A cell-penetrating peptide, an intracellular antimicrobial peptide and its application

Abstract

The present invention provides a cell-penetrating peptide, an intracellular antimicrobial peptide and its application, and relates to the technical field of antimicrobial peptides. The amino acid sequence of the cell-penetrating peptide is shown in SEQ ID No. 1, and the cell-penetrating peptide can specifically bind to sheep small intestinal epithelial cells; the present invention also provides an intracellular antimicrobial peptide, including the coupled cell-penetrating peptide and antimicrobial peptide. The cell-penetrating peptide VLNSLID provided by the present invention has cell specificity, low cytotoxicity, can carry cargo molecules, has the advantage of more efficient transport, can be used as a tool for studying the effects of intracellular macromolecules and a transport carrier for therapeutic drugs, and can be widely used as a feed additive in the preparation of antimicrobial feed to replace traditional antibiotics.

Description

Technical Field

[0001] The present invention relates to the technical field of antimicrobial peptides, and in particular to a cell-penetrating peptide, an intracellular antimicrobial peptide and applications thereof. Background Art

[0002] Facultative or obligate intracellular bacterial infections cause serious economic losses to the livestock industry. Intracellular parasites can colonize and survive for a long time in host cells, such as Salmonella, which can not only resist the host's defense system through many ingenious mechanisms, but also spread in the body as host cells migrate, leading to persistent, latent and recurrent infections.

[0003] Phage display technology is to express exogenous peptides on the surface of phages to obtain specific artificial phages with linked genotypes and phenotypes, and then interact with target protein molecules or target cells on the solid phase. This affinity screening method can highly enrich peptide sequences with certain specificity. Phage display technology has been proven to be a powerful tool for identifying peptides and proteins that bind to specific targets. In recent years, CPPs screened using phage display technology have been extensively and deeply studied and explored in human and animal health-related diseases. With the widespread application of phage display technology in the selection of specific cell-targeted CPPs, more and more CPPs with different cell targets will be screened and identified, especially in the design of intracellular bactericidal drugs, providing more and better drug delivery vehicles for the new generation of targeted interventions.

[0004] The development of antimicrobial peptide feed additives that can enter cells and kill bacteria to replace antibiotics has become an urgent scientific problem to be solved in the effective control of livestock and poultry production in animal husbandry production practice. However, studies have found that antimicrobial peptides have high bactericidal properties but are difficult to specifically pass through the intestines and enter cells, resulting in low bactericidal efficiency. Finding peptides that can specifically bind to cells and increase the specific penetration ability of antimicrobial peptides to achieve rapid and efficient cell entry and sterilization can become a treatment method to replace antibiotics. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a cell-penetrating peptide that can specifically bind to sheep intestinal epithelial cells, and a cell-penetrating antimicrobial peptide obtained by coupling the penetrating peptide with an antimicrobial peptide, which can improve the ability of the antimicrobial peptide to enter cells and kill intracellular parasites, achieve targeted and precise killing effects, thereby improving the efficiency of antimicrobial peptides in killing intracellular pathogens, and replacing antibiotics to solve the problem of intracellular parasitic infections in animal husbandry production practice.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a cell-penetrating peptide, the amino acid sequence of the cell-penetrating peptide is shown as SEQ ID No.1.

[0008] Preferably, the cell-penetrating peptide is capable of specifically binding to sheep small intestinal epithelial cells.

[0009] The present invention provides the application of the cell penetrating peptide as a tool for studying the action of intracellular macromolecules and a therapeutic drug transport carrier.

[0010] The present invention also provides a cell-penetrating antimicrobial peptide, comprising the coupled cell-penetrating peptide and the antimicrobial peptide.

[0011] Preferably, the amino acid sequence of the antimicrobial peptide is as shown in SEQ ID No.2.

[0012] Preferably, the amino acid sequence of the intracellular antimicrobial peptide is as shown in SEQ ID No.3.

[0013] The present invention also provides a gene encoding the intracellular antimicrobial peptide, and the nucleotide sequence of the gene is shown in SEQ ID No.4.

[0014] The invention also provides the use of the intracellular antimicrobial peptide in the preparation of feed additives.

[0015] The invention also provides the use of the intracellular antimicrobial peptide in the preparation of antimicrobial veterinary drugs.

[0016] Preferably, the antimicrobial veterinary drug comprises a veterinary drug for sheep.

[0017] Beneficial effects of the present invention:

[0018] The cell-penetrating peptide provided by the present invention can specifically penetrate epithelial cells. The cell-penetrating peptide is coupled to an antimicrobial peptide to penetrate the cell membrane, thereby achieving targeted and precise killing effects, thereby improving the efficiency of the antimicrobial peptide in killing intracellular parasites.

