citrate were added. OD was monitored at 0, 6, 11, 24, 35, 46, 56, 70, and 94 h. 600 With ferrous ion content.

[0047] The results of Example 1 show that, as can be seen from Figure 1, the ptrc99a-phzAG-Lac-PBBR1MCS-5-CBA strain has a lower Fe content than the ptrc99a-phzAG-trc-PBBR1MCS-5-CBA strain. 2+ The reduction ability increased by 1.98 times, indicating that the electron transfer ability also increased accordingly.

[0048] Example 2: Application of recombinant plasmid ptrc99a-phzAG in enhancing electron transport capacity in *E. coli*.

[0049] The recombinant plasmid ptrc99a-phzAG was constructed according to the construction steps of Example 1, specifically referring to patent ZL201811344851.2. The remaining steps were the same as in Example 1, resulting in Escherichia coli with multiple electron transport pathways.

[0050] Positive clones of *E. coli* with multiple electron transport pathways, *E. coli* with a single direct electron transport pathway (ptrc99a-phzAG), and *E. coli* with a single indirect electron transport pathway (PBBR1MCS-5-CBA) were selected and inoculated into 5 mL LB / g medium, respectively, and cultured at 37°C and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL LB / g medium and cultured at 37°C and 200 rpm. When the cell OD... 600 When the pH is between 0.4 and 0.6, add IPTG to a final concentration of 0.025 mM for induction, then incubate at 30°C in a shaker for 12 h. Then, use the initial OD... 600 0.5 μL of the solution was transferred to an anaerobic vial containing 50 mL of anaerobic M9 medium. Oxygen was purged with nitrogen for five minutes, and simultaneously 10 μM IPTG and 10 mM ferric citrate were added. OD values ​​were monitored at 0, 6, 11, 24, 35, 46, 56, 70, and 94 h. 600 With ferrous ion content.

[0051] The formulation of the anaerobic M9 medium is as follows: Na2HPO4·7H2O 12.8 g / L, KH2PO4 3 g / L, NaCl 0.5 g / L, NH4Cl 1 g / L, 0.4% glucose, 1 mM ammonium sulfate HCl, 0.2% casein amino acids, 2 mM MgSO4, and 0.1 mM CaCl2.

[0052] The method for detecting ferrous ions was the phenanthroxazine assay. The bacterial suspension was diluted according to the actual situation, and the diluted bacterial suspension was mixed with phenanthroxazine staining solution at a ratio of 1:1. Then, the mixture was centrifuged at 10,000 rpm for 3 minutes, and 200 μL of the supernatant was collected into a 96-well plate. The detection was performed at 562 nm using a microplate reader. The phenanthroxazine staining solution was prepared as follows: 100 mM Hepes buffer was prepared, pH adjusted to 8.0, and 0.246 g of phenanthroxazine reagent was weighed into 15 mL of Hepes buffer.

[0053] Figure 2 (a) It can be seen that E. coli with multiple electron transport pathways has a higher electron reduction capacity and can maintain a high level. Figure 2 (b) It can be seen that the growth of Escherichia coli with multiple electron transfer was not affected.

[0054] Example 3: Application of Escherichia coli constructed with recombinant plasmid ptrc99a-phzAG to enhance the yield of phenazine-1-carboxylic acid.

[0055] The recombinant plasmid ptrc99a-phzAG was constructed according to the construction steps of Example 1, specifically referring to patent ZL201811344851.2. The remaining steps were the same as in Example 1, resulting in Escherichia coli with multiple electron transport pathways.

[0056] 1. Effects of IPTG concentration

[0057] Positive clones of *E. coli* with multiple electron pathways were selected and inoculated into 5 mL of LB / Gm liquid medium, and cultured at 37°C and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL of LB / Gm liquid medium and cultured at 37°C and 200 rpm. Cell OD... 600 When the concentration was between 0.4 and 0.6, the samples were induced with IPTG at concentrations of 0, 0.025, 0.05, 0.1, 0.25, 0.5, 0.75, and 1 mM, and then incubated in a shaker at 30°C for 12 hours. OD values ​​were then measured. 600 And the yield of phenazine-1-carboxylic acid.

[0058] 2. Effect of induction temperature

[0059] Positive clones of *E. coli* with multiple electron pathways were selected and inoculated into 5 mL of LB / Gm liquid medium, and cultured at 37°C and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL of LB / Gm liquid medium and cultured at 37°C and 200 rpm. Cell OD... 600 When the concentration was between 0.4 and 0.6, the cells were induced with 0.025 mM IPTG and then incubated in shakers at 37°C, 30°C, 25°C, and 18°C. After 12 hours, samples were taken to measure the OD. 600 And the yield of phenazine-1-carboxylic acid.

