The regulatory genes of flowering of Honeysuckle and its application

Abstract

The invention discloses a flowering regulating gene of honeysuckle and application thereof, and relates to the technical field of plant gene engineering. The flowering regulating gene of honeysuckle is AGL82, and the gene sequence thereof is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the regulating gene is shown in SEQ ID NO.2; the regulating gene can be cloned by RNA extraction and reverse transcription; the regulating gene is used for regulating the flowering period of honeysuckle and for constructing a plant overexpression vector, and the regulating gene can promote the early flowering of honeysuckle; an AGL82 gene related to the flower organ development of honeysuckle and its encoding protein sequence, as well as a method for preparing the AGL82 gene and primers required in the preparation process are provided, and the function of the AGL82 gene in promoting plant flowering is verified by successfully constructing an AGL82 gene overexpression vector, genetically transforming Arabidopsis thaliana and other technical means.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering technology, in particular to a flowering regulating gene of honeysuckle and application thereof. Background Art

[0002] Honeysuckle is a perennial evergreen shrub or vine of the Caprifoliaceae family and the Lonicera genus. It is one of the main basal plants of the traditional Chinese medicine "Shan Yinhua". Its medicinal parts are the dried buds and the newly opened flowers, which have high medicinal and economic value. Ordinary honeysuckle has poor resistance, short bud period, easy withering, low yield and active ingredient content; while the new varieties of bud-type honeysuckle, such as 'Longhua' and 'Jincuile', do not open their corollas during the flowering period, and the buds are neat and stick-shaped. The flowering period is as long as 15 to 25 days, which solves the problem of large-scale centralized picking difficulties in the same period, and provides new excellent germplasm resources for honeysuckle plants. In order to better guide actual production and cater to the development trend of future molecular breeding, it is very necessary to study the molecular mechanism behind the long bud period and neat and non-opening buds of bud-type honeysuckle.

[0003] The MADS-box gene family is a class of transcriptional regulatory factors with rich biological functions in plants. They are involved in regulating various stages of plant growth and development, especially closely related to flower morphogenesis. MADS-box genes play an important regulatory role in regulating the development of floral organs such as flowering time and corolla expansion. At present, MADS-box family genes have been cloned from a large number of different plant species, but there are very few reports on MADS-box related genes in Lonicera japonica. Only sporadic reports have been seen, such as the cloning and expression analysis of AP1, AGL19 genes and the gene AGL15 related to the extension of the bud period, as well as the screening of internal reference genes. According to existing literature reports, the key genes that regulate the long bud period and non-expansion of the corolla of Lonicera japonica need to be further explored and verified.

[0004] The AGL82 gene is a member of this gene family, and there are no research reports on it so far; the invention with application number 201710819491.6 discloses a sugarcane flowering regulatory protein ScFT-2 and its encoding gene. The prior art has not cloned the AGL82 gene from Lonicera japonica, and used the Lonicera japonica AGL82 gene as an entry point to study the function of the Lonicera japonica AGL82 gene and its application in the development of plant floral organs through vector construction, genetic transformation of Arabidopsis thaliana and other methods; therefore, based on this situation, there is an urgent need to develop a Lonicera japonica flowering regulatory gene and its application to meet the needs of actual use. Summary of the invention

[0005] In view of this, the present invention aims to address the deficiencies in the prior art, and its main purpose is to provide a regulatory gene for the flowering of Lonicera japonica and its application. It provides the AGL82 gene related to the organ development of Lonicera japonica and its encoding protein sequence, as well as a method for preparing the AGL82 gene and the primers required in the preparation process, and verifies the function of the AGL82 gene in promoting plant flowering through the successful construction of an AGL82 gene overexpression vector, genetic transformation of Arabidopsis thaliana and other technical means.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] A flowering regulating gene of Honeysuckle of Grey Felt, wherein the regulating gene is AGL82, and the gene sequence thereof is shown as SEQ ID NO.1; the amino acid sequence of the protein encoded by the regulating gene is shown as SEQ ID NO.2.

[0008] As a preferred solution: the regulatory gene can be cloned by RNA extraction and reverse transcription.

