Application of CsKIC gene and the protein coded by the gene in regulating resistance to cucumber powdery mildew

CN117025632BActive Publication Date: 2026-08-18HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311083682.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-25
Publication Date
2026-08-18
Estimated Expiration
2043-08-25

AI Technical Summary

Technical Problem

有关KIC基因的报道,多见于与Ca+结合蛋白,参与植物细胞是生长发育以及毛状体的形成,少数报道其与MLO基因互作,具有抗菊花黑斑病作用,但关于KIC基因在白粉病上的抗性作用,还未见任何报道

Benefits of technology

[0018]Powdery mildew severely impacts the quality and yield of cucumbers, causing increasingly serious damage. Breeding resistant varieties has become the preferred method for controlling powdery mildew. Targeted knockout of recessive powdery mildew resistance genes using gene editing and transgenic methods can significantly shorten the breeding cycle. However, few powdery mildew resistance genes have been reported and applied in cucumbers. This invention discovers a novel function of the CsKIC gene related to cucumber powdery mildew resistance, providing a new option and target for breeding cucumbers with powdery mildew resistance. This invention also provides a method for improving cucumber powdery mildew resistance using CGMMV viral vectors and VIGS gene silencing technology, laying the foundation for developing new cucumber germplasm resources. Next, the CsKIC gene can be knocked out using gene editing technology to obtain stably heritable cucumber germplasm resources with powdery mildew resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117025632B_ABST
    Figure CN117025632B_ABST
Patent Text Reader

Abstract

The application discloses application of a CsKIC gene and a protein coded by the same in regulation of resistance to cucumber powdery mildew, wherein a nucleotide sequence of the CsKIC gene is shown as SEQ ID NO:1, and an amino acid sequence of the protein is shown as SEQ ID NO:2. By using a VIGS gene silencing technology, it is found that silencing of the CsKIC gene increases the disease resistance of cucumber to powdery mildew, thereby verifying that the CsKIC gene is a recessive disease resistance gene related to cucumber powdery mildew. The application discovers a new function of the CsKIC gene in relation to the resistance of cucumber to powdery mildew, provides a new selection and target for breeding of cucumber powdery mildew resistance, and lays a foundation for development of new cucumber germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving the application of a recessive disease resistance gene related to cucumber powdery mildew—the CsKIC gene. Background Technology

[0002] Cucumber is one of my country's major vegetable crops, and powdery mildew is one of its most serious diseases, causing significant losses every year. As a fungal disease, the pathogen is an obligate parasite that overwinters in the soil with diseased plant debris. Powdery mildew easily breaks out on a large scale in hot and humid environments, often infecting greenhouse-grown cucumbers. Currently, the control of cucumber powdery mildew mainly relies on chemical and physical methods, making the breeding of powdery mildew-resistant germplasm extremely important. At present, the breeding of powdery mildew-resistant germplasm mainly focuses on conventional breeding methods; molecular marker-assisted breeding and the creation of powdery mildew-resistant germplasm using gene editing are still in their early stages. Although Hao Junjie et al. (2018) used SSR markers to locate the powdery mildew resistance gene to chromosome 5, 15-25 Mb, they did not report the specific resistance gene. Yang et al. (2021) obtained powdery mildew-resistant germplasm by knocking out the CsMLO1, CsMLO8, and CsMLO11 genes through gene editing. However, the MLO gene family is large, and knocking out only one MLO gene is insufficient to obtain powdery mildew-resistant cucumber germplasm. Therefore, discovering new powdery mildew resistance genes is of great significance for breeding cucumbers with powdery mildew resistance.

