An aptamer for simultaneously simulating free and bound Neu5Gc, a kit and application thereof

Abstract

The present application relates to the technical field of biological medicine, in particular to an aptamer for simultaneously simulating free and combined Neu5Gc, a kit and application thereof.The nucleotide sequence of the aptamer is shown as SEQ ID No.1.The aptamer provided by the present application can effectively simulate free and various combined Neu5Gc antigen epitopes, can be combined with more kinds of anti-Neu5Gc antibodies compared with the existing limited kinds of antigens, can detect the content of anti-Neu5Gc antibodies in serum and related preparations as a molecular probe, and the detected content is closer to the real level, can detect the content of Neu5Gc antigens in biological preparations through the competition principle, and is expected to be used as a Neu5Gc substitute for in-vivo experiments due to its low immunogenicity.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to an aptamer for simultaneously simulating free and bound Neu5Gc, a kit and application thereof. BACKGROUND

[0002] Most of the posterior animals, i.e. mammals, fish and echinoderms, can widely synthesize Neu5Gc, while humans cannot synthesize Neu5Gc due to the loss of 92bp fragments in exon 6 of the CMAH hydroxylase gene in the evolution process, which makes the CMAH hydroxylase lose activity and cannot synthesize Neu5Gc, but can continuously intake exogenous Neu5Gc through the diet. Neu5Gc in red meat enters the human body and can be recognized by the substrate-unspecific Neu5Ac sialic acid synthetase, and is integrated into the outer membrane protein by borrowing the Neu5Ac metabolic integration pathway, and continuously stimulates the body to produce anti-Neu5Gc antibodies as a xenogeneic self-antigen. Anti-Neu5Gc antibodies attack normal tissues integrated with Neu5Gc, which can easily cause chronic inflammation such as enteritis, arthritis and myocarditis, and further increase the risk of colorectal cancer, heart disease and other diseases. Studies have shown that the level of anti-Neu5Gc antibodies in serum is correlated with the degree of inflammation and tumor progression, and has a detection value.

[0003] Most of the existing detection methods use Neu5Gc-BSA, Neu5Gc-polyacrylamide conjugates, or use one-pot three-enzyme artificial synthesis of specified Neu5Gc glycolipids and glycoproteins as detection antigens, and use ELISA or glycan microarray methods to detect antibody levels. However, due to the fact that in natural bound Neu5Gc, the types and connection methods of glycan, protein or lipid can also determine the antigen epitope, so that the corresponding anti-Neu5Gc antibody is of various types and has low cross-reactivity. The existing detection means uses single or limited types of Neu5Gc antigens, and the types of anti-Neu5Gc antibodies that can be detected are limited, and it is difficult to reflect the true level of anti-Neu5Gc antibodies. Therefore, a simulation antigen that can simultaneously simulate free and various bound Neu5Gc epitopes is needed to make up for the deficiency in the direction of anti-Neu5Gc antibody detection. SUMMARY

[0004] In order to solve the above problems, the present application provides an aptamer for simultaneously simulating free and bound Neu5Gc, a kit and application thereof. The aptamer provided by the present application can effectively simulate free and various bound Neu5Gc antigen epitopes, and compared with the limited types of antigens, it can bind to more types of anti-Neu5Gc antibodies, as a molecular probe, the content of anti-Neu5Gc antibodies in serum and related preparations detected is closer to the true level, and the content of Neu5Gc antigens in biological preparations can also be detected by the competition principle, and it is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity.

[0005] To achieve the above object, the present application provides the following technical solutions.

[0006] The present application provides an aptamer for simultaneously simulating free and bound Neu5Gc, and the nucleotide sequence of the aptamer is shown in any one of SEQ ID No. 1-6.

[0007] Preferably, the free Neu5Gc includes α-isomer free Neu5Gc.

[0008] Preferably, the bound Neu5Gc includes artificially synthesized antigens and natural bound Neu5Gc.

[0009] Preferably, the artificially synthesized antigens include Neu5Gc-BSA.

[0010] The present application also provides a kit for simultaneously simulating free and bound Neu5Gc, comprising the aptamer of the above technical solution.

[0011] The present application also provides the application of the aptamer of the above technical solution in preparing and purifying anti-Neu5Gc antibody reagents.

[0012] The present application also provides the application of the aptamer of the above technical solution as a molecular probe in detecting the content of anti-Neu5Gc antibody in serum and related preparations.