[0009] As a preferred embodiment: the method for cloning the regulatory gene comprises the following steps:

[0010] First: Using Lonicera japonica as the material, RNA was extracted, and the extracted RNA was reverse transcribed to generate the first chain of cDNA as a template for PCR amplification;

[0011] Second: sequence analysis was performed on the obtained AGL82 gene of Lonicera japonica and PCR reaction primers were designed;

[0012] Third: Using the first chain of Lonicera japonica cDNA as a template, AGL82 PCR reaction primer was used for PCR amplification. The PCR amplification product was subjected to 1.0% agarose gel electrophoresis, and the PCR product was recovered using an agarose gel purification recovery kit; the recovered PCR product was connected to the pTOPO vector and transformed into Escherichia coli DH5α competent cells, and the positive clones were picked and sequenced.

[0013] As a preferred solution: the PCR reaction primer is LmAGL82-F, and its primer sequence is: ATGGGACGAGCTAGAGTCAGAA.

[0014] As a preferred solution: the PCR reaction primer is LmAGL82-R, and its primer sequence is: CATGGCTAATCAGTAATTAATTGAAC.

[0015] As a preferred solution: the reaction system of PCR amplification is: 2×Phanta Max Buffer 12.5μL, dNTP Mix 0.5μL, SVP-F and SVP-R 1μL each, Phanta Max Super-Fidelity DNA Polymerase 0.5μL, cDNA template 1.5μL, ddH2O 8.0μL; the PCR reaction program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 1min, 35 cycles; 72℃ thorough extension for 5min; 12℃ continuous.

[0016] The application of the flowering regulating gene of the gray felt honeysuckle is used to regulate the flowering period of the gray felt honeysuckle.

[0017] As a preferred solution: the regulatory gene is used to construct a plant overexpression vector, and the regulatory gene can promote early flowering of Honeysuckle.

[0018] As a preferred solution: the specific method for constructing the plant overexpression vector is: constructing the pCAMBIA1301-LmAGL82 plant overexpression vector by homologous recombination, amplifying the target fragment using homologous recombination primers, and then recombining it into the linearized vector pCAMBIA1301 vector, transforming the recombination reaction into Escherichia coli and picking a single clone for identification and sequencing.

[0019] As a preferred solution: the regulatory gene is used to obtain transgenic plants.

[0020] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, it can be seen from the above technical scheme that the present application provides the AGL82 gene related to the organ development of honeysuckle and its encoding protein sequence, as well as a method for preparing the AGL82 gene and the primers required in the preparation process. The function of the AGL82 gene in promoting plant flowering is verified by the successful construction of an AGL82 gene overexpression vector, genetic transformation of Arabidopsis thaliana and other technical means. At the same time, an application path of the gene in plant trait improvement is also provided, indicating that the gene has good application prospects and provides valuable genetic resources for the cultivation of new varieties of flower medicinal materials and flower ornamental plants.

[0021] In order to more clearly illustrate the structural features and effects of the present invention, it is described in detail below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the ORF cloning of the LmAGL82 gene of Lonicera japonica of the present invention;

[0023] Figure 2 It is a schematic diagram of the NJ phylogenetic tree of the Lonicera japonica LmAGL82 protein of the present invention;

[0024] Figure 3 It is a schematic diagram of the expression pattern of the LmAGL82 gene of the present invention in different developmental stages of the varieties of Honeysuckle 'Longhua' and 'Jincuilei';

[0025] Figure 4 This is a schematic diagram of the PCR amplification fragment of the LmAGL82 recombinant bacterial solution of the present invention;

[0026] Figure 5 Schematic diagram of the screening and identification of the Arabidopsis transgenic strains of the present invention. DETAILED DESCRIPTION

[0027] The present invention Figures 1 to 5 As shown, a flowering regulatory gene of Lonicera japonica is AGL82, and its gene sequence is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the regulatory gene is shown in SEQ ID NO.2.

[0028] The regulatory gene can be cloned by RNA extraction and reverse transcription.

[0029] The method for cloning the regulatory gene comprises the following steps:

[0030] First: Using Lonicera japonica as the material, RNA was extracted, and the extracted RNA was reverse transcribed to generate the first chain of cDNA as a template for PCR amplification;

[0031] Second: sequence analysis was performed on the obtained AGL82 gene of Lonicera japonica and PCR reaction primers were designed;

[0032] Third: Using the first chain of Lonicera japonica cDNA as a template, AGL82 PCR reaction primer was used for PCR amplification. The PCR amplification product was subjected to 1.0% agarose gel electrophoresis, and the PCR product was recovered using an agarose gel purification recovery kit; the recovered PCR product was connected to the pTOPO vector and transformed into Escherichia coli DH5α competent cells, and the positive clones were picked and sequenced.