[0003] Currently, there are few reports on the KIC gene. Its initial discovery was as a Ca+-binding protein interacting with kinase-like calmodulin-binding protein (KCBP) to jointly regulate cell division and trichome morphogenesis (Vaka S. Reddy et al., 2004). Subsequent studies have found that the KIC gene also interacts with calmodulin (CaM) to participate in trichome formation (Stephanie Dobney et al., 2004). Xin Jingjing et al. (2020) discovered through yeast two-hybridization that the CmKIC gene interacts with the chrysanthemum black spot resistance gene CmMLO17, and verified the role of the CmKIC gene in chrysanthemum black spot resistance through genetic transformation and gene silencing technology. Reports on the KIC gene mostly focus on its interaction with Ca+-binding proteins, participating in plant cell growth and development and trichome formation. A few reports indicate its interaction with the MLO gene, demonstrating resistance to chrysanthemum black spot. However, no reports have been found regarding the KIC gene's resistance to powdery mildew.

[0004] VIGS (Virus-Induced Gene Silencing) technology is a technique that uses plant viruses as vectors, inoculated into the genome of plant cells, causing the host cell's genes to be unable to be transcribed normally, thereby resulting in gene silencing (Mlotshwa S et al., 2008). The silencing efficiency of VIGS and the degree of homology of the inserted fragment are closely related to the target gene and the viral vector. The inserted fragment is generally selected to be 200-350 bp, and the viral vector should be a highly adaptable, weakly virulent, and non-transmissible strain (Zhang Liying, 2022). In the past few decades, dozens of VIGS viral vectors have been developed, but few have been reported to be applicable to cucurbits, such as Apple Latent Spherical Virus (ALSV) (Igarashi A et al., 2009), Tobacco Ringspot Virus (TRSV) (Zhao F et al., 2016), Tobacco Bolling Virus (TRV) (Liao JJ et al., 2019), and Cucumber Green Mottle Mosaic Virus (CGMMV) (Mei Liu et al., 2020). The CGMMV viral vector is an important pathogen that infects cucurbitaceous plants under natural conditions and can be used for gene silencing in many cucurbitaceous crops. This invention utilizes the CGMMV vector and optimizes VIGS technology to silence the CsKIC gene, thereby obtaining cucumber plants resistant to powdery mildew. This has great application potential in developing new cucumber germplasm resources resistant to powdery mildew. Summary of the Invention

[0005] The first objective of this invention is to provide the application of the CsKIC gene and its encoded protein in regulating cucumber powdery mildew resistance.

[0006] To achieve the above objectives, the applicant used VIGS gene silencing technology to silence the cucumber CsKIC gene and found that silencing the CsKIC gene increased the cucumber's resistance to powdery mildew, thus verifying that the CsKIC gene is a recessive resistance gene associated with cucumber powdery mildew.

[0007] The CsKIC gene, derived from Cucurbitaceae, Cucumis genus, and Cucumber (Cucumis sativus L.), has a nucleotide sequence shown in SEQ ID NO: 1, which is the open reading frame (ORF) of the CsKIC gene, consisting of 378 bases. The protein encoded by this gene has an amino acid sequence shown in SEQ ID NO: 2, consisting of 125 amino acid residues.

[0008] A second objective of this invention is to provide a VIGS vector for silencing the CsKIC gene and its encoded protein, an engineered bacterium containing the VIGS vector, and the application of the transgenic Agrobacterium containing the VIGS vector in improving cucumber powdery mildew resistance. Specifically, the VIGS vector is formed by inserting a CsKIC gene silencing sequence into the multiple cloning site of a PV190 vector, particularly inserting the nucleotide sequence from position 1 to 300 of the CsKIC gene from the 5′ end as shown in SEQ ID NO: 1. The engineered bacterium is *Escherichia coli* DH5α, and the Agrobacterium is *Agrobacterium tumefaciens* GV3101.

[0009] A third objective of this invention is to provide a method for improving resistance to powdery mildew in cucumbers, comprising the following steps:

[0010] 1) Extract RNA from cucumber, reverse transcribe it into cDNA, and use the cDNA as a template to design PCR primers to amplify the silenced CsKIC gene sequence;

[0011] 2) The amplification product was purified and recovered, digested with enzymes and ligated into the VIGS viral vector, transformed into engineered bacteria, and the VIGS vector expressing the CsKIC gene silencing sequence was obtained.