[0013] The present application also provides the application of the aptamer of the above technical solution as a molecular probe in detecting the content of Neu5Gc antigen in biological preparations.

[0014] Beneficial effects:

[0015] The bound Neu5Gc integrated on the surface of human tissue cells can also be a binding site for a variety of food pathogenic bacteria, increasing the probability of food poisoning and the probability of zoonotic infectious diseases. The AB5 subserine aminease cytotoxin secreted by the Shiga toxin-producing Escherichia coli (STEC) O113:H2198NK2 strain is confirmed to specifically bind to α-isomer free Neu5Gc and various bound Neu5Gc, and is suitable as a binding target. Through epitope simulation such as SELEX technology, a simulation antigen that simultaneously simulates free and various bound Neu5Gc is screened out. SELEX technology is a method of using a large-capacity artificial synthesis of random oligonucleotide library, combining PCR in vitro amplification technology, to enrich oligonucleotide aptamers that specifically bind to target molecules at an exponential rate. A sufficient capacity of oligonucleotide library contains all possible stereostructures, and can screen high-affinity ligands for any kind of target molecules, which can meet the experimental requirements.

[0016] Therefore, the application studies using SELEX technology to take the soluble SubB protein obtained by the expression of SubB-His outer membrane protein and the renaturation of inclusion bodies as the target for the first six rounds and the last six rounds of screening, and screens 6 positive Neu5Gc mimic aptamers from a 78nt ssDNA library containing 40nt random sequences. Through indirect and competitive ELISA identification, the aptamer provided by the application can effectively simulate the free and various bound state Neu5Gc antigen epitopes, can be combined with more kinds of anti-Neu5Gc antibodies compared with the existing limited antigens, as a molecular probe, the content of anti-Neu5Gc antibody detected in the serum and related preparations is closer to the true level, and the content of Neu5Gc antigen in the biological preparation can also be detected by the competition principle, and it is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced below.

[0018] Figure 1 SELEX screening process;

[0019] Figure 2 Preparation and characterization of SubB;

[0020] Figure 3 Determination of the number of SELEX screening rounds;

[0021] Figure 4 Advantageous aptamer screening results;

[0022] Figure 5 Secondary structure prediction of aptamer No. 11;

[0023] Figure 6 Free Neu5Gc and Neu5Gc-BSA competitive ELISA results;

[0024] Figure 7 Natural Neu5Gc competitive ELISA results;

[0025] Figure 8 Affinity determination of aptamer No. 11. DETAILED DESCRIPTION

[0026] The application provides an aptamer for simultaneously simulating free and bound Neu5Gc, and the nucleotide sequence of the aptamer is as shown in any one of SEQ ID No. 1-6, and is specifically as follows:

[0027] SEQ ID No. 1:

[0028] 5'- ATGGTTGTAGGTCAGGTGGGTCGGGGCGGGTGGTGGTTCTTTTTGCTCGATCGGGGGTGCATTCCGCTTACATTCTCG -3';

[0029] SEQ ID No. 2:

[0030] TTGGTTGTAGGTCAGGTGGGGTGGGTGGTGGTCCGTTATCATGTTCCCGTTGTCTGCTGCATTCCGCTTACATTCTCG;

[0031] SEQ ID No. 3:

[0032] TTGGTTGTAGGTCAGGTGGGGTGGGTGGTGGTCTTCCTTTTTTCTGTCCCTGCGCGTGTCATTCCGCTTACATTCTCG;

[0033] SEQ ID No. 4:

[0034] TTGGTTGTAGGTCAGGTGGGCGGCGGTGTTTTGTTTCGTCTTGTCTCGTTCGGGGTTGTCATTCCGCTTACATTCTCG;

[0035] SEQ ID No. 5:

[0036] TTGGTTGTAGGTCAGGTGGGTCGGGGGGGTGGTGGTAGTGTTTTATGTCGTTGTCGGTCATTCCGCTTACATTCTCG;

[0037] SEQ ID No. 6:

[0038] TTGGTTGTAGGTCAGGTGGCGCTCGATGTGGTGGTTTCTGGGTTTGGCTCTGGGACTGGCATTCCGCTTACATTCTCG.

[0039] In the present application, the free Neu5Gc preferably includes a-iso form free Neu5Gc. In the present application, the bound Neu5Gc preferably includes an artificially synthesized antigen and natural bound Neu5Gc. In the present application, the artificially synthesized antigen preferably includes Neu5Gc-BSA.