[0033] The PCR reaction primer is LmAGL82-F, and its primer sequence is: ATGGGACGAGCTAGAGTCAGAA; the PCR reaction primer is LmAGL82-R, and its primer sequence is: CATGGCTAATCAGTAATTAATTGAAC.

[0034] The reaction system of PCR amplification is: 2×Phanta Max Buffer 12.5μL, dNTP Mix 0.5μL, SVP-F and SVP-R 1μL each, Phanta Max Super-Fidelity DNA Polymerase 0.5μL, cDNA template 1.5μL, ddH2O 8.0μL; the PCR reaction program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 1min, 35 cycles; 72℃ thorough extension for 5min; 12℃ continuous.

[0035] The regulatory gene is used to regulate the flowering period of Honeysuckle.

[0036] The regulatory gene is applied to the construction of a plant overexpression vector, and the regulatory gene can promote early flowering of honeysuckle.

[0037] The specific method for constructing the plant overexpression vector is as follows: a homologous recombination method is used to construct a pCAMBIA1301-LmAGL82 plant overexpression vector, amplifying a target fragment using homologous recombination primers, and then recombining it into a linearized vector pCAMBIA1301 vector, transforming the recombination reaction into Escherichia coli and picking a single clone for identification and sequencing.

[0038] The regulatory gene is used to obtain transgenic plants.

[0039] Example 1: Cloning and molecular characterization analysis of LmAGL82 gene of Lonicera japonica:

[0040] (1) RNA was extracted from Lonicera japonica L. 'Longhua' variety and reverse transcribed to generate the first-chain cDNA, which was used as a template for PCR amplification.

[0041] (2) The specific primers were designed by sequence analysis of the LmAGL82 gene of L. grisea obtained from the transcriptome. The primer sequences for the PCR reaction are shown in Table 1:

[0042] Table 1: PCR reaction primers

[0043] Primer name Primer sequence (5'-3') LmAGL82-F ATGGGACGAGCTAGAGTCAGAA LmAGL82-R CATGGCTAATCAGTAATTAATTGAAC

[0044] (3) Using the first strand of L. grisea cDNA as a template, PCR amplification was performed using LmAGL82-specific primers. The reaction system (25 μL) included 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of SVP-F and SVP-R, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O. The PCR reaction procedure was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 1 min, 35 cycles; 72°C full extension for 5 min; 12°C continuous. After the reaction, the PCR amplification product was subjected to 1.0% agarose gel electrophoresis, and the PCR product was recovered using an agarose gel purification recovery kit. The recovered product was ligated with the pTOPO vector and transformed into E. coli DH5α competent cells. The positive clones were picked and sequenced.

[0045] (4) Bioinformatics analysis was performed on the LmAGL82 gene and its encoded protein obtained by cloning.

[0046] Result analysis: The CDS sequence of the gene was obtained from the transcriptome of Lonicera grisea. The cDNA of Lonicera grisea was used as a template and PCR amplification was performed by RT-PCR. The PCR amplification product was detected by 1% agarose gel electrophoresis. The results showed that a clear and obvious band appeared near the 850bp marker, which was consistent with the expected size. Figure 1 The positive single clones were identified and sent for sequencing. The sequencing results were compared and found to be consistent with the sequence in the transcriptome, as shown in SEQ ID NO.1.

[0047] The results of online analysis using EditSeq and ExPASy ProtParam showed that the open reading frame of the cloned LmAGL82 gene was 846, encoding a protein of 281 amino acids (SEQ ID NO.2), and its molecular formula was estimated to be C 1424 H 2221 N 389 O 440 S 13, the number of atoms is 4487, the relative molecular mass is 32247.42, the isoelectric point (Theoretical pI) is 6.06, the instability index is 34.59<40, and it is a stable protein. The aliphatic index is 69.43, and the hydropathicity coefficient (Grand average of hydropathicity) is -0.737, which is speculated to be a hydrophilic protein. WOLF PSORT was used to predict the subcellular localization online, and the results showed that the LmAGL82 protein was localized in the nucleus. TMHMM2.0 analysis found that LmAGL82 does not have a transmembrane region. SignalP 4.1 software predicts that the LmSVP protein does not have a signal peptide sequence and is a non-secretory protein.

