An ODC1 gene biomarker for prognostic assessment of lung adenocarcinoma treated with pemetrexed / cisplatin combination chemotherapy and its application
By using the ODC1 gene as a biomarker and employing CRISPR/Cas9 knockout technology and qPCR detection, the problem of insufficient prediction of chemotherapy sensitivity in lung adenocarcinoma patients in existing technologies has been solved, enabling effective evaluation and individualized treatment of pemetrexed/cisplatin combined chemotherapy.
Patent Information
- Application Number
- CN202311103497.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-30
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2043-08-30
AI Technical Summary
The lack of highly sensitive and specific biomarkers in current technologies for predicting the sensitivity and tolerance of lung adenocarcinoma patients to pemetrexed/cisplatin combination chemotherapy makes it difficult for some patients to benefit from chemotherapy.
Using the ODC1 gene as a biomarker, we assessed the sensitivity of lung adenocarcinoma patients to pemetrexed/cisplatin combined chemotherapy by detecting its expression level. We verified the function of the ODC1 gene using CRISPR/Cas9 knockout technology and combined it with qPCR to detect the expression level of ODC1 in the patient's tumor tissue. We also provided a kit for prognostic assessment.
It can effectively predict the response of lung adenocarcinoma patients to chemotherapy, improve treatment effectiveness, reduce chemotherapy resistance, provide individualized treatment plans, and improve patient prognosis.
Smart Images

Figure CN117106914B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection technology, specifically relating to an ODC1 gene marker for prognostic assessment of lung adenocarcinoma treated with pemetrexed / cisplatin combined chemotherapy and its application. Background Technology
[0002] Lung cancer, the most common and deadliest cancer, ranks first in both incidence and mortality among all cancers, with lung adenocarcinoma being the most prevalent subtype. Cisplatin and pemetrexed exert their killing or inhibitory effects on tumor cells by damaging cellular DNA and blocking folate metabolism, respectively. Cisplatin / pemetrexed combined with chemotherapy is a classic first-line treatment for lung adenocarcinoma; however, a significant proportion of lung adenocarcinoma patients tolerate the combined chemotherapy well and do not benefit from it. Therefore, a series of reliable biomarkers are urgently needed to assist clinicians in predicting the sensitivity of lung adenocarcinoma patients to chemotherapy, which is of great significance for improving patient treatment outcomes and reducing the social burden. Currently, some reports have proposed potential biomarkers (such as thymidine synthase) for predicting the sensitivity of lung adenocarcinoma patients to combined chemotherapy. However, due to cumbersome testing procedures, low accuracy, and validation only in cell or animal models, their clinical application remains very limited. Further research is needed to find biomarkers with higher sensitivity, specificity, and application value for individualized chemotherapy regimens for lung adenocarcinoma patients.
[0003] Ferroptosis, first proposed by Dr. Brent R. Stockwell of Columbia University in 2012, is a novel, iron-dependent, programmed cell death mechanism distinct from apoptosis, necrosis, and pyroptosis. Its main mechanism involves external stimuli inducing an imbalance of intracellular reactive oxygen species (ROS), leading to the peroxidation of polyunsaturated fatty acids (PUFAs) on the cell membrane in the Fenton reaction catalyzed by ferrous iron. This results in alterations to the phospholipid bilayer structure, cell membrane rupture, and ultimately, cell death. Ferroptosis, as an important mode of cell death, participates in a series of pathophysiological processes. In recent years, feroptosis has received widespread attention from researchers, with numerous studies on its mechanisms and applications in disease diagnosis and treatment, particularly in cancer. Current research reports that chemotherapy induces feroptosis, and that intervening in feroptosis-related genes can regulate tumor feroptosis levels, thereby improving tumor resistance to pemetrexed / cisplatin chemotherapy. Summary of the Invention
[0004] The main objective of this invention is to provide an ODC1 gene biomarker for prognostic assessment of lung adenocarcinoma treated with pemetrexed / cisplatin combined chemotherapy. Based on cell experiments and clinical data verification, it was found that the ODC1 gene (ornithine decarboxylase) plays an important mediating role in ferroptosis, and its expression level is correlated with the sensitivity of cells to ferroptosis inducers and combined chemotherapy treatment. As a biomarker, it can help predict the sensitivity or tolerance of lung adenocarcinoma patients to chemotherapy, filling a gap in this field.
[0005] Another objective of this invention is to provide a kit for evaluating the sensitivity of lung adenocarcinoma to pemetrexed / cisplatin combined chemotherapy, which can intuitively determine whether lung adenocarcinoma patients are sensitive to or tolerate tumor cell ferroptosis induced by pemetrexed / cisplatin combined chemotherapy, thereby assessing the suitability of patients to use combined chemotherapy for the treatment of lung adenocarcinoma.
[0006] The above-mentioned objective of the present invention is achieved through the following technical solution:
[0007] This invention provides the application of the ODC1 gene in the preparation of a reagent for prognostic assessment of lung adenocarcinoma treated with pemetrexed / cisplatin combined chemotherapy, wherein the full name of the ODC1 gene is Ornithine Decarboxylase, and its ENSEMBLE number is ENST00000234111.9.