[0040] The kit for simultaneously simulating free and bound Neu5Gc according to the application comprises the aptamer described in the above technical solution.

[0041] The application also provides the use of the aptamer described in the above technical solution in the preparation and purification of an anti-Neu5Gc antibody reagent.

[0042] The application also provides the use of the aptamer described in the above technical solution as a molecular probe in the detection of the content of anti-Neu5Gc antibodies in serum and related preparations.

[0043] The application also provides the use of the aptamer described in the above technical solution as a molecular probe in the detection of the content of Neu5Gc antigens in biological preparations.

[0044] To further illustrate the application, the application is described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the application.

[0045] Example 1

[0046] 1. Materials and methods

[0047] 1.1 Materials

[0048] Cmah- / - gene knockout C57 mice were prepared by Cyagen Company using CRISPR / Cas9 technology; human anti-Neu5Gc antibody positive serum was obtained by preliminary screening of the difference between Cmah- / - knockout and wild mouse serum by difference ELISA, and to cover as many antibodies against different Neu5Gc antigens as possible, the human antibody positive serum from 10 donors was mixed and purified by affinity chromatography; the SubB protein gene sequence was obtained from NCBI Reference Sequence: NZ_VEOI01000025.1; the TE buffer was 20mM Tris, 1mM EDTA, pH 8.5; the washing buffer I was 20mM Tris, 1mM EDTA, 1% TritonX-100, pH 8.5; the washing buffer II was 20mM Tris, 1mM EDTA, 1% TritonX-100, 2M Urea, pH 8.5; the denaturing buffer was 20mM Tris, 10mM EDTA, 8M Urea, pH 9.5; the renaturation buffer was 2mM GSH, 0.2mM GSSG, 20mM Tris, 6, 4, 2, 0M Urea added in order of difference, and the pH was 9.5; the exonuclease was purchased from Biyun Tian Biological Technology Co., Ltd.

[0049] 1.2SubB-His outer membrane protein expression bacteria and preparation of soluble protein

[0050] The signal peptide of the SubB protein gene sequence was removed, a his tag was added to the 3' end, and the Nde I / Xhol I cloning site was connected with the pET-30a(+) plasmid synthesized by Shanghai Biosciences Biotechnology Co., Ltd., and then transformed into Rosetta(DE3) competent cells. SubB-His outer membrane protein expression bacteria were obtained by 0.5mM IPTG induction.

[0051] The expression strain was washed 3 times with 0.01M PBS, resuspended in TE buffer and ultrasonically broken; centrifuged at 12000rpm for 15min, the precipitate was washed 2 times with washing buffer I and then 1 time with washing buffer II, each time for 2h at room temperature; the precipitate was stirred overnight at room temperature in denaturing buffer, the supernatant was centrifuged and loaded into a 3kDa dialysis bag, gradually renatured in renaturation buffer, every 12h the next urea concentration gradient was changed, and finally dialyzed in 0.01M PBS for 6h, the supernatant was centrifuged, concentrated to 0.6mg / mL by 3kDa ultrafiltration tube, and stored at 4°C.

[0052] 1.3 Random library design

[0053] The 78nt random ssDNA library was composed of 19nt fixed sequences at both ends and 40nt random oligonucleotide sequences in the middle. A total of 26 pairs of primers were designed, and 8 pairs of high-quality primers were selected according to Tm and Gc content, referring to the results of Nucleotide BLAST. After blank template PCR verification, the optimal primers without primer dimer were selected, and three pairs of primer combinations were designed, i.e., the 5' end of the upstream primer was modified with biotin, and the 5' end of the downstream primer was modified with phosphorylation; the upstream primer was not modified with a tag, and the downstream primer was modified with phosphorylation at the 5' end; neither the upstream primer nor the downstream primer was modified with a tag. The above primers and library design sequences are shown in Table 1, which were synthesized by Shanghai Biosciences Biotechnology Co., Ltd.