[0048] To further understand the phylogenetic evolution of LmAGL82 protein, the amino acid sequences of MADS-box family with certain homology to LmAGL82 amino acid sequence were used to construct the phylogenetic tree using amino acid sequences of Glycine max, Nicotiana sylvestris, Solanum tuberosum, Diospyros lotus, Actinidia eriantha, Camellia lanceoleosa, Helianthus annuus, Impatiens glandulifera, Nicotiana tabacum, Nicotiana tomentosiformis, Rhododendron vialii, Salvia hispanica, Sesamumindicum, Solanum dulcamara, Camellia sinensis, etc. The results showed that the cloned gene of L. grisea belongs to AGL82 class ( Figure 2 ), named LmAGL82.

[0049] Example 2: Analysis of expression characteristics of LmAGL82 gene of Lonicera japonica:

[0050] The expression pattern of LmAGL82 gene in flower buds and leaves of Lonicera japonica cultivars 'Longhua' and 'Jincuilei' was studied by qRT-PCR.

[0051] (1) Total RNA was extracted from leaves, early flower buds (average flower bud length 14.49 mm) and late flower buds (average flower bud length 41.85 mm) of Lonicera japonica L. 'Longhua' and 'Jincuilei' varieties and reverse transcribed into cDNA;

[0052] (2) The 18S rRNA gene of Lonicera japonica was selected as the internal reference gene for qPCR analysis, and specific primers for the internal reference gene and the target gene were designed using PrimerPremier 6.0. The primers are shown in Table 2:

[0053] Table 2 Real-time fluorescence quantitative PCR primers for Lonicera japonica

[0054]

[0055] (3) Using the first-chain cDNA of L. glauca obtained by reverse transcription as a template, qPCR analysis was performed on the expression of LmAGL82 gene in different varieties, different tissues and different developmental stages of flower buds of L. glauca. Reaction system: 2×RealStar Green Fast Mixture PCR 5μL, Forward primer 0.4μL, Reverse primer 0.4μL, cDNA 1μL, ddH2O 3.2μL. Amplification program: pre-denaturation at 95℃ for 2min; denaturation at 95℃ for 15s, annealing at 60℃ for 30s, extension at 72℃ for 20s, and 40 cycles. After the reaction, a melting curve analysis was performed. The melting curve was 95℃ for 5s, 56℃ for 5s, and 95℃ continuously. Each sample was repeated 3 times, using 2 -ΔΔCt The relative expression levels of genes were calculated.

[0056] Result analysis:

[0057] Using 18S rRNA of Lonicera japonica as the internal reference gene, qRT-PCR technology was used to analyze the expression of LmAGL82 gene in different tissues (flowers and leaves) and at different flower development stages of Lonicera japonica ‘Longhua’ and ‘Jincuilei’ varieties. Figure 3 The results showed that the expression level of LmAGL82 gene in 'Jincuilei' was higher than that in 'Longhua', whether in leaves or in the early and late stages of flower buds. There was a very significant difference in the expression of LmAGL82 gene in flower buds and leaves between 'Longhua' and 'Jincuilei' (**P<0.01), and the expression level in leaves was significantly higher than that in flower buds. In 'Longhua', the expression level of LmAGL82 gene in the early and late stages of flower buds was not significantly different, and in 'Jincuilei', the expression level of LmAGL82 gene in the early stage of flower buds was significantly higher than that in the late stage of flower buds.

[0058] Example 3: Construction of LmAGL82 gene overexpression vector of Lonicera japonica and genetic transformation of Arabidopsis thaliana

[0059] (1) Construction of plant overexpression vector:

[0060] According to the restriction sites contained in the LmAGL82 gene sequence itself and the characteristics of the multiple cloning site contained in the plant overexpression vector pCAMBIA1301 used, the most suitable enzymes Nco I and EcoR I were selected, and specific primers with vector homologous sequences were designed. The primer names and sequences are as follows:

[0061] p-LmAGL82-F:ACGGGGGACTCTTGA CCATGG ATGGGACGA GCTAGAGTCAGAA;

[0062] p-LmAGL82-R: GCAACAGGATTCAAT CTTAAG CATGGCTAAT CAGTAATTAATTGAAC;

[0063] The pCAMBIA1301 vector was double-digested with restriction endonucleases QuickCut Nco I and EcoR I, and the correctly sequenced bacterial solution in Example 1 was used as a template to amplify the insert fragment by PCR. The restriction digestion products and PCR amplification products were detected by electrophoresis, recovered, and purified, and then constructed using the ClonExpress II OneStep Cloning Kit for homologous recombination reaction. After obtaining the recombinant product, Escherichia coli DH5α competent cells were transformed. After culture, the single clones were identified and sequenced, the sequencing results were compared, and the correctly sequenced bacterial solution plasmid was extracted.

