A recombinant adenovirus vaccine for varicella-zoster virus infection

Abstract

The present invention discloses a recombinant adenovirus vaccine for varicella-zoster virus infection, which contains a recombinant adenovirus named rAd26-gE-T-Foldon or rChAd63-gE-T-Foldon. Among them, rAd26-gE-T-Foldon contains the recombinant adenovirus vector pAd26-gE-T-Foldon; rChAd63-gE-T-Foldon contains the recombinant adenovirus vector pChAd63-gE-T-Foldon, wherein gE-T is a sequence encoding the gE protein and the varicella-zoster virus MHC-II restricted antigen epitope peptide T, and the varicella-zoster virus MHC-II restricted antigen epitope peptide T is selected from SEQ ID NO.1 to 13 and combinations thereof.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering. The invention discloses a recombinant adenovirus vaccine for varicella-zoster virus infection, wherein the vaccine comprises an MHC-II restricted antigen epitope peptide and gE. Background Art

[0002] Varicella zoster virus (VZV) belongs to the alpha subfamily of human herpesvirus, also known as human herpes virus types 3 (HHV-3). It is a double-stranded DNA virus and is the pathogen of varicella and herpes zoster (HZ). The first infection with VZV usually occurs in early childhood, causing chickenpox, which is highly contagious. Chickenpox rarely develops into a serious condition and eventually develops into a self-limiting disease. After the initial infection with VZV, the virus can remain dormant in the host's neuronal cells for life. As the body's immunity decreases with age, the virus reactivates and causes herpes zoster (HZ) in adulthood. The symptoms of herpes zoster are body aches, and severe cases may cause burning pain or electric shock-like pain, which is called postherpetic neuralgia (PHN).

[0003] Varicella zoster virus (VZV) is an enveloped virus, and the envelope contains a variety of glycoproteins, such as gE, gI, gB, gH, gC, etc. These glycoproteins play an important role in virus maturation and packaging. Among them, gE protein is essential for viral replication and is the most abundant glycoprotein on infected cells and viral envelopes. gE protein is the most important glycoprotein recognized by the host immune system and can induce cellular immunity and humoral immunity. gE protein has both T cell and B cell epitopes. Research on VZV antigens mainly focuses on VZV gE protein. Wild-type gE protein is generally 623 amino acids, including a hydrophilic extracellular region (including a signal peptide), a transmembrane hydrophobic region, and an intracellular region. The three antigenic determinants of VZV gE are all distributed in the extracellular region, and two of the antigenic determinant coding regions, e1 and c1, are highly conserved.

[0004] Currently, there are only two marketed herpes zoster vaccines, the live attenuated varicella zoster virus vaccine (Zostavax) from Merck & Co., Inc. and the recombinant subunit herpes zoster vaccine (Shingrix) from GlaxoSmithKline plc. The virus strain contained in Merck & Co., Inc.'s live attenuated varicella zoster virus vaccine is the OKA attenuated strain. Currently, the live attenuated varicella zoster virus vaccine has been approved for people aged 50 and above in many countries. The live attenuated vaccine contains live viruses with relatively weak pathogenicity. Therefore, there is a risk that the vaccinated individuals may develop herpes zoster due to vaccination, and the live attenuated vaccine is restricted for some immunocompromised populations. The antigen of GlaxoSmithKline plc's recombinant subunit herpes zoster vaccine is the extracellular region of VZV gE, and it is added with the AS01B adjuvant. It has been proven to be effective in preventing herpes zoster and its complications, and its immune effect is also superior to that of the live attenuated varicella zoster virus vaccine. Some studies have shown that the immune effect of the two-dose adjuvant immunization group with a two-month interval of GlaxoSmithKline plc's recombinant subunit herpes zoster vaccine is better than that of the single-dose immunization group or the two-dose non-adjuvant immunization group. The number of gE-specific CD4+ T cells in the former group is more than three times that of the latter two groups. This indicates that the immune dose has no significant difference in enhancing cellular immunity, and at the same time, it also reflects that the adjuvant plays an important role in the immune effect. Recombinant proteins need to be able to stimulate the body to produce higher cellular immunity and humoral immunity under a well-performing adjuvant system.

[0005] Cellular immunity plays a very crucial role in the body's resistance to varicella-zoster virus infection. In particular, the CD4+ T cell immune response plays an important role in virus immune prevention. In order to enhance the CD4+ T cell immune response of the body against varicella-zoster virus, the MHC II-restricted antigenic epitope peptides of varicella-zoster virus glycoproteins can be purposefully screened. The MHC II-restricted antigenic epitope peptides can stimulate the further differentiation of CD4+ T cells, thereby regulating the immune response and clearing the pathogens invading the body.

[0006] In vaccine research, adenovirus vectors have clear genetic information, are easy to operate, and can insert large fragments of foreign genes; they can effectively proliferate with high virus titers; they can induce a strong humoral and cellular immune response in the body; at the same time, adenovirus vectors also have an adjuvant effect, thus stimulating a stronger immune response in the body. Replication-deficient adenoviruses can only replicate in specific cell lines and have good safety, and have been used in the research and development of a variety of vaccines. Currently, the most thoroughly studied and widely used is human adenovirus type 5. However, the natural infection rate of human adenovirus type 5 in the population is relatively high, and innate immunity limits its further application.

[0007] Therefore, rare human adenovirus serotypes and non-primate serotype adenoviruses have become another breakthrough in vaccine development. Currently, recombinant adenovirus vaccines based on human Ad26 and chimpanzee adenovirus (ChAd) have been successively launched, and single-dose immunization can achieve good immune effects. This further demonstrates the safety and feasibility of using rare human serotypes and non-human primate adenovirus vectors for vaccine research.