[0008] Preferably, the prognostic assessment of pemetrexed / cisplatin combined chemotherapy for lung adenocarcinoma includes determining whether the lung adenocarcinoma patient is sensitive to or tolerates pemetrexed / cisplatin combined chemotherapy.
[0009] This invention also provides the application of reagents for detecting ODC1 expression levels in the preparation of a diagnostic product for prognostic assessment of lung adenocarcinoma treated with pemetrexed / cisplatin combined chemotherapy.
[0010] The present invention also provides a kit for evaluating the sensitivity of lung adenocarcinoma to pemetrexed / cisplatin combined chemotherapy, which includes a reagent for detecting the expression level of ODC1.
[0011] This invention also provides a method for evaluating the sensitivity of lung adenocarcinoma to pemetrexed / cisplatin combined chemotherapy, comprising the following steps:
[0012] Step 1: Collect test samples;
[0013] Step 2: The expression level of ODC1 in the test sample was detected using the kit for assessing the sensitivity of lung adenocarcinoma to pemetrexed / cisplatin combined chemotherapy. Lung adenocarcinoma patients with high ODC1 expression were sensitive to pemetrexed / cisplatin combined chemotherapy, indicating a good response to pemetrexed / cisplatin combined chemotherapy.
[0014] Preferably, the test sample comes from tumor tissue from a patient with lung adenocarcinoma.
[0015] As a preferred approach, the median ΔCT value of ODC1 relative to the internal reference glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is 8.31, was used as the cutoff value. If the expression of ODC1 in the sample is low, i.e., ΔCT > 8.31, it indicates that the patient is tolerant to pemetrexed / cisplatin combined chemotherapy; if the expression of ODC1 in the sample is high, i.e., ΔCT ≤ 8.31, it indicates that the patient is sensitive to pemetrexed / cisplatin combined chemotherapy.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] Preliminary findings using whole-genome CRISPR / Cas9 knockout screening technology revealed that ODC1 knockout significantly enhanced the tolerance of A549 lung adenocarcinoma cells to the ferroptosis inducer Erastin, a result further confirmed in cell experiments. Considering that pemetrexed / cisplatin-based chemotherapy also induces ferroptosis, ODC1 was knocked out or overexpressed in both A549 and H358 lung adenocarcinoma cell lines, followed by treatment with appropriate doses of pemetrexed / cisplatin-based chemotherapy. It was found that ODC1 knockout significantly increased cell tolerance to chemotherapy, while overexpression of ODC1 significantly enhanced the killing effect of chemotherapy on lung adenocarcinoma cells. Similarly, treatment of A549 and H358 cells with the ODC1-specific inhibitor DFMO also significantly improved the sensitivity of lung adenocarcinoma cells to chemotherapy. Therefore, ODC1 is proposed as a prognostic biomarker for assessing the sensitivity of lung adenocarcinoma patients to pemetrexed / cisplatin-based chemotherapy. In addition, the expression of ODC1 in surgical specimens from 34 patients who received pemetrexed / cisplatin combined chemotherapy was detected by qPCR, and their prognostic outcomes were analyzed. The results showed that patients with high ODC1 expression were more sensitive to chemotherapy than those with low expression, indicating a better prognosis. Therefore, the expression level of ODC1 can be used to predict whether lung adenocarcinoma patients are sensitive or resistant to pemetrexed / cisplatin combined chemotherapy. Attached Figure Description
[0018] Figure 1 The figures shown are drug toxicity curves of A549 and H358 lung adenocarcinoma cells with ODC1 knockout or overexpression and controls, respectively, against different concentrations of Erastin or pemetrexed / cisplatin.
[0019] Figure 2 The cell viability of A549 and H358 lung adenocarcinoma cells in the examples was obtained after pretreatment with the ODC1-specific inhibitor DFMO and control cells, followed by further treatment with Erastin or pemetrexed / cisplatin.
[0020] Figure 3 The lipid peroxidation levels of A549 and H358 lung adenocarcinoma cells with ODC1 knockout or overexpression and controls, respectively, after treatment with Erastin or pemetrexed / cisplatin, are shown in the examples.
[0021] Figure 4 The example shows the prognostic result of ODC1 expression level in lung adenocarcinoma tissue. Detailed Implementation
[0022] The present invention will be further described below with reference to the embodiments:
[0023] Example 1
[0024] 1. High-throughput screening of drug resistance genes across the entire genome using CRISPR / Cas9
[0025] Methods: First, a series of sgRNAs were constructed based on an existing CRISPR / Cas9 knockout library and transfected into lung adenocarcinoma cells A549. An appropriate viral load was used to ensure that each cell contained only one sgRNA or no sgRNA. Cells without sgRNA were then treated with puromycin to kill them, resulting in each A549 cell having a randomly knocked-out gene. Subsequently, the knockout cells were treated with the ferroptosis inducer Erastin for selection. Sensitive cells were inhibited or even died, while the normal proliferation of resistant cells remained unaffected. High-throughput sequencing analysis of sgRNAs in cells before and after treatment allowed for the inference of changes in cell viability after knocking out each gene.