[0019] The cell-penetrating peptide VLNSLID provided by the present invention has cell specificity and low cytotoxicity, can carry cargo molecules, has the advantage of more efficient transport, can be used as a tool for studying the effects of intracellular macromolecules and a transport carrier for therapeutic drugs, and can be widely used as a feed additive in the preparation of antibacterial feed to replace traditional antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of ELISA test on the binding affinity between monoclonal phage and sheep intestinal epithelial cells. The ratio greater than 2 is a positive clone, indicating that the monoclonal phage has a high affinity with sheep intestinal epithelial cells.

[0021] Figure 2This is a diagram of cytotoxic activity identified by the CCK8 method, with peptides SCPP1, SCPP2, svSCPP1, and svSCPP2, and peptide concentrations of 256 μmol / mL, 128 μmol / mL, 64 μmol / mL, 32 μmol / mL, and 16 μmol / mL. Cells without peptides were used as negative control groups, and culture medium alone was used as blank control groups.

[0022] Figure 3 The specific membrane penetration effect of the peptides observed under a fluorescence microscope is shown in the fluorescence images of the peptides SCPP1, SCPP2, svSCPP1, and svSCPP2 co-incubated with sheep small intestinal epithelial cells (upper), pig small intestinal epithelial cells (middle), and mouse small intestinal epithelial cells (lower) at 16 μmol / mL for 2 hours. The microscope magnification is 20X.

[0023] Figure 4 The final concentrations of peptides SCPP1 and SCPP2 were 32 and 16 μmol / mL, respectively, and the sheep intestinal epithelial cells were incubated for 2 hours, and the intracellular mean fluorescence intensity was detected by flow cytometry.

[0024] Figure 5 This is a cytotoxicity test diagram of the coupled peptides SCPP1-C3M4 and C3M4-SCPP1. The peptide concentrations are 256 μmol / mL, 128 μmol / mL, 64 μmol / mL, 32 μmol / mL, and 16 μmol / mL. Cells without peptides were used as negative control groups, and culture medium alone was used as blank control groups.

[0025] Figure 6 Fluorescence images of C3M4 (upper), coupled peptide SCPP1-C3M4 (middle), and C3M4-SCPP1 (lower) co-incubated with sheep small intestinal epithelial cells at 16 μmol / mL for 2 h, with a microscope magnification of 20X;

[0026] Figure 7 The final concentration of the coupled peptide was 32 and 16 μmol / mL, and the cells were incubated with sheep intestinal epithelial cells for 2 h. The mean fluorescence intensity was detected by flow cytometry.

[0027] Figure 8 The diagram shows the intracellular bactericidal activity of the coupled peptides SCPP1-C3M4 and C3M4-SCPP1, where the upper diagram is the intracellular bactericidal kinetic curve of C3M4, the middle diagram is the intracellular bactericidal kinetic curve of C3M4-SCPP1, and the lower diagram is the intracellular bactericidal kinetic curve of SCPP1-C3M4. DETAILED DESCRIPTION

[0028] The present invention provides a cell-penetrating peptide, the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID No. 1, specifically as follows: VLNSLID, hereinafter referred to as SCPP1.

[0029] In the present invention, the cell-penetrating peptide can specifically bind to sheep intestinal epithelial cells; the cell-penetrating peptide is preferably obtained by four rounds of in vitro subtraction screening using phage display technology, and the cell-penetrating peptide has no cytotoxicity and has specific penetration.

[0030] The present invention provides the use of the cell-penetrating peptide as a tool for studying the effects of intracellular macromolecules and a transport carrier for therapeutic drugs. The present invention does not specifically limit the specific types of the intracellular macromolecules and drugs, as long as they can be coupled to the cell-penetrating peptide and specifically enter cells.

[0031] The present invention also provides a cell-penetrating antimicrobial peptide, comprising the coupled cell-penetrating peptide and the antimicrobial peptide.

[0032] In the present invention, the amino acid sequence of the antimicrobial peptide is shown in SEQ ID No. 2, specifically as follows: GLLKGLLKKIGKKIRVGVRTRA, hereinafter referred to as C3M4.

[0033] In the present invention, the amino acid sequence of the intracellular antimicrobial peptide is shown in SEQ ID No. 3, specifically as follows: GLLKGLLKKIGKKIRVGVRTRAVLNSLID, hereinafter referred to as CPP-CM.

