Rice endosperm powdery related gene osTML and its coding protein and application

Abstract

The application discloses a rice endosperm development related gene OsTML, a coding protein and application thereof. The gene OsTML is a DNA molecule as described in the following 1), 2), 3) or 4): 1) a DNA molecule shown in SEQ ID NO. 1; 2) a DNA molecule shown in SEQ ID NO. 2; 3) a DNA molecule hybridized with the DNA sequence defined in 1) or 2) under stringent conditions and coding the protein; and 4) a DNA molecule having more than 90% homology with the DNA sequence defined in 1), 2) or 3) and coding a plant endosperm development related protein. The application further provides a protein coded by the gene, the protein affects the development of a plant endosperm, and the coding gene of the protein is introduced into a plant with abnormal endosperm development, so that a transgenic plant with normal endosperm development can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a rice endosperm development-related gene OsTML, its encoded protein, and its applications. Background Technology

[0002] Rice is one of my country's important staple foods, and its quality directly affects people's daily lives. The endosperm in rice grains is the main energy storage organ, storing large amounts of starch, protein, and lipids, providing energy for seed germination and seedling development, and is also a major source of food for humans.

[0003] Existing research indicates that rice endosperm development is regulated by multiple metabolic pathways, including starch synthesis, storage protein transport, sugar transport and metabolism, starch-forming body development, and mitochondrial function. Therefore, identifying new regulatory factors is crucial for understanding the regulatory network of rice endosperm development and for future rice quality improvement efforts.

[0004] Scientists have discovered numerous mutant rice seeds with a mealy phenotype induced by chemical reagents, exhibiting loosely arranged starch granules in their endosperm. With the rapid development of molecular biology and molecular genetics methods and techniques, several functional genes that directly or indirectly regulate endosperm development have been cloned. However, the regulatory network of rice endosperm development remains unclear, necessitating the localization and cloning of more genes to further elucidate the mechanisms of rice endosperm development. Summary of the Invention

[0005] The purpose of this invention is to disclose a rice endosperm flour-related gene OsTML, its encoded protein, and its applications.

[0006] The gene OsTML provided by this invention is a DNA molecule as described in 1) or 2) or 3) or 4) below:

[0007] 1) The DNA molecule shown in SEQ ID NO.1;

[0008] 2) The DNA molecule shown in SEQ ID NO.2;

[0009] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein;

[0010] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant endosperm development.

[0011] The present invention also provides a protein encoded by the above-mentioned gene OsTML.

[0012] Specifically, the protein provided by this invention is selected from any one shown in (a) or (b):

[0013] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.3;

[0014] (b) Proteins derived from SEQ ID NO.3 that are associated with endosperm development and are modified by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO.3.

[0015] This invention also provides a recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria containing the aforementioned gene OsTML. Recombinant expression vectors containing any of the above-described genes also fall within the scope of protection of this invention.

[0016] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.

[0017] The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. These vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).

[0018] When constructing recombinant plant expression vectors using the aforementioned genes, any type of enhancing promoter or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter, can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0019] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0020] The recombinant overexpression vector can be a recombinant plasmid obtained by inserting the gene and its promoter into the recombination site of the vector pCAMBIA1390, which is double-digested with restriction endonucleases HindIII and BamHI. pCAMBIA1390 containing OsTML is named pOsTML::OsTML.

[0021] Expression cassettes, transgenic cell lines, and recombinant bacteria containing any of the genes (OsTML) described above are all within the scope of protection of this invention.

[0022] Primer pairs that amplify the full length or any fragment of the gene (OsTML) are also within the scope of protection of this invention, and the preferred primer pairs are Primer1 / Primer2, Primer3 / Primer4, Primer5 / Primer6 and Primer1 / Primer7.

[0023] The primers used in the fine mapping of this gene are shown in Table 1. The InDel primers were designed by the author for this experiment and are also within the scope of protection of this invention.

[0024] The present invention also provides the application of at least one of the said gene, the said protein, the said recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria in plant breeding.

[0025] The present invention also provides the use of at least one of the said gene, the said protein, the said recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria in the cultivation of transgenic plants with normal endosperm development.

[0026] The present invention also provides a method for cultivating transgenic plants with normal endosperm development, which involves introducing the gene into plants with abnormal endosperm development to obtain transgenic plants with normal endosperm development.

[0027] Specifically, the gene can be introduced into plants with abnormal endosperm development via the recombinant expression vector.