[0064] The extracted recombinant vector plasmid was transformed into Agrobacterium GV3101, and the Agrobacterium containing the pCAMBIA1301-LmAGL82 vector plasmid was genetically transformed into Arabidopsis thaliana using the floral organ infection method.

[0065] Table 3: Plasmid pCAMBIA1301 double restriction enzyme digestion reaction system

[0066]

[0067]

[0068] Reaction conditions: 37°C for 1h.

[0069] Table 4: Recombination reaction system

[0070]

[0071] The reaction conditions were: 37°C for 30 min.

[0072] (2) Screening and identification of Hyg resistance in transgenic Arabidopsis thaliana:

[0073] The T1 generation seeds of the infected Arabidopsis plants were collected, disinfected and sown on 1 / 2MS medium (with 30 mg / L Hyg), and the wild-type Arabidopsis seeds were disinfected and sown on 1 / 2MS medium (without antibiotics) as a control, vernalized for 2 days in a dark condition at 4°C refrigerator, and then placed in a plant culture room for culture. The plant growth environment is 60% relative humidity; constant temperature 20-22 degrees; photoperiod is 16h light, 8h dark; light intensity is 80-200μmol / M 2 After 8-15 days of growth, the normally growing T1 generation Arabidopsis seedlings were transplanted into the culture medium for further cultivation.

[0074] The DNA of Arabidopsis thaliana seedlings screened for Hyg resistance in the T0 generation and wild-type Arabidopsis thaliana WT plants was extracted, and PCR detection was performed using the hygromycin resistance gene-specific primers HPT-F (GGTCGCGGAGGCTATGGATGC) and HPT-R (GCTTCTGCGGGCGA TTTGTGT). Arabidopsis seedlings with correct PCR identification results were further cultured, and individual plants were harvested as T2 generation seeds, and screening was continued according to the above steps until the T3 generation was obtained.

[0075] PCR reaction system: 2×Taq mix 10μL; genomic DNA 2μL; primer 0.8μL; ddH2O 7.2μL.

[0076] PCR reaction conditions: 94℃3min; 94℃30sec, 60℃30sec, 72℃1min; 35 cycles; 72℃5min.

[0077] (3) Phenotypic observation of transgenic Arabidopsis:

[0078] The growth of LmAGL82 transgenic Arabidopsis and wild-type Arabidopsis was observed, and the time of scape emergence (based on the scape extending 1 cm), the time of first flower bud appearance, the time of corolla expansion and the number of rosette leaves at the corresponding time were counted. Each strain included 12 plants.

[0079] Table 5 Phenotypic statistics of T2 Arabidopsis thaliana transgenic with LmAGL82 gene

[0080]

[0081] Result analysis:

[0082] The pCAMBIA1301-LmAGL82 plant overexpression vector was constructed by homologous recombination. The target fragment was amplified using homologous recombination primers and then recombined into the linearized vector pCAMBIA1301. The recombination reaction was transformed into Escherichia coli and a single clone was picked for identification and sequencing. The results of electrophoresis after PCR in the bacterial solution ( Figure 4 ) indicated that the target fragment was connected to the vector, and the sequencing results were consistent with the sequence in the transcriptome, indicating that the pCAMBIA1301-LmAGL82 plant overexpression vector was successfully constructed.

[0083] The pCAMBIA1301-LmAGL82 vector plasmid was genetically transformed into Arabidopsis thaliana by Agrobacterium using the floral organ infection method. After the seeds matured, they were collected and dried, disinfected and sown on 1 / 2MS solid culture medium. The wild-type Arabidopsis thaliana was used as the control. The robust Arabidopsis thaliana seedlings after resistance screening were transplanted and continued to be cultured, and DNA was extracted for PCR detection. The test results are as follows: Figure 5 After hygromycin screening and PCR identification, a total of 16 LmAGL82 transgenic Arabidopsis lines were obtained. After the seeds of the identified transgenic Arabidopsis plants matured, the seeds were collected and screened to the T3 generation for use.