[0008] By constructing a varicella-zoster virus MHC-II restricted antigen epitope peptide and its glycoprotein integrated vaccine, a higher CD4+ T cell immune response can be achieved, broadening the research ideas for varicella-zoster virus vaccine development. We selected human rare serotype adenovirus type 26 and chimpanzee adenovirus type 63 as vectors, and modified these two adenoviruses (rAd26 and rChAd63) to construct replication-defective recombinant adenoviruses that can express varicella-zoster virus glycoprotein E (gE) and MHC II restricted antigen epitope peptides, further improving safety for the prevention of varicella-zoster virus infection. Summary of the Invention

[0009] The object of the present invention is to provide varicella-zoster virus MHC-II restricted antigen epitope peptides and their application in vaccine preparation. To achieve the above object of the invention, the present invention provides the following technical solutions:

[0010] A recombinant adenovirus vaccine containing recombinant adenoviruses named rAd26-gE-T-Foldon and / or rChAd63-gE-T-Foldon, wherein rAd26-gE-T-Foldon contains the recombinant adenovirus vector pAd26-gE-T-Foldonr; rChAd63-gE-T-Foldon contains the recombinant adenovirus vector pChAd63-gE-T-Foldon.

[0011] In one embodiment, gE-T is the amino acid sequence encoding the gE protein and the varicella-zoster virus MHC-II restricted antigen epitope peptide T, wherein the varicella-zoster virus MHC-II restricted antigen epitope peptide T is selected from SEQ ID NO.1 to 13 and their combinations.

[0012] In one embodiment, the gE is tPA-gE with the sequence shown in SEQ ID NO.14, the T is the antigen complex T with the sequences shown in SEQ ID NO.15 to 20, and the antigen complex T is preferably SEQ ID NO.20. The Foldon has the sequence shown in SEQ ID NO.21, and the sequence encoded by the recombinant adenovirus includes the sequence shown in SEQ ID NO.22.

[0013] In one embodiment, the recombinant adenovirus vector is obtained by integrating the plasmid pcDNA3.1-gE-T-Foldon with the backbone plasmids by homologous recombination method, and the backbone plasmids are pAd26 and pChAd63.

[0014] In one embodiment, the amino acid sequences encoding the MHC-II restricted antigen epitope peptides of varicella-zoster virus and the gE protein are linked by a linker, and the linker is selected from: a rigid linker, a flexible linker, an IRES linker peptide, a 2A linker peptide and other forms of linkers.

[0015] A plasmid, which is pcDNA3.1-gE-T-Foldon.

[0016] A recombinant adenovirus vector, selected from: pAd26-gE-T-Foldon or pChAd63-gE-T-Foldon.

[0017] A recombinant adenovirus expression system, selected from: a eukaryotic expression system, a yeast expression system, an Escherichia coli expression system and an insect cell expression system.

[0018] In one embodiment, the cell is HEK293 cell.

[0019] The present invention further provides a varicella-zoster virus (OKA strain) MHC-II restricted antigen epitope peptide, and the amino acid sequence of the antigen epitope peptide is selected from SEQ ID NO.1 to 13 or a combination thereof. Preferably, the antigen epitope peptide is selected from T1, T2, T3, T4, T5, T6, and the amino acid sequences correspond to:

[0020]

[0021]

[0022] A gE-T polypeptide, selected from gE-T1, gE-T2, gE-T3, gE-T4, gE-T5, gE-T6, and the corresponding amino acid sequences are as follows:

[0023]

[0024] In one embodiment, it includes a method for preparing the recombinant adenovirus vaccine described in the present invention:

[0025] (1) Synthesize the plasmid pcDNA3.1-gE-T-Foldon that can express the gE-T-Foldon amino acid sequence;

[0026] (2) Integrate the plasmid described in step (1) with the backbone plasmid by homologous recombination to obtain the recombinant adenovirus vector pAd26-gE-T-Foldon or pChAd63-gE-T-Foldon;

[0027] (3) Linearize the recombinant adenovirus vector described in step (2) by Pac I digestion to obtain a linearized plasmid, and transfect the linearized plasmid into packaging cells such as HEK293 cells;

[0028] (4) Culture the cells described in step (3);

[0029] (5) Harvest the replication-defective recombinant adenovirus rAd26-gE-T-Foldon or rChAd63-gE-T-Foldon released from the cells described in step (4).

[0030] The present invention further includes preparing the above-mentioned recombinant adenovirus rAd26-gE-T-Foldon or rChAd63-gE-T-Foldon into a vaccine preparation, and the vaccine preparation is an injection, and necessary vaccine carriers or vaccine adjuvants can be added as needed.

[0031] The present invention screens MHC-II restricted antigenic epitope peptides for 8 glycoproteins of varicella-zoster virus, and randomly combines the epitope peptides. The combined epitope peptide complex is called: T, which is linked to the modified gE fusion protein through a linker and is called: gE-T. The antigenicity is scored using the VaxiJen software, and the epitope peptide complex with a higher score is finally added with a Foldon sequence at the C-terminus of its combined fragment, so that the antigen complex is expressed in the form of a trimer and is called: gE-T-Foldon.

[0032] The present invention provides the plasmid pcDNA3.1-gE-T-Foldon, which contains the optimized designed amino acid sequences encoding the MHC-II restricted antigenic epitope peptides of varicella-zoster virus and the gE protein. The recombinant adenovirus expression vector is obtained by integrating the plasmid pcDNA3.1-gE-T-Foldon with the backbone plasmid by homologous recombination, and the backbone plasmid is pAd26 and pChAd63.