[0054] Table 1 Random library design

[0055]

[0056] 1.4 Double-target SELEX screening

[0057] SubB-His outer membrane protein expression bacteria and soluble SubB protein were used as the first 6 rounds and the last 6 rounds of screening targets, respectively, and the screening process is shown in Figure 1 Table 2 shows the information of the required expression bacteria, protein, ssDNA dosage, incubation time and washing times for each round of screening. The induced and uninduced strains were washed 3 times with 0.01M PBS, resuspended to 10 9CFU / mL, 4°C storage for standby. Take 0.01M PBS to resuspend ssDNA, 95°C metal bath for 5 min, then ice bath for 10 min, gently mix with non-expression strain, incubate at 37°C; 12000rpm, 2 min centrifugation, take supernatant and gently mix with expression strain, incubate at 37°C; 0.01M PBS centrifugal washing, precipitate resuspended by 100μL ddH2O, 95°C metal bath for 5 min, then ice bath for 2 min, centrifugation to take supernatant, dilute 10 times as PCR template, -20°C storage.

[0058] Table 2 SELEX screening conditions

[0059]

[0060] Take 1μg / mL SubB protein and 4×10 7 CFU / mL non-induced strain, 100μL / well into 96-well enzyme-labeled plate, 4°C coating overnight; take 0.01M PBS to resuspend ssDNA, 95°C metal bath for 5 min, then ice bath for 10 min, add non-induced strain coated well, incubate at 37°C, then take supernatant and add to SubB protein coated well, incubate at 37°C; discard supernatant, 0.01M PBS shake washing, add 100μL ddH2O, 95°C metal bath for 5 min, then ice bath for 2 min, take supernatant, dilute 10 times as PCR template, -20°C storage.

[0061] PCR system see Table 3, PCR program is 94°C pre-denaturation for 30s, 94°C denaturation for 6s, 57°C annealing for 4s, 72°C extension for 4s, 3 cycles, change to 62°C annealing for 22 cycles, 72°C extension for 30s. Phosphorylated dsDNA is cut by exonuclease to remove the antisense strand, the enzyme cutting system is 250μL PCR dsDNA product, 18μL exonuclease, 90μL buffer, 540μL ddH2O, incubate at 37°C for 20 min, 75°C metal bath for 10 min, then ice bath for 5 min. The ssDNA obtained by enzyme cutting is purified by ethanol precipitation, resuspended in 0.01M PBS and stored at -20°C. Non-biotin labeled ssDNA is used for the next round of screening, and biotin labeled ssDNA is used for ELISA identification.

[0062] Table 3 PCR system

[0063] Reagents Biotin-labeled addition system (μL) Biotin-labeled addition system (μL) PCR Mix enzyme 12 8 Upstream primer 2 2 Downstream primer 2 2 Template 5 5 ddH2O 4 8 Total volume 25 25

[0064] The last round of non-biotin non-phosphorylated labeled PCR double-stranded product was connected with pMD 19-T vector and transformed into JM109 competent cells, uniformly coated on Amp resistant agar plates, incubated at 37°C overnight, and single colony was picked and cultured overnight, and the bacterial liquid was sent to Shanghai Shengong Biotechnology Co., Ltd. for sequencing identification. After multiple sequence alignment analysis by Snapgene, 6 oligonucleotide sequences with the highest repetition were selected, and biotin-labeled aptamer was synthesized by Shanghai Shengong Biotechnology Co., Ltd. for ELISA screening.

[0065] 1.5 SELEX screening round determination

[0066] Take 1-12 rounds of purified biotin-labeled ssDNA, 1:25 dilution, 100 μL / well into SubB protein coated wells, 37°C incubation for 1h; PBST shaking and washing, 100 μL / well avidin-HRP, 37°C incubation for 1h; PBST shaking and washing, 100 μL / well TMB substrate, 37°C incubation for 10min, 50 μL / well stop solution, read OD 450nm absorbance value.

[0067] 1.6 Aptamer sequence screening

[0068] Take human anti-Neu5Gc positive antibody, 14 μg / mL, 100 μL / well into 96-well enzyme-labeled plate, 4°C coating overnight; biotin-labeled aptamer was resuspended in 0.01M PBS to 0.4 μM, 95°C metal bath for 5min, then ice bath for 10min, 100 μL / well into SubB protein coated wells and human positive antibody coated wells, 37°C incubation for 1h, PBST shaking and washing, 100 μL / well avidin-HRP, 37°C incubation for 1h; PBST shaking and washing, 100 μL / well TMB substrate, 37°C incubation for 10min, 50 μL / well stop solution, read OD 450nm absorbance value.