[0028] The present invention also provides the application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in the breeding of rice varieties with abnormal endosperm development. The application is to knock out or silence the gene shown in SEQ ID NO.1 or SEQ ID NO.2 to obtain rice with abnormal endosperm development; for example, by using CRISPR-Cas9 technology to perform site-directed mutations on the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in wild-type normal plants to obtain transgenic rice with abnormal endosperm development.

[0029] The method for cultivating rice varieties with abnormal endosperm development as described in this invention, or its application in plant heritage improvement or research.

[0030] By using any vector capable of guiding the expression of exogenous genes in plants, the gene encoding the stated protein can be introduced into plant cells to obtain transgenic cell lines and transgenic plants. The expression vector carrying the stated gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed can be either monocotyledonous or dicotyledonous, such as tobacco, birdsfoot, Arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0031] Beneficial effects:

[0032] This invention is the first to discover, locate, and clone the gene OsTML, a novel plant endosperm mealy protein. This plant endosperm mealy protein affects the endosperm development process in plants. Inhibiting the expression of the gene encoding this protein can lead to impaired endosperm development in plant seeds, thereby enabling the cultivation of transgenic plants with endosperm variations. Introducing the gene encoding this protein into plants with abnormal endosperm development can cultivate plants with normal endosperm development. This protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description

[0033] Figure 1 The seed phenotypes of wild-type Ningjing 2 and mutant Ostml are shown.

[0034] Figure 2 Scanning electron microscopy observation of mature seeds of wild-type Ningjing 2 and mutant Ostml.

[0035] Figure 3 Half-thin sections of wild-type Ningjing 2 and mutant Ostml 9 days after flowering.

[0036] Figure 4 This shows the fine location of the mutated gene on chromosome 8.

[0037] Figure 5 The T1 grain phenotype of the T0 generation plants transgenic with pCAMBIA1390-OsTML. Detailed Implementation

[0038] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0039] Example 1: Phenotypic identification of rice endosperm development mutants and cloning of their regulatory genes

[0040] I. Phenotypic and genetic analysis of the rice endosperm mealy mutant Ostml

[0041] An endosperm-rich mutant was screened from the tissue culture progeny of the japonica rice variety Ningjing 2 and named Ostml.

[0042] Figure 1 The images show whole and cross-sectional scans of mature seeds of Ningjing 2 and Ostml. The mutant exhibits a phenotype with completely mealy endosperm compared to Ningjing 2.

[0043] Cross-sections of Ningjing 2 and Ostml mutant seeds were observed using scanning electron microscopy. Figure 2 Wild-type seeds have tightly packed starch granules of uniform size, while Ostml mutant seeds have loosely packed starch granules, most of which are round.

[0044] Throughout seed development, the Ostml mutant exhibited a significantly reduced number of starch granules compared to Ningjing 2, displaying a phenotype of delayed endosperm development. Figure 3 ).

[0045] II. Map-based cloning of mutant gene sites

[0046] 1. Location of the mutated gene

[0047] First, a hybrid F1 combination of the mutants Ostml and Dular was bred, and F2 seeds were obtained after one generation of self-crossing. Ten grains of the extreme individual with a mealy phenotype were taken, and DNA was extracted and primary linkage was performed to determine the target gene on rice chromosome 8.

[0048] Using both standard primers from the laboratory and primers of our own design, the number of extreme individuals was increased to 463 strains. Ultimately, the target gene was located between markers Z21 and Z29, with a region size of 180 kb. Figure 4 ).

[0049] The method for SSR marker analysis described above is as follows:

[0050] (1) Extract total DNA from the selected single plants as a template. The specific method is as follows:

[0051] ① Take about 0.2 grams of tender rice leaves and place them in a 2.0 mL Eppendorf tube. Place a steel ball in the tube and freeze the Eppendorf tube containing the sample in liquid nitrogen for 5 minutes. Then, place the sample on a 2000 GENO / GRINDER instrument and crush it for 1 minute.

[0052] ② Add 500 μL of extraction buffer (a solution containing 100 mM Tris-HCl (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl, and 0.2 g / mL CTAB), incubate in a water bath at 42°C for 30 min, shaking once every 10 min;

[0053] ③ Add 500 μL of chloroform:isoamyl alcohol (24:1), mix well and let stand for ten minutes;

[0054] ④ Centrifuge at 12000 rpm for 5 minutes;

[0055] ⑤ Take 300 μL of the supernatant and add 600 μL of anhydrous ethanol pre-cooled at -20℃;

[0056] ⑥ Centrifuge at 12000 rpm for 3 minutes, discard the supernatant, and air dry at room temperature;

[0057] ⑦ Add 100 μL of 1×TE (a solution obtained by dissolving 121g Tris in 1 liter of water and adjusting the pH to 8.0 with hydrochloric acid) to dissolve the DNA.