[0033] The present invention provides an amino acid sequence of a varicella-zoster virus MHC-II restricted antigenic epitope peptide and a gE protein, a recombinant adenovirus vector, and expresses the protein shown in SEQ ID NO. 22.

[0034] The recombinant adenovirus of the present invention is a replication-defective recombinant adenovirus, which is prepared from the above-mentioned recombinant adenovirus vector, and the replication-defective recombinant adenovirus is rAd26-gE-T-Foldon and rChAd63-gE-T-Foldon.

[0035] The present invention provides a vaccine against varicella-zoster virus, and its active ingredient is the above-mentioned replication-defective recombinant adenovirus.

[0036] The present invention provides an amino acid sequence of a varicella-zoster virus MHC-II restricted antigenic epitope peptide and a gE protein, a recombinant adenovirus vector containing the amino acid sequence, a recombinant adenovirus, and a construction method. The obtained replication-defective recombinant adenovirus can infect eukaryotic cells, thereby achieving the purpose of expressing the varicella-zoster virus MHC-II restricted antigenic epitope peptide and the gE protein in eukaryotic cells, laying a good foundation for further research on varicella-zoster virus vaccines.

[0037] The following are further explanations and descriptions of the terms appearing in the present invention:

[0038] Adenovirus: A DNA virus with a diameter of 70-90 nm, which is icosahedral and non-enveloped, and exists in the eyes, upper respiratory tract, digestive tract, etc. of humans and other mammals and birds.

[0039] Recombinant adenovirus: A replication-defective adenovirus, an adenovirus that can only replicate in a specific cell line, and an adenovirus that only infects but does not replicate in the human body.

[0040] Adenovirus vaccine: A vaccine prepared by cloning a foreign gene into an adenovirus vector and packaging a replication-defective adenovirus in a specific cell line.

[0041] rAd26: Human adenovirus type 26

[0042] gE: Specifically refers to the varicella-zoster virus gE gene or gE glycoprotein here;

[0043] T: T cell epitope peptide complex;

[0044] Foldon: The domain of the T4 phage fibritin protein

[0045] rChAd63: Recombinant chimpanzee adenovirus type 63

[0046] pAd26: Human adenovirus serotype 26 backbone plasmid

[0047] pChAd63: Chimpanzee adenovirus serotype 63 backbone plasmid

[0048] Varicella-zoster virus MHC-II restricted antigenic epitope peptide: Varicella-zoster virus type II major histocompatibility complex antigenic epitope peptide;

[0049] Signal peptide: A short peptide that guides newly synthesized proteins to the secretory pathway Peptide chain ;

[0050] tPA: Tissue plasminogen activator signal peptide

[0051] pcDNA3.1: Plasmid pcDNA3.1

[0052] Linker: Linking group;

[0053] Rigid linker: A linking group with a relatively rigid structure that can effectively separate protein domains;

[0054] Flexible linker: A linking group that does not affect the interaction or distance between protein domains;

[0055] IRES: Internal ribosome entry site;

[0056] 2A: A short peptide with an average length of 18 - 22 amino acids, present in various viruses;

[0057] Plasmid: Any extrachromosomal genetic determinant;

[0058] Vector: A self-replicating DNA molecule that transfers DNA fragments (target genes) to recipient cells in recombinant DNA technology in genetic engineering;

[0059] Expression cassette: A set of DNA sequences composed of a promoter, a target gene, and a reporter gene, which can be expressed in specific tissues and are easy to detect;

[0060] Eukaryotic expression system: A type of expression system that efficiently expresses genes encoding protective antigens of pathogenic microorganisms in yeast, insect cells, eukaryotic cells (such as CHO, 293 cells, etc.) through DNA recombinant technology;

[0061] Yeast expression system: An expression system that efficiently expresses genes encoding protective antigens of pathogenic microorganisms in yeast through DNA recombinant technology;

[0062] Escherichia coli expression system: An expression system that efficiently expresses genes encoding protective antigens of pathogenic microorganisms in Escherichia coli through DNA recombinant technology;

[0063] Insect cell expression system: An expression system that efficiently expresses genes encoding protective antigens of pathogenic microorganisms in insect cells through DNA recombination technology;

[0064] HEK293 cells: Human embryonic kidney cells 293;

[0065] Backbone plasmid: A plasmid containing important information such as promoters, terminators, and resistance genes;

[0066] Packaging cells: A cell line used for virus amplification or replication;

[0067] Defective recombinant adenovirus: An adenovirus that only replicates in specific cell lines;

[0068] Antigen combination: A combination of two or more antigens;

[0069] Antigen epitope complex: A combination of multi-epitope peptides;

[0070] Sequence 1: MHC-II restricted antigen epitope peptide of varicella-zoster virus gB protein Sequence 2: MHC-II restricted antigen epitope peptide of varicella-zoster virus gB protein Sequence 3: MHC-II restricted antigen epitope peptide of varicella-zoster virus gC protein Sequence 4: MHC-II restricted antigen epitope peptide of varicella-zoster virus gC protein Sequence 5: MHC-II restricted antigen epitope peptide of varicella-zoster virus gH protein Sequence 6: MHC-II restricted antigen epitope peptide of varicella-zoster virus gH protein Sequence 7: MHC-II restricted antigen epitope peptide of varicella-zoster virus gI protein Sequence 8: MHC-II restricted antigen epitope peptide of varicella-zoster virus gI protein Sequence 9: MHC-II restricted antigen epitope peptide of varicella-zoster virus gK protein Sequence 10: MHC-II restricted antigen epitope peptide of varicella-zoster virus gL protein Sequence 11: MHC-II restricted antigen epitope peptide of varicella-zoster virus gM protein Sequence 12: MHC-II restricted antigen epitope peptide of varicella-zoster virus gM protein Sequence 13: MHC-II restricted antigen epitope peptide of varicella-zoster virus gN protein