[0069] 1.7 Aptamer specificity identification

[0070] To prove that the aptamer can effectively compete with free Neu5Gc and Neu5Gc-BSA conjugate, biotin-labeled aptamer was resuspended in 0.01M PBS to 0.8 μM, 95°C metal bath for 5min, then ice bath for 10min, gently mixed with equal volume of 20 μg / mL Neu5Gc-BSA and 20 μg / mL Neu5Gc standard, 100 μL / well into human positive antibody coated wells, 37°C incubation for 1h; avidin-HRP was used to capture the aptamer bound to human positive antibody, and OD 450nm absorbance value.

[0071] To prove that the aptamer can effectively compete with the natural binding state of Neu5Gc, knock out and wild type mouse serum diluted 1:500, 100 μL / well was added to the 96-well enzyme plate coated at 4°C overnight; biotin-labeled aptamer was resuspended in 0.01M PBS to 0.8 μM, immediately ice-bathed for 10 min after 5 min in a 95°C metal bath, and gently mixed with an equal volume of 14 μg / mL human positive antibody, 100 μL / well was added to the knock out and wild type mouse serum coated wells, and incubated at 37°C for 1 h; the anti-human secondary antibody-HRP was used to capture the bound human positive antibody, and the OD 450nm absorbance value at 450 nm was read.

[0072] 1.8 Aptamer affinity identification

[0073] Human anti-Neu5Gc positive antibody was taken, 28 μg / mL, 100 μL / well was added to the 96-well enzyme plate coated at 4°C overnight; biotin-labeled aptamer was diluted in 0.01M PBS to 50, 25, 12.5, 6.25, 3.125, 1.56, 0.78 nM, 100 μL / well was added to the coated wells after 5 min in a 95°C metal bath and immediately ice-bathed for 10 min, and incubated at 37°C for 1 h; avidin-HRP was used to capture the aptamer bound to the human positive antibody, and the OD 450nm absorbance value at 450 nm was read.

[0074] 2. Results and discussion

[0075] 2.1 SubB-His outer membrane protein expression bacteria and preparation of soluble protein

[0076] PCR was performed using SubB-His outer membrane protein expression bacteria as template, and the SubB-His gene fragment was successfully amplified, indicating that the SubB-pET-30a(+) plasmid was successfully constructed and transformed into Rosetta(DE3) competent cells. Using 0.5 mM IPTG, expression was induced at 20°C and 37°C, respectively. The supernatant and precipitate were separated by ultrasonic centrifugation, and identified by SDS-PAGE and Western-Blot, and SubB protein was successfully expressed, and the inclusion body was induced at 37°C to express a large amount of inclusion body, which was used for inclusion body renaturation purification. The solutions of each step of renaturation purification were identified by SDS-PAGE, and part of the higher content of impurities was washed away, realizing the preparation and preliminary purification of soluble SubB protein.

[0077] 2.2 Determination of SELEX screening rounds

[0078] The affinity of the purified biotin-labeled ssDNA and SubB protein obtained in each round of screening was measured by indirect ELISA. The screening round number was taken as the horizontal coordinate, and the OD value was taken as the vertical coordinate to make a dot plot. The optimal screening round number was determined according to the OD value. With the decrease of the amount of ssDNA input in each round, the concentration of ssDNA obtained in each round of purification also decreased accordingly, but the OD value of the positive well increased. As shown in FIG. 2, the OD value of the positive well increased from 0.2645 in the first round to 1.5 in the 11th and 12th rounds. Therefore, after 12 rounds of screening, a high-purity targeted ssDNA was obtained. Figure 3 As can be seen, the overall trend of the OD value is still rising. The OD value of the first round is 0.2645, and the OD values of the 11th and 12th rounds are about 1.5, and the OD value trend is stable. Therefore, after 12 rounds of screening, a high-purity targeted ssDNA has been obtained.

[0079] The OD value of the 5th round is 1.35, which is much higher than the OD value of the 4th round, which is 0.53, indicating that the 5th round of screening is effective. However, the OD value of the 6th round decreases to 0.74, indicating that the 6th round of screening may not have completely retained the advantage of the 5th round of ssDNA, but the OD value is still significantly enriched compared to the 4th round. The OD value of the 10th round decreases to 0.169, which is speculated to be because the amount of ssDNA input is further reduced in this round, and the reverse screening step is performed, so that the concentration of ssDNA obtained for PCR template in the positive screening is low, and therefore the OD value is low. However, as can be seen from the OD value of 1.541 in the 11th round, the 10th round of screening still retains ssDNA with high affinity, which is enriched to a high concentration after the 11th round.