[0034] The gene sequence encoding the intracellular antimicrobial peptide is as follows:

[0035] ATGGGTTTGTTGAAGGGTTTGTTGAAAAAGATTGGTAAAAAGATC AGAGTCGGTGTTAGAACTAGAGCTGTTTTGAACTCTTTGATT (SEQ OD No. 4).

[0036] In the present invention, the intracellular antimicrobial peptide can specifically kill intracellular parasites including Salmonella, and can efficiently enter the cell to kill bacteria; the CPP-CM has high in vitro antibacterial activity and can kill Salmonella at low concentrations; the thermal stability, salt ion stability, and serum stability are all good; the CPP-CM has low hemolytic activity, low cytotoxicity, and a penetration ability that is significantly higher than that of C3M4, and has a significantly better bactericidal effect on intracellular Salmonella than C3M4.

[0037] The invention also provides the use of the intracellular antimicrobial peptide in the preparation of feed additives.

[0038] The invention also provides the use of the intracellular antimicrobial peptide in the preparation of antimicrobial veterinary drugs.

[0039] In the present invention, the antibacterial veterinary drugs include veterinary drugs for sheep.

[0040] The present invention has no special limitation on the preparation method and dosage form of the feed additive and the antibacterial veterinary drug, as long as the intracellular antibacterial peptide is acceptable in terms of pharmaceutical preparation.

[0041] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0042] Example 1

[0043] Four rounds of subtractive screening of a phage-displayed heptapeptide library in sheep intestinal epithelial cells

[0044] (1) Subtractive screening of phage display heptapeptide library

[0045] The sheep intestinal epithelial cells grown to 90% were blocked with 1% BSA in DMEM at 37°C for 1 hour. 10 μL (about 2×10 11 pfu), shake at 100rpm for 1h at room temperature, and remove the unbound phage liquid from the first round. Wash the culture dish twice with 0.05% TBST, about 1min each time. Pour out the washing solution and pat dry on sterile filter paper. Add 1mL of elution solution (0.2M Glycine-HCl) to the culture dish and incubate at room temperature, 100rpm, for 10min. During this period, add 150μL of neutralization buffer (1M Tris-HCl) to a sterile EP tube for use. After the elution is completed, add it to the prepared neutralization buffer EP tube and mix well.

[0046] (2) Screening of amplification of eluted products

[0047] Cultivate E. coli to the early logarithmic stage, take 20 mL and mix thoroughly with 10 μL of the phage dilution obtained in the above step, shake vigorously in a 37°C shaker for 4.5 hours for amplification. Transfer the amplified culture to a 50 mL centrifuge tube and centrifuge at 4°C, 10,000 rpm for 10 minutes. Take the supernatant and centrifuge again at 4°C, 10,000 rpm for 10 minutes. Add 80% of the supernatant to one-sixth volume of PEG / NaCl, mix well and place in a refrigerator at 4°C overnight. The next day, centrifuge the PEG / NaCl mixture at 4°C, 10,000 rpm for 15 minutes. Discard the supernatant, centrifuge again at 4°C, 10,000 rpm for 5 minutes, and discard the supernatant. Add 1 mL of PBS to the precipitate, mix well, and centrifuge at 4°C, 10,000 rpm for 5 minutes. Add one-sixth volume of PEG / NaCl again, mix well, incubate on ice for 1 hour, centrifuge at 4°C, 10,000 rpm for 10 minutes, and discard the supernatant. Add 200 μL PBS to the centrifuge tube. Centrifuge at 4°C, 10,000 rpm for 10 minutes. Transfer the supernatant to another centrifuge tube, which is the eluate after amplification. Perform concentration titration on the eluate after amplification. Repeat the above steps for 2, 3, and 4 rounds of screening, and perform concentration titration on the eluate and amplification solution in each round. After the 4th round of screening, pick 30 single blue plaques from the plate for amplification culture, centrifuge, and the supernatant is the phage clone storage solution.

[0048] (3) Phage titer determination

[0049] Take 10 μL of the neutralization eluate after adsorption (or the supernatant of phage after amplification) and dilute the phage with LB medium. The dilution range is: dilute the neutralization eluate after adsorption by 10 1 -10 5 ; After amplification, the phage supernatant was diluted 10 8 -10 11 . Add 200μL of bacterial solution for each dilution multiple, and add 10μL of phage solution of different dilution multiples to each tube, and shake on a shaker for 5 minutes to mix. Add to 3mL of top agar and incubate for 3 minutes, add to the preheated LB / IPTG / Xgal plate and spread evenly, invert and incubate in a 37℃ incubator overnight. Check the growth of phage blue spots on the plate and count (count the number of phage spots on each plate).