[0071] Sequence 14: Optimized amino acid sequence of varicella-zoster virus gE protein (gE)

[0072] Sequence 15: Amino acid sequence (gE-T1) formed by tandem combination of 4 MHC-II restricted antigen epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein, and varicella-zoster virus gC protein

[0073] Sequence 16: The amino acid sequence (gE-T2) formed by the tandem combination of 4 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gC protein and gB protein

[0074] Sequence 17: The amino acid sequence (gE-T3) formed by the tandem combination of 5 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gK protein, gL protein, gM protein and gN protein

[0075] Sequence 18: The amino acid sequence (gE-T4) formed by the tandem combination of 6 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gB protein, gC protein and gH protein

[0076] Sequence 19: The amino acid sequence (gE-T5) formed by the tandem combination of 8 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein

[0077] Sequence 20: The amino acid sequence (gE-T6) formed by the tandem combination of 13 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein

[0078] Sequence 21: The amino acid sequence of the domain Foldon of T4 phage fibritin protein Sequence 22: The amino acid sequence (gE-T6-Foldon) formed by the tandem combination of 13 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein and the amino acid sequence of Foldon

[0079] Sequence 23: The nucleotide sequence after translation of the amino acid sequence formed by the tandem combination of 4 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gC protein and gB protein (gE-T1)

[0080] Sequence 24: The nucleotide sequence after translation of the amino acid sequence formed by the tandem combination of 4 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein and varicella-zoster virus gC protein and gB protein (gE-T2)

[0081] SEQ ID NO: 25: The nucleotide sequence after translation of the amino acid sequence formed by tandem combination of 5 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gK protein, gL protein, gM protein and gN protein (gE-T3)

[0082] SEQ ID NO: 26: The nucleotide sequence after translation of the amino acid sequence formed by tandem combination of 6 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein, gC protein and gH protein (gE-T4)

[0083] SEQ ID NO: 27: The nucleotide sequence after translation of the amino acid sequence formed by tandem combination of 8 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein (gE-T5)

[0084] SEQ ID NO: 28: The nucleotide sequence after translation of the amino acid sequence formed by tandem combination of 13 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein (gE-T6)

[0085] SEQ ID NO: 29: The nucleotide sequence after translation of the amino acid sequence formed by tandem combination of 13 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein and the amino acid sequence of Foldon (gE-T6-Foldon) BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 Schematic diagram of the varicella-zoster virus antigen expression cassette of the present invention;

[0087] Figure 2 Identification diagrams of the recombinant adenovirus vector plasmid pAd26-gE-T-Foldon digested with restriction endonuclease Kpn I alone and restriction endonuclease EcoR V alone; Identification diagram of pChAd63-gE-T-Foldon digested with restriction endonuclease Spe I alone;

[0088] Figure 3 Results diagram of cytopathic effect formed by rescued recombinant adenovirus;

[0089] Figure 4Figure showing the results of serum antibody detection after immunizing animals with the recombinant adenovirus of Example 6;

[0090] Figure 5 Figure showing the results of cellular immune effect detection after immunizing animals with the recombinant adenovirus of Example 6; Detailed implementation manners

[0091] The present invention provides that the amino acid sequence of the MHC-II restricted antigenic epitope peptide of varicella-zoster virus is shown as any one of SEQ ID NO.1-13; the modified gE amino acid sequence is shown as SEQ ID NO.15; the MHC-II restricted antigenic epitope complex is linked with gE through a linker, and a Foldon sequence is added to the C-terminus of the combined fragment, and the amino acid sequence of the antigen composition is shown as SEQ ID NO.17.

[0092] In the present invention, the plasmid of the MHC-II restricted antigenic epitope peptide of varicella-zoster virus and the gE antigen composition (gE-T-Foldon) amino acid sequence that can be expressed is obtained by artificial synthesis. The present invention has no special limitation on the artificial synthesis method, and conventional methods in the art can be used.

[0093] The present invention also provides two replication-defective recombinant adenovirus vectors, and the replication-defective recombinant adenovirus vectors are pAd26 and pChAd63. The gE-T-Foldon plasmid in the above scheme is integrated on the recombinant adenovirus vector by homologous recombination.

[0094] The present invention also provides a construction method for preparing the replication-defective adenovirus vector and the recombinant adenovirus as described above, and the method includes the following steps:

[0095] (1) Construct a pcDNA3.1-gE-T-Foldon plasmid containing the amino acid sequence of gE-T-Foldon that can be expressed;

[0096] (2) Integrate the vector in step (1) with the backbone plasmid by homologous recombination to obtain a recombinant adenovirus vector;

[0097] (3) Linearize the recombinant adenovirus vector in step (2) by Pac I digestion to obtain a linearized plasmid, and transfect the HEK293 cells with the linearized plasmid;

[0098] (4) Culture the HEK293 cells in step (3) until obvious cytopathic effects appear, such as cell shrinkage, becoming larger and rounder, and aggregating into grape-like beads;

[0099] (5) Harvest the replication-defective recombinant adenovirus released from the cells in step (4).

[0100] The present invention provides a varicella-zoster virus vaccine, comprising the replication-deficient recombinant adenovirus described in the above scheme.