[0058] (2) Dilute the extracted DNA to about 20 ng / μL and use it as a template for PCR amplification.

[0059] PCR reaction system (10 μL): DNA (20 ng / μL) 1 μL, upstream primer (2 pmol / μL) 1 μL, downstream primer (2 pmol / μL) 1 μL, 10×Buffer (MgCl2 free) 1 μL, dNTP (10 mM) 0.2 μL, MgCl2 (25 mM) 0.6 μL, rTaq (5 U / μL) 0.1 μL, ddH2O 5.1 μL, total 10 μL.

[0060] PCR reaction program: denaturation at 94.0℃ for 3 min; denaturation at 94.0℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min; storage at 10℃. PCR reactions were performed in an MJ Research PTC-225 thermal cycler.

[0061] (3) Detection of SSR-labeled PCR products

[0062] The amplification products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. A 50 bp DNA ladder was used as a control to compare the molecular weight of the amplification products, and silver staining was performed for color development.

[0063] The primer development process is as follows:

[0064] SSR markers from public maps were integrated with rice genome sequences, and BAC / PAC clone sequences near mutation sites were downloaded. Potential SSR sequences (repetition count ≥ 6) in clones were searched using SSRhunter (Li Qiang et al., Genetics, 2005, 27(5):808-810) or the online SSRIT software (http: / / archive.gramene.org / db / markers / ssrtool). These SSRs and their adjacent 400–500 bp sequences were compared online with corresponding indica rice sequences using the BLAST program on NCBI. If there was a difference in the number of SSR repeats, it was preliminarily inferred that the PCR product of the SSR primers exhibited polymorphism between indica and japonica rice. SSR primers were then designed using Primer Premier 5.0 software and synthesized by Nanjing Genscript Biotech Co., Ltd. The self-designed SSR paired primers were mixed in equal proportions, and their polymorphism between Dular and Nipponbare was detected. Polymorphic primers were used as molecular markers for fine mapping. Molecular markers used for fine mapping are shown in Table 1.

[0065] Table 1 Molecular markers used for fine localization

[0066]

[0067]

[0068] 2. Cloning of the powder gene

[0069] Sequencing of the 180kb region revealed a single base substitution in the Ostml gene.

[0070] Primers were designed based on sequences published online, as follows:

[0071] Primer1: 5'AGATCTCACCCAACCACCTC 3';

[0072] Primer2: 5'AATCAAGGGTAAAGTAACAA3'.

[0073] Using Primer 1 and Primer 2 as primers and endosperm DNA from the developing Ningjing 2 cultivar as a template, PCR amplification was performed to obtain the target gene. The amplification reaction was conducted on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 4 min, 35 cycles; 72℃ for 10 min. The PCR product was recovered, purified, and ligated into pMD18-T (Takara, Japan), transformed into *E. coli* DH5α competent cells (Tiangen CB101, Beijing), and positive clones were selected for sequencing.

[0074] Sequencing results showed that the fragment obtained by PCR had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 641 amino acid residues (see SEQ ID NO.3 in the sequence listing). The protein shown in SEQ ID NO.3 was named OsTML, and the gene encoding the protein shown in SEQ ID NO.3 was named OsTML.

[0075] Example 2: Obtaining and Identifying Transgenic Plants

[0076] I. Construction of Recombinant Expression Vectors

[0077] NCBI analysis revealed that OsTML lacks introns. Therefore, using genomic DNA from Ningjing 2 (from the germplasm resource bank of the Rice Research Institute of Nanjing Agricultural University) as a template, PCR amplification was performed using Primer 3 / 4 to obtain the full-length template sequence of the OsTML gene promoter and CDS. Using the full-length fragment amplified by Primer 3 / 4 as a template, PCR amplification was performed using Primer 5 / 6 to obtain the full-length OsTML gene promoter and CDS (SEQ ID NO. 1).

[0078] The OsTML gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0079] Primer3:

[0080] 5'ATAATTAAAAGTGGTGATGC 3';

[0081] Primer4:

[0082] 5'AACAACTACAATACAAAGAA3';

[0083] Primer5:

[0084] 5'CCGGCGCGCCAAGCTTCTGGGCGTTTCTCACTTGAT 3';

[0085] Primer 6:

[0086] 5'GAATTCCCGGGGATCCTTAGATGCACAGATAACTCC 3'.