[0080] 2.3 Selection of Advantageous Aptamer

[0081] Six oligonucleotide sequences with the highest degree of repetition (Table 1) were selected for indirect ELISA screening, and the results are shown in FIG. 2. Figure 4 1, 8, and 11 aptamers bind well to SubB protein, but only aptamer No. 11 (SEQ ID No. 1) 5'-ATGGTTGTAGGTCAGGTGGGTCGGGGCGGGTGGTGGTTCTTTTTGCTCG ATCGGGGGTGCATTCCGCTTACATTCTCG-3' also binds well to human positive antibody. According to the principle of minimum free energy, secondary structure prediction was performed using snapgene software, and aptamer No. 11 formed a neck ring structure ( Figure 5 ), with two QGRS regions, a G-score of 20 and 6, and good stability, which can be used for subsequent identification.

[0082] Table 1: Aptamer sequence

[0083]

[0084] 2.4 Determination of aptamer specificity and affinity

[0085] The 11th aptamer can effectively compete with free Neu5Gc, Neu5Gc-BSA and naturally combined Neu5Gc through competitive ELISA and differential competitive ELISA verification. When human positive antibodies are coated, the competition effect of the aptamer on free Neu5Gc and Neu5Gc-BSA is extremely significant (p<0.001) Figure 6 ), which indicates that the aptamer can effectively simulate free, Neu5Gc-BSA antigen epitopes, and the inhibition rate is about 25%, which is related to the proportion of free Neu5Gc and Neu5Gc-BSA antigen epitopes corresponding to the antibody. When wild and knockout mouse serum is coated, the competition effect of the aptamer is extremely significant (p<0.001), and the competition inhibition rate is 80%, and the OD 450nm value difference between the wild and knockout mouse serum coating groups is reduced from extremely significant (p<0.001) to significant (p<0.05) Figure 7 ). Although the OD 450nm value of the wild mouse serum coating group after the competition of the aptamer is close to that of the knockout mouse serum coating group, there is still a significant difference (p<0.05), which indicates that the 11th aptamer can simulate most of the naturally combined Neu5Gc antigen epitopes, but there are still a small part of the naturally combined Neu5Gc antigen epitopes that have not been successfully simulated. Therefore, a plurality of aptamers can be considered to be used in combination to cover most of the naturally combined Neu5Gc antigen epitopes.

[0086] The results of the indirect ELISA experiment are non-linearly fitted by using GraphPad software, and the results are shown in Figure 8 . Within a 95% confidence interval, the dissociation constant (K d ) of the 11th aptamer is calculated as 0.8498 nM, the corresponding affinity constant (K a ) is 1.17 x 10 9 L / mol, and the goodness of fit (R 2 ) is 0.9972, which indicates that the 11th aptamer has high affinity and is suitable for being used as a sensitive molecular probe in the detection and diagnosis field.

[0087] From the above examples, it can be concluded that the present application uses SELEX technology, takes SubB-His outer membrane protein expression bacteria and soluble SubB protein as screening targets, and screens the 11th aptamer which can effectively simulate free and various combined Neu5Gc from the ssDNA library. Compared with the limited types of existing antigens, the aptamer can be combined with more types of anti-Neu5Gc antibodies, as a molecular probe, the content of anti-Neu5Gc antibodies detected in the serum and related preparations is closer to the true level, and the Neu5Gc antigen content in the biological preparation can also be detected through the competition principle, and it is expected to be used as a Neu5Gc substitute for in vivo experiments due to its low immunogenicity.

[0088] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. An aptamer that simultaneously mimics free and bound Neu5Gc, characterized in that, The nucleotide sequence of the aptamer is shown as SEQ ID No.

1.

2. The aptamer of claim 1, wherein, The free Neu5Gc includes α-isomer free Neu5Gc.

3. The aptamer of claim 1, wherein, The bound Neu5Gc includes an artificially synthesized antigen.

4. The aptamer of claim 3, wherein, The artificially synthesized antigen includes Neu5Gc-BSA.

5. A kit for simultaneous analog of free and bound Neu5Gc, characterized in that, The aptamer of claim 1.

6. Use of the aptamer of claim 1 as a molecular probe in preparation of a reagent for detecting the content of anti-Neu5Gc antibody in serum preparation.

Images