[0101] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0102] Example 1: Prediction of MHC-II restricted antigenic epitopes of varicella-zoster virus

[0103] 1.1 The amino acid sequences of gB, gC, gH, gI, gK, gL, gM and gN glycoproteins in the amino acid sequence of varicella-zoster virus (OKA strain) (GenBank: AB097933.1) collected on the NCBI website were queried, and the MHC-II binding tool (http: / / tools.iedb.org / mhcii / ) was used to predict the MHC-II restricted antigen epitopes of the above 8 glycoproteins. The prediction method used is the consensus method recommended by IEDB Recommended, which uses the best possible for a given MHC molecule. The short peptides with the top ranking of the MHC-II restricted antigen epitopes screened by each protein were selected for antigen combination. The specific sequence information of the MHC-II restricted antigen epitopes screened is shown in Table 1.

[0104] Table 1 MHC-II restricted antigen epitope peptides of 8 glycoproteins of varicella-zoster virus

[0105]

[0106]

[0107]

[0108]

[0109]

[0110] Example 2: Modification of gE protein and construction of antigen composition

[0111] 2.1 Change the original signal peptide (1aa - 30aa) of the gE protein to the tissue plasminogen activator signal peptide tPA to further improve the expression level of the gE protein. At the same time, remove the transmembrane region and intracellular region (starting from amino acid 547) of the gE protein. The amino acid sequence information of the modified gE protein is shown in SEQ ID NO.14, and the nucleotide sequence is shown in SEQ ID NO.23, where 1bp - 66bp is the tissue plasminogen activator signal peptide tPA, and 67bp - 1614bp is the extracellular region of the gE protein.

[0112] 2.2 Link the screened MHC-II restricted antigen epitopes with GPGPG to form the antigen epitope complex T. Link the antigen epitope complex with the modified gE through a rigid linker (EAAAK), named gE-T, and use the VaxiJen software to score the antigenicity. A score higher than 0.4 indicates that the composition has antigenicity. Table 2 shows the antigenicity scores of several random combinations of the optimized gE linked antigen epitope complex.

[0113] Table 2 Antigenicity score results of gE-T

[0114]

[0115]

[0116] As can be seen from the above table, gE-T1, gE-T2, gE-T3, gE-T4, gE-T5, and gE-T6 all have immunogenicity and can be used as vaccines.

[0117] Among them, gE-T1 is an amino acid sequence formed by concatenating and combining 4 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein, varicella-zoster virus gB protein and gC protein. The amino acid sequence information is shown in SEQ ID NO.15. The nucleotide sequence information of gE-T1 is shown in SEQ ID NO.24, in which 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1614bp is the extracellular region of gE protein; 1615bp-1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp-1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.1 of gB protein; 1675bp-1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp-1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.2 of gB protein; 1735bp-1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp-1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.3 of gC protein; 1795bp-1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp-1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.4 of gC protein.

[0118] Among them, gE-T2 is an amino acid sequence formed by the tandem combination of 4 MHC-II restricted antigenic epitope peptides screened from the varicella-zoster virus gE protein, the varicella-zoster virus gC protein and the gB protein. The amino acid sequence information is shown in SEQ ID NO.16. The nucleotide sequence information of gE-T2 is shown in SEQ ID NO.25, where 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1614bp is the extracellular region of the gE protein; 1615bp-1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp-1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.3 of the gC protein; 1675bp-1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp-1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.4 of the gC protein; 1735bp-1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp-1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.1 of the gB protein; 1795bp-1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp-1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.2 of the gB protein.

[0119] Among them, gE-T3 is an amino acid sequence formed by concatenating and combining 5 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein with varicella-zoster virus gK protein, gL protein, gM protein and gN protein. The amino acid sequence information is shown in SEQ ID NO.17. The nucleotide sequence information of gE-T3 is shown in SEQ ID NO.26, where 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1614bp is the extracellular region of gE protein; 1615bp-1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp-1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ IDNO.9 of gK protein; 1675bp-1689bp is the nucleotide sequence of linker (GPGPG); 1690bp-1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.10 of gL protein; 1735bp-1749bp is the nucleotide sequence of linker (GPGPG); 1750bp-1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.11 of gM protein; 1795bp-1809bp is the nucleotide sequence of linker (GPGPG); 1810bp-1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.12 of gM protein; 1855bp-1869bp is the nucleotide sequence of linker (GPGPG); 1870bp-1914bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.13 of gM protein.

[0120] Among them, gE-T4 is an amino acid sequence formed by concatenating and combining 6 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein with varicella-zoster virus gB protein, gC protein and gH protein. The amino acid sequence information is shown in SEQ ID NO.18. The nucleotide sequence information of gE-T4 is shown in SEQ ID NO.27, where 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1614bp is the extracellular region of gE protein; 1615bp-1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp-1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.1 of gB protein; 1675bp-1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp-1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.2 of gB protein; 1735bp-1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp-1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.3 of gC protein; 1795bp-1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp-1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.4 of gC protein; 1855bp-1869bp is the nucleotide sequence of the linker (GPGPG); 1870bp-1914bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.5 of gH protein; 1915bp-1929bp is the nucleotide sequence of the linker (GPGPG); 1930bp-1974bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.6 of gH protein.