[0050] Phage titer calculation method: phage plaque number multiplied by its corresponding dilution multiple.

[0051] (4) Second to fourth rounds of screening

[0052] Each round of screening uses the phage solution amplified in the previous round as the secondary peptide library, and each round maintains the same phage input amount as the first round (about 2×10 11pfu), and a total of 4 rounds of subtractive screening were performed. The screening conditions were changed: the binding time of the peptide library to the sheep small intestinal epithelial cells was reduced to 50min (round 2), 40min (round 3), and 30min (round 4), respectively; the TBST concentration was adjusted to 0.1% (round 2), 0.15% (round 3), and 0.2% (round 4); the number of washes was increased to 4 times (round 2), 6 times (round 3), and 8 times (round 4). The phage titer of the eluate after each round of screening was determined, and the phage recovery rate was calculated.

[0053] Calculation formula: (eluted phage amount / input phage amount)×100%.

[0054] The enrichment effect results are shown in Table 1.

[0055] Table 1 Effect of four rounds of subtractive screening on phage enrichment

[0056]

[0057] The results showed that after four rounds of in vitro screening of sheep small intestinal epithelial cells, the recovery rate increased significantly, and in the fourth round, phages were significantly enriched, indicating that phages that could specifically bind to sheep small intestinal epithelial cells were enriched in large quantities.

[0058] Example 2

[0059] ELISA method to identify the specific binding of positive clones to sheep small intestinal epithelial cells

[0060] Take 100 μL of E. coli in the logarithmic growth phase and add it to 10 mL LB medium and mix well. Select 30 blue plaques that need to be amplified and add them to the above E. coli mixture. Place the mixture in a 37°C shaker and incubate for 4.5 hours; transfer to a 50 mL centrifuge tube, centrifuge at 4°C, 10,000 rpm for 10 minutes, take the supernatant and transfer it to another centrifuge tube, and repeat the above operation. Transfer the supernatant to another centrifuge tube and store at 4°C for later use. Take well-grown sheep small intestinal epithelial cells and add 1×10 5 / well, 200μL / well of culture medium were plated in a 96-well ELISA plate. After the cells adhered well and grew into a monolayer, the culture medium in the wells was aspirated, and the wells were rinsed with PBS 3 times, 5 minutes each time, and 50μL of 0.25% glutaraldehyde solution was added to fix the cells for 15 minutes. After fixation, the wells were washed with PBS 3 times, 5 minutes each time, and 3% hydrogen peroxide solution was added, 100μL per well, and placed in a 37°C incubator for 30 minutes to block the activity of endogenous peroxidase. The wells were rinsed with PBS 3 times, 5 minutes each time, and blocked with 1% BSA at 37°C for 60 minutes. The blocking solution was discarded and 1×10 10pfu randomly selected 30 monoclonal phage amplification solutions, the first round of unbound phage as negative control, incubated at 37℃ for 1.5h. Rinse with PBS 5 times, 1min / time, add 1:5000 diluted HRP / Anti-M13 antibody (purchased from Acbam), 100μL / well, and act at 37℃ for 1h. Rinse with PBS 3 times, 1min / time, add TMB colorimetric solution, and after the liquid turns blue, put it in an automatic microplate reader to detect the OD value at 450nm.

[0061] Affinity results: The OD value of the amplified phage and the sheep small intestinal epithelial cells was set as S, and the OD value of the unbound phage and the sheep small intestinal epithelial cells in the first round was set as P. The formula used was: S / P (S and P values ​​were the values ​​obtained by subtracting the OD value of the PBS blank control from the corresponding OD value). If the ratio was greater than 2, it was a positive result.

[0062] The results are as follows Figure 1 As shown, there are 21 phages with affinities greater than 2.

[0063] Example 3

[0064] Extraction and sequence determination of positive monoclonal phage DNA

[0065] (1) The M13 Isolation Kit purchased from Beijing Biolabs was used as follows:

[0066] Take 1-3mL of the amplified monoclonal phage supernatant and place it in a nuclease-free centrifuge tube. Add 0.2 times the volume of Buffer PB to the centrifuge tube, shake and mix, and place it at room temperature for about 10 minutes. Transfer the mixed solution to the adsorption column with a collection tube, and centrifuge at 10,000rpm for 30 seconds at room temperature. Pour out the liquid in the collection tube and put the adsorption column back into the collection tube. Repeat the above steps until all the mixed solution passes through the adsorption column, and place the adsorption column in a new collection tube. Add 600μL Buffer PC to the adsorption column, act at room temperature for 1 minute, and centrifuge at 10,000rpm for 30 seconds. Pour out the liquid in the collection tube and put the adsorption column back into the collection tube. Add 600μL DNA Wash Buffer to the adsorption column, and centrifuge at 10,000rpm for 30 seconds. Pour out the liquid in the collection tube and put the adsorption column back into the collection tube. Repeat the previous step, place the adsorption column in a new collection tube, remove the cap on the adsorption column, place it at room temperature for 2 minutes, centrifuge at 14000rpm for 2 minutes to remove as much residual ethanol as possible. Place the adsorption column in a new nuclease-free EP tube, add about 80μL of Elution Buffer to the adsorption column, place it at room temperature for 5 minutes. Centrifuge at 14000rpm for 2 minutes to elute the DNA.