[0012] 3) Agrobacterium was transformed using the VIGS vector, and cucumber seeds were infected with the bacterial solution to obtain plants with silenced CsKIC gene and its encoded protein.

[0013] The CsKIC gene silencing sequence is the nucleotide sequence from position 1 to 300 at the 5′ end of the sequence shown in SEQ ID NO: 1.

[0014] Furthermore, the forward primer sequence of the PCR primer is shown in SEQ ID NO: 3, and the reverse primer sequence is shown in SEQ ID NO: 4.

[0015] The VIGS viral vector is the PV190 plasmid.

[0016] Among them, when using bacterial solution to infect cucumber seeds, the OD value of the bacterial solution was 0.8 and the ultrasonic time was 30s, at which point the infection efficiency was relatively high.

[0017] The beneficial effects of this invention are:

[0018] Powdery mildew severely impacts the quality and yield of cucumbers, causing increasingly serious damage. Breeding resistant varieties has become the preferred method for controlling powdery mildew. Targeted knockout of recessive powdery mildew resistance genes using gene editing and transgenic methods can significantly shorten the breeding cycle. However, few powdery mildew resistance genes have been reported and applied in cucumbers. This invention discovers a novel function of the CsKIC gene related to cucumber powdery mildew resistance, providing a new option and target for breeding cucumbers with powdery mildew resistance. This invention also provides a method for improving cucumber powdery mildew resistance using CGMMV viral vectors and VIGS gene silencing technology, laying the foundation for developing new cucumber germplasm resources. Next, the CsKIC gene can be knocked out using gene editing technology to obtain stably heritable cucumber germplasm resources with powdery mildew resistance. Attached Figure Description

[0019] Figure 1 PV190-CsKIC carrier spectrum.

[0020] Figure 2 Results of optimized bacterial concentration and sonication time for infection.

[0021] Figure 3 qRT-PCR quantification results.

[0022] Figure 4 The leaf susceptibility of PV190 empty vector plants and CsKIC gene silent plants under natural powdery mildew incidence conditions in the field.

[0023] Figure 5 After powdery mildew was observed in the field, the disease severity was assessed every five days for both PV190 empty vector plants and CsKIC gene-silenced plants. The powdery mildew disease index of PV190 empty vector plants and CsKIC gene-silenced plants was calculated, showing that silencing the CsKIC gene increased the resistance of cucumbers to powdery mildew. Detailed Implementation

[0024] The present invention will be further described in detail below with reference to specific embodiments.

[0025] The CsKIC gene is based on the transcriptome analysis results of our group's cucumber MLO gene knockout experiment. Through transcriptome enrichment analysis, as the disease resistance increases, the gene GO with increased expression level is enriched with the calcium ion binding entry (as shown in Table 1).

[0026] Table 1. Key genes for calcium signaling in the plant-disease interaction pathway and calcium ion binding entries.

[0027] CsaV3_3G040820 EF hand calcium-binding family protein CsCML23 CsaV3_3G044850 Calcium-binding EF-hand CsCML25 CsaV3_4G011890 Calcium-dependent protein kinase CsCPK11 CsaV3_4G027870 EF hand calcium-binding family protein CsCML28 CsaV3_3G046100 Calcium-dependent protein kinase CsCPK8 CsaV3_6G008810 Calcium-binding protein like CsKIC

[0028] Key materials and their descriptions:

[0029] PV190 plasmid: donated by Researcher Gu Qinsheng of Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences. This plasmid was published in the journal Plant Methods in 2020. Paper link: https: / / doi.org / 10.1186 / s13007-020-0560-3.

[0030] Both Escherichia coli competent cells DH5α and Agrobacterium tumefaciens GV3101 were purchased from Beijing Qingke Biotechnology Co., Ltd.