[0121] Among them, gE-T5 is an amino acid sequence formed by concatenating 8 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein with varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein. The amino acid sequence information is shown in SEQ ID NO.19. The nucleotide sequence information of gE-T5 is shown in SEQ ID NO.28, where 1bp - 66bp is the tissue plasminogen activator signal peptide tPA; 67bp - 1614bp is the extracellular region of gE protein; 1615bp - 1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp - 1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.1 of gB protein; 1675bp - 1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp - 1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.3 of gC protein; 1735bp - 1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp - 1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.5 of gH protein; 1795bp - 1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp - 1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.7 of gI protein; 1855bp - 1869bp is the nucleotide sequence of the linker (GPGPG); 1870bp - 1914bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.9 of gK protein; 1915bp - 1929bp is the nucleotide sequence of the linker (GPGPG); 1930bp - 1974bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.10 of gL protein; 1975bp - 1989bp is the nucleotide sequence of the linker (GPGPG); 1990bp - 2034bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.11 of gM protein; 2035bp - 2049bp is the nucleotide sequence of the linker (GPGPG); 2050bp - 2094bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.13 of gN protein.

[0122] Among them, gE-T6 is an amino acid sequence formed by concatenating 13 MHC-II restricted antigenic epitope peptides screened from varicella-zoster virus gE protein with varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein and gN protein. The amino acid sequence information is shown in SEQ ID NO.20. The nucleotide sequence information of gE-T6 is shown in SEQ ID NO.29, where 1bp - 66bp is the tissue plasminogen activator signal peptide tPA; 67bp - 1614bp is the extracellular region of gE protein; 1615bp - 1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp - 1674bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.1 of gB protein; 1675bp - 1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp - 1734bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.2 of gB protein; 1735bp - 1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp - 1794bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.3 of gC protein; 1795bp - 1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp - 1854bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.4 of gC protein; 1855bp - 1869bp is the nucleotide sequence of the linker (GPGPG); 1870bp - 1914bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.5 of gH protein; 1915bp - 1929bp is the nucleotide sequence of the linker (GPGPG); 1930bp - 1974bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.6 of gH protein; 1975bp - 1989bp is the nucleotide sequence of the linker (GPGPG); 1990bp - 2034bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ IDNO.7 of gI protein; 2035bp - 2049bp is the nucleotide sequence of the linker (GPGPG); 2050bp - 2094bp is the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.8 of gI protein; 2095bp - 2109bp is the nucleotide sequence of the linker (GPGPG); 2110bp - 2154bp is the MHC-II restricted antigenic epitope peptide SEQ ID NO. of gK proteinThe nucleotide sequence of 9; the nucleotide sequence of the linker (GPGPG) is from 2155bp to 2169bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide of the gL protein SEQ ID NO.10 is from 2170bp to 2214bp; the nucleotide sequence of the linker (GPGPG) is from 2215bp to 2229bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide of the gM protein SEQ ID NO.11 is from 2230bp to 2274bp; the nucleotide sequence of the linker (GPGPG) is from 2275bp to 2289bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide of the gM protein SEQ ID NO.12 is from 2290bp to 2334bp; the nucleotide sequence of the linker (GPGPG) is from 2335bp to 2349bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide of the gM protein SEQ ID NO.13 is from 2350bp to 2394bp.

[0123] The antigen composition gE-T6 that selects MHC-II restricted antigen epitopes is used as the candidate antigen gE-T. The specific amino acid sequence information can be seen in SEQ ID NO.20. Subsequently, a Foldon sequence is added to the C-terminus of the combined fragment to form a trimeric structure. The amino acid sequence of the antigen composition is shown in SEQ ID NO.22, and its nucleotide sequence information can be seen in SEQ ID NO.30. Among them, gE-T6-Foldon is an amino acid sequence formed by concatenating 13 MHC-II restricted antigen epitope peptides screened from the varicella-zoster virus gE protein and the varicella-zoster virus gB protein, gC protein, gH protein, gI protein, gK protein, gL protein, gM protein, and gN protein, with a Foldon sequence added to the C-terminus. The amino acid sequence information can be seen in SEQ ID NO.22. The nucleotide sequence information of gE-T6-Foldon can be seen in SEQ ID NO.30, where 1bp-66bp is the tissue plasminogen activator signal peptide tPA; 67bp-1614bp is the extracellular region of the gE protein; 1615bp-1629bp is the nucleotide sequence of the rigid linker (EAAAK); 1630bp-1674bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ ID NO.1 of the gB protein; 1675bp-1689bp is the nucleotide sequence of the linker (GPGPG); 1690bp-1734bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ ID NO.2 of the gB protein; 1735bp-1749bp is the nucleotide sequence of the linker (GPGPG); 1750bp-1794bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ ID NO.3 of the gC protein; 1795bp-1809bp is the nucleotide sequence of the linker (GPGPG); 1810bp-1854bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ IDNO.4 of the gC protein; 1855bp-1869bp is the nucleotide sequence of the linker (GPGPG); 1870bp-1914bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ ID NO.5 of the gH protein; 1915bp-1929bp is the nucleotide sequence of the linker (GPGPG); 1930bp-1974bp is the nucleotide sequence of the MHC-II restricted antigen epitope peptide SEQ ID NO.6 of the gH protein; 1975bp-1989bp is the nucleotide sequence of the linker (GPGPG); 1990bp-2034bp is the MHC-II restricted antigen epitope peptide SEQ ID NO.The nucleotide sequence of 7; the nucleotide sequence of the linker (GPGPG) is from 2035bp to 2049bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.8 of the gI protein is from 2050bp to 2094bp; the nucleotide sequence of the linker (GPGPG) is from 2095bp to 2109bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.9 of the gK protein is from 2110bp to 2154bp; the nucleotide sequence of the linker (GPGPG) is from 2155bp to 2169bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.10 of the gL protein is from 2170bp to 2214bp; the nucleotide sequence of the linker (GPGPG) is from 2215bp to 2229bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.11 of the gM protein is from 2230bp to 2274bp; the nucleotide sequence of the linker (GPGPG) is from 2275bp to 2289bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.12 of the gM protein is from 2290bp to 2334bp; the nucleotide sequence of the linker (GPGPG) is from 2335bp to 2349bp; the nucleotide sequence of the MHC-II restricted antigenic epitope peptide SEQ ID NO.13 of the gM protein is from 2350bp to 2394bp; the nucleotide sequence of the Foldon amino acid sequence SEQ ID NO.29 for stabilizing the trimer conformation is from 2395bp to 2481bp.