[0067] (2) Determination and analysis of bacteriophage single-stranded DNA

[0068] According to the results of ELISA identification, 30 μL of positive phage single-stranded DNA extract was taken and sent to a biological company for fully automatic sequencing, using -96gⅢ sequencing primer 5′-HOCCCTCATAGTTAGCGTAACG-3′. The sequence was read according to the instructions of the phage display heptapeptide library kit and translated into the required heptapeptide sequence according to the codon table. The sequence with the highest repetition rate was selected, and the biological company synthesized the polypeptides and named them SCPP1 (VLNSLID) and SCPP2 (HSTTAQF). At the same time, a polypeptide with the same amino acid sequence and structure as the polypeptide but different combination order was synthesized and labeled with fluorescein isothiocyanate (FITC) to synthesize the targeted fluorescent probes FITC-SCPP1 and FITC-SCPP2 and the reverse sequence random control fluorescent probes FITC-svSCPP1 and FITC-sv SCCP2.

[0069] Table 2 Sequences and frequencies of positive phage amino acids

[0070]

[0071]

[0072] Example 4

[0073] CCK8 cytotoxicity assay of penetrating peptides

[0074] In a 96-well plate full of sheep intestinal epithelial cells, add 100 μl of peptides (FITC-SCPP1, FITC-SCPP2, FITC-sv SCPP1, FITC-svSCPP2) of different final concentrations (256 μmol / mL, 128 μmol / mL, 64 μmol / mL, 32 μmol / mL, 16 μmol / mL), only cells without peptides as negative control group, only culture medium as blank control group, put in 37 ° C, 5% CO2 incubator for 24 hours. After the treatment reaches the expected time, the supernatant of the cell co-incubation solution is discarded, and the cells are washed 3 times with 1×PBS 100 μl / well, 2 minutes / time. Add 10 μl CCK8 solution to each well, continue incubation in the incubator for 1-3 hours, and measure the absorbance at 450nm with an enzyme marker.

[0075] Cell survival rate (%) = [(OD A(处理组) -OD A(空白组) ) / (OD A(未处理组) -OD A(空白组) )]×100%;

[0076] The results are as follows Figure 2 As shown, SCPP1 showed slight toxicity at a cell viability of 88% at 256 μmol / mL, svSCPP2 showed toxicity at a cell viability of 75% at 256 μmol / mL, and the other concentrations were non-toxic and had no effect on cell growth.

[0077] Example 5

[0078] Cell-specific permeability assay

[0079] Digest a dish of sheep intestinal epithelial cells, mouse intestinal epithelial cells, and porcine intestinal epithelial cells in good growth condition in the logarithmic growth phase with trypsin, collect the cell precipitate by centrifugation, add 1 mL of DMEM-F12 complete medium containing serum to the centrifuge tube, resuspend the cells and mix them evenly, count the cells using a counting plate, and adjust the cell suspension concentration to 1×10 5 / mL, and add the cell suspension to the culture dish, 1mL / well, and culture in a cell culture incubator overnight. Incubate the cells with the FITC-tagged polypeptide (16μmol / mL) for 2h, wash 3 times with PBS, 1min / time. Fix with 4% paraformaldehyde for 15min, wash 3 times with PBS, 1min / time. Add 200μl DAPI to each well, incubate at 37℃ in the dark for 5min, wash 3 times with PBS, 1min / time. Add appropriate amount of Dil for staining, incubate at 37℃ in the dark for 5-20min, wash 3 times with PBS, 1min / time. Observe under a fluorescence microscope, the results are as follows Figure 3 As shown, it can be seen that SCPP1 and SCPP2 can penetrate sheep small intestinal epithelial cells under the conditions of 16 μmol / mL and 2 h, but cannot penetrate pig small intestinal epithelial cells and mouse small intestinal epithelial cells.