[0031] The reverse transcription kit HiScript IIQ RT SuperMix for qPCR (+gDNA wiper); PCR amplification enzyme 2×Taq Master Mix; and the fluorescent quantitative dye ChamQ Universal SYBR qPCR Master Mix were all purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0032] All amplification primers used were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0033] Other materials not mentioned in this article are all conventional materials in this field.

[0034] Table 2. List of English Abbreviations

[0035]

[0036]

[0037] Example 1: Obtaining CsKIC gene-silenced plants

[0038] I. Construction of VIGS gene silencing vector and Agrobacterium-mediated transformation

[0039] The silencing sequence of the cucumber CsKIC gene was designed using the website https: / / vigs.solgenomics.net / . Primers required for constructing the vector were designed and synthesized based on the silencing sequence. The silencing sequence of the CsKIC gene was amplified by PCR using the primers, and the amplification product was recovered, digested, and ligated with enzymes to insert the CsKIC silencing sequence into the multiple cloning site of the vector plasmid, thus constructing the VIGS gene silencing vector.

[0040] 1. Design of CsKIC gene silencing sequences

[0041] Enter the CsKIC gene sequence on the website https: / / vigs.solgenomics.net / and select the Cucurbitaceae family, Cucumis genus genome as the reference genome to design the CsKIC silencing sequence. The CsKIC silencing sequence is as follows:

[0042] ATGGATCAAAATCATAATACCTCAGGTAGAGTACTGGATGAAGGGTATGAAGACTTGTTGCCGGTGATGGCGCAGAAGCTCGACGTGGAGGTGTTTGGTGGCCGAGCTTTGCAGCGGATTTCGGCTGCTTGCCGATGCAACAAAAGGGCTG ATAACTGCCGAGAGTTTACGGCGGAATTCGGCACTTTTGGGAATGGAAGGGATGAACGAGAACGAAGCGGAGTCGATGGTGAGGGAAGGAGATCTTGATGGGGATGGAGCTCTTAATGAGATGGAATTTTGCATTTTAATGGTGAGACTT

[0043] 2. Primer design, RNA extraction, reverse transcription, and PCR amplification.

[0044] (1) Primers were designed based on the CsKIC silencing sequence. The primer sequences are as follows: (5'-3')

[0045] CsKIC-F:ATGGATCAAAATCATAATACCTCAGGTAG

[0046] CsKIC-R:AAGTCTCACCATTAAAATGCAAAATTCCATC

[0047] (2) Extracting RNA from cucumber, the steps are as follows:

[0048] a. First, fold the small foil bags and label them. Try not to let liquid nitrogen enter the small foil bags. If the foil bags are removed from the liquid nitrogen, they will expand and may break.

[0049] b. Prepare liquid nitrogen, tweezers, and scissors. Use the scissors to cut off the leaf, and use the tweezers to place it into a small foil bag and immediately put it into the liquid nitrogen, ensuring that the small bag and liquid nitrogen are in full contact.

[0050] c. Place the sample in a liquid nitrogen box and bring it to a -80°C freezer. Use tweezers to put the sample into a bag and quickly place it into the -80°C freezer.

[0051] d. Spray the desktop, lab equipment, and gloves with an RNase remover. Wear a mask and minimize talking.

[0052] e. Scoop a spoonful of liquid nitrogen into the mortar to pre-cool (to ensure the sample is at a low temperature when it enters the mortar, preventing the sample from freezing with water), use tweezers to remove the sample from the foil pouch, pour the sample into the mortar, and grind the sample into powder using a grinding stick, ensuring that there is liquid nitrogen in the mortar during the grinding process.

[0053] f. Place the test tube in liquid nitrogen for pre-cooling, insert the spatula into the liquid nitrogen for pre-cooling, and use the spatula to put the ground sample into the test tube. Extract RNA from one tube and store it in the other. During this process, ensure the mortar is kept at a low temperature. Add liquid nitrogen from time to time as needed, and then put the test tube back into the liquid nitrogen.