[0060] 3. Inducing initial OD 600 Impact

[0061] Positive clones of *E. coli* with multiple electron pathways were selected and inoculated into 5 mL of LB / Gm liquid medium, and cultured at 37°C and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL of LB / Gm liquid medium and cultured at 37°C and 200 rpm. Cell OD... 600 At concentrations between 0, 0.4, 0.7, and 1, samples were induced with 0.025 mM IPTG and then incubated in a shaker at 30°C. After 12 hours, samples were taken to measure the OD. 600 And the yield of phenazine-1-carboxylic acid.

[0062] 3. The influence of induction time

[0063] Positive clones of *E. coli* with multiple electron pathways were selected and inoculated into 5 mL of LB / Gm liquid medium, and cultured at 37°C and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL of LB / Gm liquid medium and cultured at 37°C and 200 rpm. Cell OD... 600 At 0.4, after induction with 0.025 mM IPTG, the samples were incubated in a shaker at 30°C. OD values ​​were measured at 0, 7, 12, 21, 26, and 33 hours. 600 And the yield of phenazine-1-carboxylic acid.

[0064] The detection method for the above-mentioned phenazine-1-carboxylic acid is as follows: take 1 ml of bacterial culture, centrifuge at 10000 rpm for 3 minutes, take 200 μl of the supernatant into a 96-well plate, and detect it at 365 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0065] according to Figure 3 (a) Figure 3 (b) Figure 3 (c) OD analysis 600 The yield of phenazine-1-carboxylic acid was determined by using IPTG 0.025 mM at 30 °C and inducing initial OD. 600 0.4 is the optimal fermentation condition. After induction for 12 hours, the culture is transferred to anaerobic culture, which can maintain high cell activity and the yield of phenazine-1-carboxylic acid, showing good application prospects.

[0066] In summary, this invention relates to the construction and application of a multi-electron transport pathway in Escherichia coli. The invention constructs an electron transport pathway in Escherichia coli, and by constructing a direct electron transport pathway (Mtr pathway) and introducing a suitable endogenous electron mediator, it aims to improve electron transport capacity and increase the electrosynthesis efficiency of recombinant Escherichia coli.

Claims

1. An application of *Escherichia coli* with multiple electron transport pathways in increasing the yield of reduced soluble ferric ions and phenazine-1-carboxylic acid, characterized in that... Positive clones of *E. coli* with multiple electronic pathways were selected and inoculated into 5 mL LB / Gm liquid medium. The culture was carried out at 37 ℃ and 200 rpm with shaking for 9 h. The clones were then transferred to 100 mL LB / Gm liquid medium and cultured at 37 ℃ and 200 rpm until the cells reached their OD (overflow surfacing rate). 600 At 0.4, after induction with 0.025 mM IPTG, the cells were cultured in a shaker at 30°C for 12 hours to obtain phenazine-1-carboxylic acid. The steps for reducing soluble ferric ions are as follows: First, select positive clones of *E. coli* with multiple electron transport pathways, activate them with LB, and then transfer them to a shaker flask for culture at 37°C. Second, cell OD... 600 The OD was induced with IPTG between 0.4 and 0.6, and then incubated in a shaker at 30°C for 12 h. Samples were then taken to measure the OD. 600 and the yield of phenazine-1-carboxylic acid; the third step, with the initial OD 600 0.5 μL was transferred to anaerobic culture, and 10 mM ferric citrate was added simultaneously. OD was monitored by sampling at specified time intervals. 600 The electroactivity is detected by measuring the content of ferrous ions; specifically, a highly adaptable transmembrane electron channel is constructed and an endogenous electron mediator synthesis gene is introduced into *E. coli* with multiple electron transport pathways; the specific steps include: Step 1: Construct the recombinant plasmid ptrc99a-Lac-phzAG; Step 2: Construct the recombinant plasmid PBBR1MCS-5-MtrCBA; Step 3: The recombinant plasmids ptrc99a-Lac-phzAG and PBBR1MCS-5-MtrCBA were introduced into E. coli strain E. coli K12 (Δldh, Δpfl, ΔptsG), thus forming E. coli with a multiple electron transport pathway. The E. coli strain E. coli K12 (Δldh, Δpfl, ΔptsG) is deposited at the China Center for Type Culture Collection (CCTCC) with accession number M2018743, address: Wuhan University, Wuhan, China, and date of deposit: November 1, 2018.