[0080] Example 6

[0081] Flow cytometry to detect the membrane penetration efficiency of penetrating peptides

[0082] Logarithmically growing sheep small intestinal epithelial cells were taken and 1×10 5 The cells were inoculated in a 6-well plate at a density of 10 cells / well, and three replicate wells were set up in parallel for routine culture. Each cell type was divided into an experimental group and a control group. When the cells reached the logarithmic growth phase, they were replaced with serum-free culture medium and cultured for another 1 hour. The experimental group added peptides with a final concentration of 32 and 16 μmol / mL, and continued routine culture for 2 hours. The control group added serum-free culture medium for culture. The above incubation solution was discarded and washed 3 times with PBS. 0.5 mL of 0.25% trypsin solution was added and allowed to stand at room temperature for 10 minutes to completely digest the peptides attached to the cells. 5 mL of PBS was transferred with a pipette to blow up all the cells at the bottom of the bottle and collected in a 15 mL centrifuge tube. Centrifuge at 3000 rpm for 3 minutes, discard the supernatant, add 300 μL PBS to make a cell suspension, and detect the average fluorescence intensity on a flow cytometer.

[0083] The results are as follows Figure 4 As shown, it can be seen that the fluorescence intensity of SCPP1 is significantly higher than that of SCPP2, and is dose-dependent.

[0084] The experimental results of Examples 1 to 6 above indicate that the penetrating peptide VLNSLID can specifically penetrate sheep small intestinal epithelial cells.

[0085] Example 7

[0086] In vitro minimum inhibitory concentration determination of the conjugated peptide of penetrating peptide VLNSLID and antimicrobial peptide GLLKGLLKKIGKKIRVGVRTRA.

[0087] The antimicrobial peptide and penetrating peptide sequences were sent to Gill Biochemical (Shanghai) Co., Ltd. for Fmoc solid phase synthesis, and were labeled with FITC tags. The synthesized peptides were purified by high performance liquid chromatography, and the purity of the purified peptides was required to reach more than 95%. Electrospray mass spectrometry (MMALDI-TOF MS) was used for mass spectrometry identification to analyze the molecular mass and determine whether the synthesis was successful.

[0088] Salmonella was cultured in LB medium at 37°C for 12 h, centrifuged at 4°C for 10 min, the supernatant was discarded, the bacteria were washed three times with PBS, and the bacteria were resuspended in culture medium and the bacterial concentration was adjusted to 1×10 6 CFU / mL, take 50μL of bacterial solution and add it to a 96-well bacterial culture plate, dilute the coupled peptides (SCPP1-C3M4 and C3M4-SCPP1) with sterile water in a series ratio, the concentrations are 256μmol / mL, 128μmol / mL, 64μmol / mL, 32μmol / mL, 16μmol / mL, 8μmol / mL, 4μmol / mL, 2μmol / mL, 1μmol / mL, 0.5μmol / mL, and then add them to the above 96-well bacterial culture plate, 50μL / well, each concentration of coupled peptide is repeated 3 wells, cultured at 37℃ for 12h, observe the clarity of the solution with the naked eye, if there is bacterial growth, the solution is turbid, and the concentration of the antimicrobial peptide solution corresponding to the clear well at the junction of turbidity and clarity is the minimum inhibitory concentration (MIC).

[0089] The results showed that C3M4-SCPP1 had an antibacterial effect at 2 μmol / mL, and the antibacterial effect was higher than that of C3M4, indicating that the connection of the penetrating peptide had no effect on the antibacterial effect of the antimicrobial peptide.

[0090] Table 3 Minimum inhibitory concentration MIC (μM) of intracellular antimicrobial peptides

[0091]

[0092] Example 8

[0093] Conjugated peptide hemolytic activity assay

[0094] Collect 1mL of sheep blood, rat blood, and chicken blood, and store them in sodium heparin anticoagulant tubes; centrifuge at 1000g for 5min, discard the supernatant, and collect red blood cells; rinse the collected red blood cells with PBS for 3 times, and then resuspend the red blood cells; add 50μL PBS to wells 1 to 10 in each row of a 96-well plate, add 50μL of coupled peptide to well 1, mix well, then draw 50μL and add it to well 2, mix well, and so on, until well 10, draw 50μL after mixing, and discard; add 50μL of red blood cell suspension to wells 1 to 11 of the 96-well plate, add 50μL 0.2% TritonX-100 to well 12, and mix well. Well 11 is used as a negative control, and well 12 is used as a positive control. Place the plate in an incubator and incubate at 37°C for 1 hour, then centrifuge at 1000g, 4°C for 5 minutes. Pipette the supernatant and add it to a new 96-well plate. Measure the OD value with an ELISA reader. 570 The absorbance value under the given conditions was 0.0447 W / m2; the peptide concentration that caused 5% hemolytic activity was defined as the minimum hemolytic concentration.