[0054] g. Replace the mortar and pestle, clean the residue from the spatula, spray with RNase remover, and continue the above steps until the sample is ground or the grinding process is terminated. The ground sample can be stored in a -80°C freezer. If there is not enough time, the grinding process can be repeated multiple times.

[0055] h. Sample storage: Test tubes that have been pre-cooled should not be left at room temperature with the lid on, as they will crack. Therefore, they should be placed in a -80°C freezer quickly and not left at room temperature for too long.

[0056] i. During the grinding process, gloves may come into contact with powder from the ground sample. If this is found, gloves should be replaced immediately and an RNase remover should be sprayed on.

[0057] j. When grinding samples, it is essential to ensure that the mortar is kept at a low temperature, the time without liquid nitrogen should not be too long, and the test tubes for storing samples should not be filled too full to prevent insufficient freezing of the samples. Grinded samples should be put back into the container using a spatula as much as possible.

[0058] k. Transfer the powdered sample to a centrifuge tube, adding 1 ml of TransZol for every 50-100 mg of tissue. Homogenize using a homogenizer, repeatedly pipetting and aspirating. Shake at room temperature for 5 min.

[0059] 1. For every 1 ml of TransZol used, add 0.2 ml of RNA Extraction Agent, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes.

[0060] Centrifuge at 10,000 rpm for 15 minutes at 2-8°C. At this point, the sample separates into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). RNA is mainly in the aqueous phase, which accounts for approximately 60% of the volume of the TransZol reagent used.

[0061] n. Transfer the colorless aqueous phase to a new centrifuge tube, add 0.5 ml of isopropanol for every 1 ml of TransZol used, invert to mix, and incubate at room temperature for 10 min.

[0062] Centrifuge at 10000 rpm for 10 min at 2-8℃, remove the supernatant, and a gel-like precipitate will form on the side and bottom of the tube.

[0063] p. Add 1 ml of 75% ethanol (prepared with DEPC-treated water) and vortex vigorously (add at least 1 ml of 75% ethanol for every 1 ml of TransZol used).

[0064] Centrifuge at 7500 rpm for 5 min at 2-8℃.

[0065] r. Discard the supernatant (to better control the salt ion content in the RNA, ethanol should be removed as completely as possible), and air-dry the precipitate at room temperature (about 5 minutes).

[0066] s. Dissolve the precipitate in 50-100 μl of RNA lysate.

[0067] Incubate at 55-60℃ for 10 minutes, then store the sample at -80℃ for long-term use.

[0068] (3) Reverse transcription

[0069] a. Prepare the reverse transcription system in RNAse-free centrifuge tubes. The reaction system is shown in Table 3.

[0070] Table 3 Reverse Transcription System

[0071] <![CDATA[RNAse free ddH2O]]> 10 4×gDNA wiper Mix 4 Template RNA 2 5×HiseripⅡqRT super MixⅡ 4

[0072] b. Mix RNAse-free ddH2O, 4×gDNA wiper Mix, and template RNA, and incubate at 42°C for 2 min (in a PCR instrument).

[0073] c. Add 5×HiscripⅡqRT super MixⅡ to the previous reaction to perform reverse transcription. The reaction procedure is shown in Table 4.

[0074] Table 4 Reverse Transcription Procedure

[0075] 25 1 10 50 1 30 85 1 5

[0076] (4) PCR amplification

[0077] Using the cucumber cDNA obtained by reverse transcription in (3) above as a template, the fragment length was amplified using the primers in (1), and the fragment length was approximately 300 bp.

[0078] ①The PCR reaction system and conditions are shown in Table 5.