[0087] Primers 3 and 4 are located 2 kb upstream of the gene shown in SEQ ID NO. 2. The amplified product is the promoter of this gene. PCR product 1 was recovered and purified. Primers 5 and 6 were then used to amplify the full-length CDS of this gene, and PCR product 2 was recovered and purified. The two PCR products were cloned into the vector pCAMBIA1390 using the INFUSION recombination kit (Takara, Japan). The INFUSION recombination reaction system (10 μL) consisted of: PCR product 1 1.0 μL, PCR product 2 1.0 μL, pCAMBIA1395 5.0 μL, 5× infusion buffer 2.0 μL, and infusion enzyme mix 1 μL. After brief centrifugation, the mixture was incubated at 37°C for 15 minutes, then at 50°C for 15 minutes. 2.5 μL of the reaction mixture was then used to transform *E. coli* DH5α competent cells (Tiangen, Beijing; CB101) using the heat shock method. All transformed cells were evenly spread on LB agar containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant expression vector containing the gene shown in SEQ ID NO.1 was obtained. pCAMBIA1390 containing OsTML was named pOsTML::OsTML. The OsTML gene fragment was inserted between the HindIII and BamHI restriction sites of the vector using the INFUSION recombination kit (Takara Corporation, Japan).

[0088] II. Obtaining Recombinant Agrobacterium

[0089] pOsTML::OsTML was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using an electroporation method to obtain a recombinant strain. The plasmid was extracted and identified by PCR and enzyme digestion. The recombinant strain that was correctly identified by PCR and enzyme digestion was named EH-pOsTML::OsTML.

[0090] Agrobacterium EHA105 strain was transformed using pCAMBIA1390 as a control vector, and the same method was used to obtain the control strain with empty vector.

[0091] III. Obtaining Transgenic Plants

[0092] The EH-pOsTML::OsTML strain and the control strain with empty vector were transformed into the rice endosperm mealy mutant Ostml, respectively. The specific methods were as follows:

[0093] (1) Incubate EH-pOsTML::OsTML (or control strain with empty vector) at 28℃ for 16 hours, collect the bacterial cells, and dilute them in N6 liquid medium (Sigma, C1416) to a concentration of OD600≈0.5 to obtain bacterial solution;

[0094] (2) Mix the Ostml rice mature embryo embryonic callus cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0095] (3) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (16 days).

[0096] (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0097] (5) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days.

[0098] (6) Select resistant callus and transfer it to differentiation medium for differentiation; obtain T0 generation positive plants that have differentiated into seedlings.

[0099] IV. Identification of Transgenic Plants

[0100] 1. PCR molecular identification

[0101] Genomic DNA was extracted from the T0 generation plants obtained in step 3, and amplified using Primer1 and Primer7 as primers, with the genomic DNA as a template.

[0102] PCR reaction system: DNA (20ng / μL) 2μL, Primer 5 (10pmol / μL) 2μL, Primer 6 (10pmol / μL) 2μL, 10x Buffer (MgCl2 free) 2μL, dNTP (10mM) 0.4μL, MgCl2 (25mM) 1.2μL, rTaq (5U / μL) 0.4μL, ddH2O 10μL, total volume 20μL.

[0103] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, 35 cycles; 72℃ for 10 min.

[0104] PCR products were separated using 8% non-denaturing PAGE gel and silver-stained. Transgenic positive plants were identified.

[0105] 2. Phenotypic identification

[0106] T0 generation pOsTML::OsTML positive plants, T0 generation empty vector control plants, mutant Ostml, and Ningjing 2 were planted in a transgenic field at the Tuqiao Rice Breeding Base of Nanjing Agricultural University. After seed maturity, seeds from each material were harvested, and transparent seeds were observed in the seeds of the pOsTML::OsTML plants. Figure 5 Therefore, it is proven that the phenotypic variation of the Ostml mutant is caused by the mutation of OsTML. pOsTML::OsTML can restore the powdery endosperm of the Ostml mutant to a transparent endosperm similar to that of the wild type.

Claims

1. The application of the gene shown in SEQ ID NO.1 or SEQ ID NO.2, a recombinant expression vector, expression cassette or recombinant bacteria containing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 in the cultivation of rice with normal endosperm development, wherein the application is to transfer the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with the gene defect shown in SEQ ID NO.2 to obtain rice with normal endosperm development.

2. A method for cultivating transgenic rice with normal endosperm development, comprising introducing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with abnormal endosperm development that has a defect in the SEQ ID NO.2 gene, thereby obtaining transgenic rice with normal endosperm development.

3. The method according to claim 2, characterized in that, The method involves introducing the gene shown in SEQ ID NO.1 or SEQ ID NO.2 into rice with abnormal endosperm development using a recombinant expression vector.

Images