[0095] Table 4 Hemolytic activity of intracellular antimicrobial peptides (μM)

[0096]

[0097]

[0098] The results showed that the coupled peptide had low hemolytic activity against sheep blood and mouse blood, but high hemolytic activity against chicken blood.

[0099] Example 9

[0100] Stability testing of coupled peptides

[0101] (1) Effect of different temperatures on the antibacterial effect of intracellular antimicrobial peptides. CPP-CM was placed at 0 and 100°C for 60 min, and then the antibacterial activity of CPP-CM was measured. The experiment was repeated 3 times.

[0102] (2) Effect of different concentrations of serum solution on the antibacterial effect of intracellular antimicrobial peptides. CPP-CM was mixed with 0%, 5%, 10%, 15% and 20% serum solutions in equal amounts, incubated at 37°C for 60 min, and then the antibacterial activity of intracellular antimicrobial peptides was measured. The experiment was repeated 3 times.

[0103] (3) Effect of different salt ions on the antibacterial effect of intracellular antimicrobial peptides. CPP-CM was exposed to different salt ions at 37°C for 60 min, and then the antibacterial activity of CPP-CM was measured. The experiment was repeated 3 times. The final concentrations of the salt ions measured were: 150mM NaCl, 4.5mM KCl, 1mM MgCl2, 2.5mM CaCl2, 4mM FeCl3 and 6mM NH4CL.

[0104] Table 5 Thermal stability of antimicrobial peptides (μM)

[0105]

[0106] Table 6 Serum stability of antimicrobial peptides (μM)

[0107]

[0108] Table 7 Salt ion stability of antimicrobial peptides (μM)

[0109]

[0110]

[0111] The results showed that C3M4 and its coupled peptides had good thermal stability, salt ion stability and serum stability.

[0112] Example 10

[0113] Peptide-coupled CCK8 cytotoxicity assay

[0114] In a 96-well plate full of sheep intestinal epithelial cells, add 100 μl of peptides with different final concentrations (256 μmol / mL, 128 μmol / mL, 64 μmol / mL, 32 μmol / mL, 16 μmol / mL), only cells without peptides as negative control group, only culture medium as blank control group, put into 37 ° C, 5% CO2 incubator for 24 hours. After the treatment reaches the expected time, discard the supernatant of the cell co-incubation solution, wash the cells 3 times with 1×PBS 100 μl / well, 2 minutes / time. Add 10 μl CCK8 solution to each well, continue incubation in the incubator for 1-3 hours, and measure the absorbance at 450nm with an enzyme marker.

[0115] Cytotoxic activity (%) = [A (drug added) - A (blank) / A (0 drug added) - A (blank)] × 100%

[0116] The results are as follows Figure 5 As shown, C3M4 and its coupled peptides inhibited cell viability at concentrations of 64 μmol / mL and above, and had no toxicity and no significant effect on cell growth at concentrations of 32 μmol / mL and below.

[0117] Embodiment 11

[0118] Cell penetration test of coupled peptides

[0119] Digest the well-growing sheep intestinal epithelial cells in the logarithmic growth phase with trypsin, collect the cell precipitate by centrifugation, add 1 mL of DMEM-F12 complete medium containing serum to the centrifuge tube, resuspend the cells and mix them evenly, count the cells using a counting plate, and adjust the cell suspension concentration to 1×10 5 / mL, and the cell suspension was added to a 12-well plate, 1mL / well, and placed in a cell culture incubator for overnight culture. The peptides containing FITC labels (C3M4, SCPP1-C3M4, C3M4-SCPP1, 16μmol / mL) were incubated with the cells for 2h, and washed 3 times with PBS, 1min / time. Fix with 4% paraformaldehyde for 15min, wash 3 times with PBS, 1min / time. Add 200μl DAPI to each well, incubate at 37℃ in the dark for 5min, wash 3 times with PBS, 1min / time. Add appropriate amount of Dil for staining, incubate at 37℃ in the dark for 5-20min, wash 3 times with PBS, 1min / time. Observe under a fluorescence microscope.

[0120] The results are as follows Figure 6 As shown, the membrane penetration effect diagram of the coupled peptide observed under a fluorescence microscope shows that the penetration ability of the coupled peptide is significantly enhanced compared with C3M4.