[0079] Table 5 PCR Reaction System and Conditions

[0080]

[0081] ②Agarose gel electrophoresis detection:

[0082] Weigh 0.5g of agarose into an Erlenmeyer flask, add 25mL of 1×TAE solution, and microwave until boiling until the agarose is completely dissolved. Place the inner tank horizontally and position the comb. Pour the agarose gel solution, cooled to approximately 65℃, onto the glass plate of the inner tank. Let it stand at room temperature until the gel is completely solidified. Gently pull the comb vertically to prepare a 2% agarose gel. Place the gel and inner tank into an electrophoresis tank. Using a 10μL micropipette, add DL 2000 DNA Marker (as a control) and the PCR amplification products to the small grooves of the gel plate. After adding the samples, perform electrophoresis at 100V. After electrophoresis, remove the gel and stain it with fluorescent nucleic acid gel staining solution for approximately 20 minutes. Develop the gel using a gel imaging system under UV light. A band of approximately 300bp should be observed, indicating successful amplification of the target fragment.

[0083] ③Purification and recovery of PCR products:

[0084] Purification and recovery were performed using a PCR product purification kit (QIAGEN, QIAquick PCR Purification Kit (50), 28104). The procedure was as follows: PCR product was added to a 2mL centrifuge tube, followed by 5 volumes of Buffer PB. The mixture was thoroughly mixed. The adsorption column was placed in a 2mL centrifuge tube, and the mixed solution from the previous step was added to the adsorption column. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was discarded. The adsorption column was returned to the 2mL centrifuge tube, and 750μL of Buffer PE was added to the column. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was discarded. The adsorption column was returned to the 2mL centrifuge tube, and centrifuged again at 12000 rpm for 1 min, and the filtrate was discarded. The adsorption column was placed in a clean 1.5mL centrifuge tube and allowed to stand for 5 min. 30μL of Buffer EB (heated to 65℃ to improve elution efficiency) was added to the center of the adsorption column, and the column was allowed to stand at room temperature for 1 min, followed by centrifugation at 12000 rpm for 1 min. The recovered PCR product was obtained. The concentration of the recovered fragment liquid was 113 ng / μL.

[0085] 3. Enzyme digestion and ligation of amplification products

[0086] After obtaining the PCR amplification products, an enzyme digestion and ligation system was established as shown in Table 6 below.

[0087] Table 6 Enzyme digestion and ligation system and conditions

[0088]

[0089] 4. Transformation of Escherichia coli

[0090] In a clean bench, add 5 μL of the ligation system to 100 μL of competent E. coli DH5α cells and gently tap to mix. Incubate on ice for 5 min, then heat shock in a 42℃ water bath for 90 s, followed immediately by an ice bath for 3 min. Add 1 mL of LB solution and mix well; incubate at 37℃ and 220 rpm for 30 min. Spread approximately 200 μL of transformant bacteria evenly on a solid LB+Kan plate. Seal the plate and incubate upside down at 37℃ for 1 day. After single colonies have grown, pick a single colony and inoculate it into LB+Kan liquid medium, incubating at 37℃ and 220 rpm for 30 min. Send the single colony culture to Qingke Biotechnology Co., Ltd. for sequencing and perform sequence alignment using Geneious software. Correct alignment indicates successful construction of the VIGS silencing vector. Figure 1 The plasmid map of the constructed PV190-CsKIC vector is shown.

[0091] 5. Transformation of Agrobacterium

[0092] The correctly sequenced expression vector plasmid returned by Qingke Company was transformed into Agrobacterium GV3101 cells to prepare for subsequent cucumber VIGS infection experiments. In a clean bench, 2 μL of plasmid was added to 100 μL of competent Agrobacterium GV3101 cells and gently tumbled to mix. After mixing, the cells were incubated on ice for 5 min, frozen in liquid nitrogen for 1 min, and then quickly placed in a 37°C water bath for 5 min. 800 μL of LB medium was added, and the cells were incubated at 28°C and 220 rpm for 2 h on a shaker. The bacterial culture was concentrated by centrifugation at 12000 rpm for 1 min, resuspended in 200 μL of LB liquid medium, mixed, and evenly spread on LB+KAN solid medium. The culture was then incubated in the dark at 28°C for 2 days. Single Agrobacterium colonies were picked and cultured in LB+KAN+RIF liquid medium for 12 h. The bacterial culture was then stored at -80°C for later use.