[0124] Example 3. Vaccine design scheme

[0125] In the examples of the present invention, the adenovirus vectors used are the modified human rare serotype 26 adenovirus and chimpanzee 63 adenovirus. Compared with the corresponding wild-type adenovirus, the modified adenovirus lacks part of the E1 gene related to virus replication and all of the E3 gene. The constructed recombinant adenovirus can only replicate in the E1 gene-expressing cell line (HEK293 cells). After the recombinant adenovirus infects animals or humans, it can express the inserted foreign gene but cannot replicate, achieving the characteristic of replication deficiency and demonstrating its safety.

[0126] The recombinant adenovirus constructed in the present invention contains the MHC-II restricted antigenic epitope peptide of varicella-zoster virus and the expression cassette of the modified gE protein (antigen composition). The expressed sequence is located between the cytomegalovirus (CMV) promoter and the SV40 polyadenylation tail termination sequence. A Kozak sequence that is beneficial for efficient gene expression is added before the antigen composition sequence, as Figure 1 shown, where the Kozak sequence is GCCACC.

[0127] The replication-deficient recombinant adenovirus vectors pAd26 and pChAd63, and pcDNA3.1-gE-T-Foldon were synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd.

[0128] Example 4: Construction of recombinant adenovirus vectors

[0129] Construction of recombinant adenovirus vector plasmids pAd26-gE-T-Foldon and pChAd63-gE-T-Foldon

[0130] (1) Using the plasmid pcDNA3.1-gE-T-Foldon as a template, the CMV-gE-T-Foldon-SV40 fragment 1 that can be recombined with the pAd26 backbone plasmid and the CMV-gE-T-Foldon-SV40 fragment 2 that can be recombined with the pChAd63 backbone plasmid were obtained by PCR. The PCR primers are as follows:

[0131] F-26S-G: TGGTACCGTCGACGCGGCCGCTCGAGCCTAAGCT R-26S-G: ATCAGTT ATCTAGATCCGGTGGATCGG ATATCTTAT F-63S-G: ACTCTTGAGTGCCAGCGAGTAGAGTTTACTGTAAT R-63S-G: CTGGAGCCGAACTCCGTCCCGTTGCGTTAAGATAC

[0132] (2) The pAd26 backbone plasmid was digested with the restriction endonuclease Xba I, and the pChAd63 backbone plasmid was digested with the restriction endonuclease Hpa I. The vectors were obtained by ethanol precipitation and were respectively homologously recombined with the purified CMV-gE-T-Foldon-SV40 fragment 1 and CMV-gE-T-Foldon-SV40 fragment 2 using the Seamless Cloning Kit. The recombinant products were transformed into DH10B competent cells, and clones were screened on an ampicillin-resistant plate. Clones were picked for colony PCR identification, and positive clones were used to extract plasmids. The pAd26-gE-T-Foldon plasmid was identified by single digestion with Kpn I and single digestion with EcoR V, as shown in Figure 2 a; The pChAd63-gE-T-Foldon was identified by single digestion with Spe I, as shown in Figure 2 b. The correct plasmids were sent for sequencing identification. The plasmids with correct sequencing are the recombinant adenovirus vector plasmids pAd26-gE-T-Foldon and pChAd63-gE-T-Foldon.

[0133] Example 5, Packaging and Identification of Recombinant Adenovirus

[0134] Packaging of Recombinant Adenovirus

[0135] (1) The recombinant adenovirus vector plasmids pAd26-gE-T-Foldon and pChAd63-gE-T-Foldon were respectively digested with the restriction endonuclease Pac I, and the linearized plasmids were recovered by ethanol precipitation;

[0136] (2) HEK293 cells were seeded in a six-well plate and transfected when the cell confluence reached 70%;

[0137] (3) Plasmid preparation: 4 μg of the linearized plasmid and 10 μl of Lipofectamine 2000 liposome were respectively mixed with 250 μl of serum-free DMEM medium and allowed to stand at room temperature for 5 min. Subsequently, the two mixtures were mixed together and allowed to stand at room temperature for 20 min;

[0138] (4) The mixture was added to the six-well plate containing HEK293 cells. After culturing at 37 °C for 5 h, the culture medium was replaced with DMEM medium containing 2% calf serum and cultured at 37 °C;

[0139] (5) The cell status and virus production were observed every 24 h. The virus production phenomenon was that the cells became larger and rounder, as shown in (Figure a is blank cells, Figure b is the cell lesion diagram). When most of the cells were diseased, the virus was harvested. Figure 3 shown (Figure a is blank cells, Figure b is the cell lesion diagram). When most of the cells were diseased, the virus was harvested.

[0140] (6) The virus-producing cells were repeatedly frozen and thawed three times in an -80 °C refrigerator and a 37 °C water bath to release the recombinant adenovirus from the cells. After centrifugation at 4000 rpm for 10 min, the supernatant was collected, which was the first-generation virus seed (P1) and used as the virus seed for subsequent large-scale culture.