[0084] The wild-type Arabidopsis WT was used as a control to observe the development of transgenic Arabidopsis overexpressing LmAGL82. The results showed that the bolting time and flower bud appearance time of LmAGL82 transgenic plants were significantly earlier than those of wild-type Arabidopsis. Among them, LmAGL82-#2 bolted and flowered the earliest, with only 23.85 days for the bolt to reach 1 cm, the first flower bud to appear at 32.67 days, and the corolla to unfold at 35.56 days; while the wild-type Arabidopsis could only bolt 1 cm after 30.86 days, the first flower bud to appear at 40.25 days, and the corolla to unfold at 42.38 days. In addition to the bolting and corolla unfolding time, the number of rosette leaves at flowering is often used to reflect the development time of Arabidopsis in the study of flowering period, thereby measuring the change of flowering period. This study found that the number of rosette leaves corresponding to the opening of the first flower of LmAGL82 transgenic plants was also different from that of wild-type Arabidopsis, with the number of rosette leaves of LmAGL82-#2 being 9.85 and that of wild-type Arabidopsis being 12.66. These results indicate that heterologous expression of LmAGL82 in Arabidopsis can promote early flowering of plants.

[0085] Using wild-type Arabidopsis WT as a control, the growth and development of transgenic Arabidopsis overexpressing LmAGL82 were observed and it was found that the corolla expansion time of the three strains of LmAGL82 transgenic plants was 35.56d, 40.72d, and 36.25d, respectively, which was significantly earlier than that of the wild-type plants, indicating that this gene can promote early flowering of Arabidopsis.

[0086] The design focus of the present invention is that the present application provides the AGL82 gene related to the organ development of honeysuckle and its encoding protein sequence, as well as a method for preparing the AGL82 gene and the primers required in the preparation process, and verifies the function of the AGL82 gene in promoting plant flowering through the successful construction of an AGL82 gene overexpression vector, genetic transformation of Arabidopsis thaliana and other technical means. At the same time, it also provides an application path for the gene in plant trait improvement, indicating that the gene has good application prospects and provides valuable genetic resources for the cultivation of new varieties of flower medicinal materials and flower ornamental plants.

[0087] The above description is only a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any slight modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

[0088]

[0089]

[0090]

Claims

1. A gene that promotes flowering of Honeysuckle, characterized in that: The gene is AGL82, and its gene sequence is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; the gene can be cloned by RNA extraction and reverse transcription; The method for cloning the gene comprises the following steps: First: Using Lonicera japonica as the material, RNA was extracted, and the extracted RNA was reverse transcribed to generate the first chain of cDNA as a template for PCR amplification; Second: sequence analysis was performed on the obtained AGL82 gene of Lonicera japonica and PCR reaction primers were designed; Third: Using the first strand of Lonicera japonica cDNA as a template, PCR amplification was performed using AGL82 PCR reaction primers. The PCR amplification product was subjected to 1.0% agarose gel electrophoresis, and the PCR product was recovered using an agarose gel purification and recovery kit. The recovered PCR product was connected to the pTOPO vector and transformed into Escherichia coli DH5α competent cells, and the positive clones were picked and sequenced. The PCR reaction primer is LmAGL82-F, and its primer sequence is: ATGGGACGAGCTAGAGTCAGAA; the PCR reaction primer is LmAGL82-R, and its primer sequence is: CATGGCTAATCAGTAATTAATTGAAC; The reaction system for the PCR amplification was: 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of SVP-F and SVP-R, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O; the PCR reaction program was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; complete extension at 72°C for 5 min; and continuous at 12°C.

2. An application of the gene for promoting flowering of Honeysuckle as claimed in claim 1, characterized in that; Overexpression of the gene is used to promote flowering of Honeysuckle.

3. The use of the gene for promoting flowering of Honeysuckle according to claim 2, characterized in that; The gene is applied to the construction of a plant overexpression vector, and the gene can promote early flowering of Honeysuckle.

4. The use of the gene for promoting flowering of Honeysuckle according to claim 3, characterized in that: The specific method for constructing the plant overexpression vector is: constructing the pCAMBIA1301-LmAGL82 plant overexpression vector using the homologous recombination method, amplifying the target fragment using homologous recombination primers, and then recombining it into the linearized vector pCAMBIA1301 vector, transforming the recombination reaction into Escherichia coli and picking a single clone for identification and sequencing.

5. The use of the gene for promoting flowering of Honeysuckle according to claim 2, characterized in that: The gene is used to obtain transgenic plants.

Images