[0093] II. VIGS Infection Test

[0094] 1. Soaking seeds: Soak seeds in 55℃ warm water for 15-30 minutes, and measure the temperature with a thermometer.

[0095] 2. Peeling: Keep the seeds moist throughout the peeling process. Place the peeled seeds in a dish with a damp gauze covering both the top and bottom, and incubate in a 28℃ incubator for 24 hours to promote germination.

[0096] 3. Shaking: Add bacterial culture and culture medium to the conical flask. Bacterial culture: culture medium = 1:1000. Culture medium: LB + Kan + Rif; Kan, Rif: LB = 1:1000. Shake on a shaker for about 24 hours.

[0097] 4. At the same time the next day, cut a slit in the cotyledon of the seed (which has already germinated).

[0098] 5. Infection

[0099] (1) Transfer the shaken bacteria to a large centrifuge tube (50ml or 15ml), centrifuge at 6000rpm for 8-10min and discard the supernatant. Prepare the MAA resuspension as shown in Table 7.

[0100] Table 7. Preparation method of MAA resuspension

[0101] water 1000 <![CDATA[MgCl2]]> 1M 10 MES 0.5M 20 AS 20mg / ml 1

[0102] (2) Pour a little of the prepared MMA solution into the bacteria, shake it by hand, and use MMA as a control to adjust the OD value to 0.8.

[0103] (3) Place the cut seeds into the bacterial solution and sonicate them. Set the ultrasonic power to 40W and the time to 30s. Vacuum at -10kPa for 5min.

[0104] (4) Transfer the seeds to vermiculite containing bacterial solution, without watering the vermiculite, and water it entirely with bacterial solution. Incubate in a 23℃ incubator for about 4 days.

[0105] Different gradients were set for bacterial suspension concentration OD value and ultrasonic time. The optimal infection conditions were screened by detecting the average whitening efficiency (average whitening efficiency (%) = leaf whitening area / total leaf area * 100%). The results showed that a bacterial suspension concentration OD value of 0.8 and an ultrasonic time of 30 seconds yielded the best results. Figure 2 ).

[0106] 6. Transplanting

[0107] Once the seeds have sprouted and grown to about 3-5cm, transplant the seedlings into 50-cell trays. Move them from the incubator to an artificial climate chamber with low light (turn off one or two light bulbs) and cover to maintain humidity. When they reach the stage of three leaves and one bud, transfer them to flowerpots and inoculate them with powdery mildew fungus, then observe their phenotype.

[0108] III. Detection of CsKIC expression level by qRT-PCR

[0109] 1. Extraction of RNA from cucumber tissue (the specific extraction steps are the same as those in Example 1).

[0110] 2. Reverse transcription (the specific steps are the same as those in Example 1).

[0111] 3. qRT-PCR

[0112] Geneious primers were designed for quantitative experiments on CsKIC. The GC content of these primers should be maintained between 40% and 60%. The designed primer sequences are as follows (5'-3'):

[0113] QF:GTGAGGGAAGGAGATCTTGATG

[0114] QR:CAAGAAGATTTACCTAGCTCTTCATC

[0115] Using the cDNA obtained from the above reverse transcription as a template, and QF and QR primers, qRT-PCR was performed. The qRT-PCR reaction system is shown in Table 8 below.

[0116] Table 8 qRT-PCR reaction system

[0117] ChamQ Universal SYBR qPCR Master Mix 5 Forward primer (10μM) 0.5 Reverse primer (10μM) 0.5 template cDNA 1 <![CDATA[ddH2O]]> 3

[0118] qRT-PCR results: see Figure 3 The expression level of CsKIC in gene-silenced plants was significantly lower than that in PV190 empty vector plants (plants obtained by infecting cucumber seeds with Agrobacterium containing PV190 empty vector) (P<0.05), indicating that CsKIC gene silencing was successful.