[0141] The packaged recombinant adenoviruses were rAd26-gE-T-Foldon and rChAd63-gE-T-Foldon. At the same time, the recombinant adenoviruses rAd26-gE and rChAd63-gE expressing the original gE sequence were constructed.

[0142] Example 6, Animal Immunization Experiment with Recombinant Adenovirus

[0143] 6.1 Animal Immunization

[0144] Female BALB / c mice of the same age and similar body weight were randomly divided into three groups of 5 mice each. The first group was primed with rAd26-gE-T-Foldon and boosted with rChAd63-gE-T-Foldon; the second group was primed with rAd26-gE and boosted with rChAd63-gE; the third group was the saline group. Experimental treatment: Prime by intramuscular injection on day 0, boost by intramuscular injection 21 days after immunization, and collect mouse sera and splenocytes 35 days after immunization for serum antibody detection and cellular immune effect detection respectively.

[0145] 6.2 Serum antibody detection

[0146] Purified gE protein was coated onto ELISA plates at 200 ng / ml, and the IgG antibody titer against gE protein in the sera of immunized BALB / c mice was detected by ELISA. The results are as Figure 4 shown. In the group primed with rAd26-gE-T-Foldon and boosted with rChAd63-gE-T-Foldon and the group primed with rAd26-gE and boosted with rChAd63-gE, high serum antibodies were produced in the sera of BALB / c mice after immunization.

[0147] 6.3 Cellular immune detection

[0148] 6.3.1 Preparation of splenocytes

[0149] 1) Collect the spleens of mice that have completed the immunization procedure in a biosafety cabinet;

[0150] 2) Grind the spleen through a gauze into lymphocyte separation medium, transfer the suspension to a 15 ml centrifuge tube, adjust the speed of the centrifuge to the lowest, and centrifuge at 1000 rpm for 20 min;

[0151] 3) After centrifugation, aspirate the separated lymphocytes into 1640 medium;

[0152] 4) Centrifuge the lymphocytes again at 1000 rpm for 10 min;

[0153] 5) Discard the supernatant, resuspend the cells with 1640 medium, and perform cell counting for standby.

[0154] 6.3.2 Detection of cell labeling effect by ELISPOT method

[0155] Detect using ELISPOT plates pre-coated with IFN-γ. The stimulating antigens are gE protein and 13 short peptides with SEQ ID NO.1 - 13 synthesized by Nanjing Genscript Biotech Co., Ltd.

[0156] 1) Add 200 μl of 1640 medium to the pre-coated IFN-γ ELISPOT 96-well plate in a biosafety cabinet, let it stand at room temperature for 10 min, and discard the medium.

[0157] 2) Add the cell suspension to the corresponding experimental wells at 100 μl / well, set up positive and negative wells, with 3×10 5 cells added to each well. At the same time, set up blank control wells, with 2 replicates for each.

[0158] 3) Add the antigen stimulator mixture (0.5 μg of each stimulator) to the experimental wells, and incubate at 37°C in a 5% incubator for 20 h.

[0159] 4) Discard the cell fluid, add pre-cooled deionized water to the 96-well plate, and place it in a 4°C refrigerator for 10 min.

[0160] 5) Discard the liquid, wash the plate 5 times with the washing solution, let it stand for 1 min each time, and blot dry the excess liquid with absorbent paper.

[0161] 6) Dilute the biotin-labeled antibody with the antibody diluent, add it to the 96-well plate, and incubate at 37°C for 1 h.

[0162] 7) Wash the plate 5 times with the washing solution, let it stand for 1 min each time, and blot dry the excess liquid with absorbent paper.

[0163] 8) Prepare the AEC chromogenic working solution freshly and add it to the 96-well plate, and develop color at room temperature for 20 min.

[0164] 9) Observe the formation of spots, discard the liquid, wash the plate 5 times with deionized water, air-dry the 96-well plate naturally, and perform spot reading after it is dry.

[0165] Result analysis: As Figure 5 shown in the cellular immune detection results, compared with the mice immunized with the recombinant adenoviruses rAd26gE and rChAd63gE, the mice immunized with the recombinant adenoviruses rAd26gE-T-Foldon and rChAd63gE-T-Foldon containing the MHC-II polypeptide combination can stimulate higher cellular immune responses in mice after immunization.

[0166] The above are only the preferred embodiments of the present invention, but it is not limited to the applications listed in the embodiments. It should be noted that for those skilled in the art of this technology, optimization and improvement can be easily achieved, and all should be within the protection scope of the present invention. The present invention is not limited to specific details.

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

Claims

1. A recombinant adenovirus vaccine, characterized in that, Recombinant adenoviruses containing rAd26-gE-T-Foldon and rChAd63-gE-T-Foldon, wherein rAd26-gE-T-Foldon contains the recombinant adenovirus vector pAd26-gE-T-Foldon; rChAd63-gE-T-Foldon contains the recombinant adenovirus vector pChAd63-gE-T-Foldon, and the amino acid sequence of the gE-T-Foldon is as shown in SEQ ID NO.

22.

2. A polynucleotide, characterized in that: It encodes the gE-T-Foldon described in claim 1.

3. A recombinant adenovirus vector, which includes pAd26-gE-T-Foldon and pChAd63-gE-T-Foldon, and contains the polynucleotide described in claim 2.

4. A recombinant adenovirus expression system containing the recombinant adenovirus vector described in claim 3, which is selected from: eukaryotic expression systems and Escherichia coli expression systems.

5. The recombinant adenovirus expression system described in claim 4, wherein the eukaryotic expression system is HEK293 cells.

Images