[0121] Example 12

[0122] Flow cytometry to detect the membrane penetration efficiency of coupled peptides

[0123] Logarithmically growing sheep small intestinal epithelial cells were taken and 1×10 5 The cells were inoculated in a 6-well plate at a seeding density of 10 cells / well, and three replicate wells were set up in parallel for routine culture. Each cell type was divided into an experimental group and a control group. When the cells reached the logarithmic growth phase (80% fusion), they were replaced with serum-free culture medium and cultured for another 1 hour. The experimental group added peptides with a final concentration of 32 and 16 μmol / mL; the routine culture was continued for 2 hours, and the control group was cultured with serum-free culture medium. The above incubation solution was discarded and washed 3 times with PBS. 0.5 mL of 0.25% trypsin solution (the digestion solution can cover the entire bottom of the culture plate) was added, and the cells were allowed to stand at room temperature for 10 minutes to completely digest the peptides attached to the cells. 5 mL of PBS was transferred with a pipette to blow up all the cells at the bottom of the bottle and collect them in a 15 mL centrifuge tube. Centrifuge at 3000 rpm for 3 minutes, discard the supernatant, add 300 μL PBS to make a cell suspension, and detect the average fluorescence intensity on a flow cytometer.

[0124] The results are as follows Figure 7As shown, the intracellular fluorescence intensity of C3M4-SCPP1 is higher than that of SCPP1-C3M4 and C3M4, proving that C3M4-SCPP1 has the best penetration effect.

[0125] Embodiment 13

[0126] Intracellular bactericidal activity of the intracellular antimicrobial peptide CPP-CM.

[0127] The concentration of primary sheep small intestinal epithelial cells was adjusted to 2×10 5 Plates were placed in 96-well plates, 100 μL per well, and Salmonella (MOI = 10:1) was added after attachment at 37°C. After stimulation for 1 hour, gentamicin (100 μg / mL) was added to kill extracellular bacteria. Then, intracellular antimicrobial peptides were added at concentrations of 4×MIC, 2×MIC, and 1×MIC, and the action time was 4h, 8h, and 12h, respectively. The peptides were discarded, and then 1 mL of 0.1% TritonX-100 solution was added to each well to lyse the cells for 10 minutes. After repeatedly blowing the cells, they were transferred to a 1.5 mL centrifuge tube and spread on an LB plate to count the bacteria.

[0128] The results are as follows Figure 8 As shown, the number of intracellular bacteria gradually decreased with the increase of antimicrobial peptide incubation time and antimicrobial peptide concentration, and the killing effect of the coupled peptide on intracellular bacteria was significantly higher than that of the C3M4 group.

[0129] These experimental results show that the coupled peptide formed by the coupling of the specific penetrating peptide VLNSLID and the antimicrobial peptide has enhanced antibacterial effect, low hemolytic activity and low cytotoxicity, and enhances the ability to penetrate cells and the intracellular bactericidal effect.

[0130] As can be seen from the above examples, the penetrating peptide with the amino acid sequence VLNSLID disclosed in the present invention is a cell penetrating peptide that has the ability to specifically enter the epithelial cells of the small intestine of sheep, and is safe and non-toxic. In addition, the coupled peptide formed after solid phase synthesis with the antimicrobial peptide can kill bacteria at low concentrations, has low hemolytic activity, low cytotoxicity, and can improve the penetration ability and enhance the ability of the antimicrobial peptide to enter cells and kill bacteria. Therefore, the penetrating peptide provided by the present invention can be used as a carrier, and the coupled antimicrobial peptide can be efficiently entered into cells and killed bacteria.

[0131] It is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A cell penetrating peptide, characterized in that The amino acid sequence of the cell penetrating peptide is shown in SEQ ID No.

1.

2. Use of the cell-penetrating peptide according to claim 1 as a tool for studying the effects of intracellular macromolecules and as a transport carrier for therapeutic drugs.

3. An intracellular antimicrobial peptide, characterized in that: Composed of the coupled cell penetrating peptide and antimicrobial peptide according to claim 1; The amino acid sequence of the antimicrobial peptide is shown in SEQ ID No.

2.

4. The intracellular antimicrobial peptide according to claim 3, characterized in that The amino acid sequence of the intracellular antimicrobial peptide is shown in SEQ ID No.

3.

5. The gene encoding the intracellular antimicrobial peptide according to claim 4, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

4.

6. Use of the intracellular antimicrobial peptide according to any one of claims 3 to 5 in the preparation of feed additives.

7. Use of the intracellular antimicrobial peptide according to any one of claims 3 to 5 in the preparation of antimicrobial veterinary drugs, characterized in that: The antibacterial veterinary drug is an anti-Salmonella veterinary drug.

8. The use according to claim 7, characterized in that: The antibacterial veterinary drugs include veterinary drugs for sheep.

Images