[0119] IV. Identification of powdery mildew resistance in plants with silenced CsKIC gene

[0120] To determine the powdery mildew resistance of gene-edited cucumbers, we randomly planted PV190 empty vector plants and CsKIC gene-silenced plants in a greenhouse. Under natural powdery mildew infection conditions in the field, we conducted a disease index survey on both types of plants. The specific details of the disease index survey are as follows: Four survey sites were randomly selected in the greenhouse, with 3 plants surveyed at each site, and 12 plants surveyed for both the empty vector and silent gene types. After the powdery mildew layer was observed, surveys were conducted every five days. Each time, three leaves from each of the upper, middle, and lower parts of the plant were collected for survey and the disease level was recorded. The disease level was classified into six levels (0, 1, 3, 5, 7, 9). Grade 0: Clean leaves, no lesions; Grade 1: A few small, indistinct powdery mildew spots, covering less than 5% of the leaf area; Grade 3: Thin powdery mildew layer, covering more than 5% and less than 30% of the leaf area; Grade 5: Thick powdery mildew layer, covering more than 30% and less than 50% of the leaf area; Grade 7: Thick powdery mildew layer, covering more than 50% and less than 70% of the leaf area; Grade 9: Thick powdery mildew layer, covering more than 70% and less than 90% of the leaf area. After investigating and recording the disease levels of the uninoculated and silent types, the disease index was calculated using the following formula: Disease Index = [Σ(Number of diseased leaves at each level × Representative value at each level) / Total number of leaves investigated × Highest representative value] × 100. It was found that as time progressed, powdery mildew in uninoculated plants in the field became increasingly severe, and the disease index gradually increased; while plants with the CsKIC gene silence showed almost no powdery mildew lesions, and the disease index remained at a low level. Figure 4 , Figure 5Silencing the CsKIC gene showed increased resistance of cucumbers to powdery mildew.

[0121] In summary, this invention has discovered a recessive resistance gene related to cucumber powdery mildew through VIGS gene silencing technology. Silencing the CsKIC gene significantly improves the powdery mildew resistance level of cucumber plants.

Claims

1. Used for silence CsKIC The application of the VIGS vector containing the gene and its encoded protein in improving cucumber powdery mildew resistance, wherein the nucleotide sequence of the CsKIC gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein is shown in SEQ ID NO:

2.

2. The application of transgenic Agrobacterium containing the VIGS vector of claim 1 in improving cucumber powdery mildew resistance.

3. A method for improving cucumber powdery mildew resistance, characterized in that... Includes the following steps: 1) Extract RNA from cucumber, reverse transcribe it into cDNA, and design PCR primers to amplify it using the cDNA as a template. CsKIC Gene silencing sequences; 2) The amplification product was purified and recovered, digested with enzymes, ligated into the VIGS viral vector, transformed into engineered bacteria, and expressed. CsKIC VIGS vector for gene silencing sequences; 3) Agrobacterium was transformed using VIGS vector, and cucumber seeds were infected with the bacterial solution to obtain... CsKIC Gene-silenced plants, The CsKIC The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. The method for improving cucumber powdery mildew resistance as described in claim 3, characterized in that: The CsKIC The gene silencing sequence is the sequence shown in SEQ ID NO: 1, from nucleotides 1 to 300 at the 5' end.

5. The method for improving cucumber powdery mildew resistance as described in claim 4, characterized in that: The forward primer sequence of the PCR primers is shown in SEQ ID NO: 3, and the reverse primer sequence is shown in SEQ ID NO:

4.

6. The method for improving cucumber powdery mildew resistance as described in claim 3, characterized in that: The VIGS viral vector is the PV190 plasmid.

7. The method for improving cucumber powdery mildew resistance as described in claim 3, characterized in that: The specific conditions for infection are: the bacterial solution OD value is 0.8 and the ultrasonic time is 30 s.