[0026] Results: After this step, it was found that the ODC1 knockout cell subpopulation increased significantly after Erastin treatment compared with the control. The experimental data are shown in Table 1:
[0027] Table 1
[0028] Gene <![CDATA[Log(Fc) Erastin ]]> <![CDATA[Log(Fc) DMSO ]]> <![CDATA[Log(Fc) Erastin -Log(Fc) DMSO ]]> ODC1 2.736 0.253 2.483
[0029] Here, Log(Fc) Erastin Log(Fc) represents the logarithmic change in the expression level of a certain sgRNA in cells after 3 days of Erastin treatment compared to before treatment. DMSO The value represents the control group, which is the logarithmic change in expression of the same sgRNA after 3 days of DMSO treatment compared to before treatment. This suggests that ODC1 knockout enhances the resistance of lung adenocarcinoma cells to Erastin.
[0030] 2. Changes in resistance to Erastin and pemetrexed / cisplatin after knockout or overexpression of ODC1 in lung adenocarcinoma cells.
[0031] Methods: ODC1 was knocked out or overexpressed in two types of lung adenocarcinoma cells, A549 and H358, respectively, and corresponding controls were established. The transfected cells were then treated with Erastin or pemetrexed / cisplatin, respectively, and cell viability was detected using CCK8 assay.
[0032] Results: Compared with the control group, cells with ODC1 knockout showed significantly higher tolerance to Erastin and pemetrexed / cisplatin, while overexpression of ODC1 led to increased cellular sensitivity to these two drugs. Figure 1 Similarly, treatment of lung adenocarcinoma cells with the ODC1-specific inhibitor DFMO also resulted in a significant increase in cell tolerance to Erastin and pemetrexed / cisplatin. Figure 2 ).
[0033] Furthermore, the BODIPY lipid peroxidation assay showed that pemetrexed / cisplatin combination treatment significantly increased lipid peroxidation levels in lung adenocarcinoma cells, suggesting that combination chemotherapy led to ferroptosis, while ODC1 knockout significantly alleviated this effect. Figure 3 Therefore, it can be inferred that knocking out ODC1 significantly enhances the tolerance of lung adenocarcinoma cells to pemetrexed / cisplatin-induced ferroptosis.
[0034] 3. ODC1 expression in lung adenocarcinoma patients receiving pemetrexed / cisplatin combination chemotherapy and its relationship to patient prognosis.
[0035] The expression of ODC1 in tumor tissues of 34 patients with lung adenocarcinoma who received pemetrexed / cisplatin combination chemotherapy was detected using qRT-PCR. Patients were then followed up for more than 5 years to compare the association between ODC1 and patient prognosis. The specific steps are as follows:
[0036] (1) Extract total RNA from tissue samples.
[0037] (2) Detection of ODC1 expression using qRT-PCR: The expression of ODC1 was detected using qRT-PCR provided by Yisheng Company. The qPCR SYBR GreenMaster Mix was tested on a Thermo Fisher QuantStudio 5 real-time PCR instrument. The primer sequences were as follows:
[0038] ODC1:
[0039] Forward: GGCTGTACCGATCCTGAGACCTT;
[0040] Reverse: GCCACCGCCAATATCAAGCAGA;
[0041] Internal reference gene GAPDH:
[0042] Forward: AGAAGGCTGGGGCTCATTTG;
[0043] Reverse:AGGGGCCATCCACAGTCTTC.
[0044] All the primers mentioned above were provided by Shanghai Sangon Biotech Co., Ltd.
[0045] (3) Follow-up on patient survival (>5 years). The follow-up period is once a year, with a maximum follow-up period of 10 years.
[0046] (4) Survival curve analysis results. The median ΔCT value of ODC1 relative to the internal reference GAPDH, 8.31, was used as the cutoff value to distinguish between high and low expression groups, corresponding to different survival outcomes, such as... Figure 4 As shown, the results indicate that high ODC1 expression in tumor tissue samples of lung adenocarcinoma patients receiving pemetrexed / cisplatin combination therapy signifies a better prognosis and suggests a good response to combination chemotherapy. Therefore, ODC1 expression levels can be used to predict the sensitivity of lung adenocarcinoma patients to pemetrexed / cisplatin treatment.
[0047] In summary, this invention first employs high-throughput technology to comprehensively and systematically analyze the changes in sensitivity of A549 lung adenocarcinoma cells to the ferroptosis inducer Erastin after random gene knockout. The analysis revealed that lung adenocarcinoma cells with ODC1 knockout showed greater tolerance to Erastin. Furthermore, it was verified that ODC1 knockout led to resistance to pemetrexed / cisplatin combined chemotherapy, indicating that ODC1 expression levels are suitable for predicting the sensitivity of lung adenocarcinoma patients to pemetrexed / cisplatin combined chemotherapy. Subsequently, the expression differences of this gene in lung adenocarcinoma patients and its application value in determining sensitivity to pemetrexed / cisplatin combined chemotherapy were further confirmed. By detecting ODC1 expression in tumor samples from lung adenocarcinoma patients, if ODC1 expression in the sample was low (i.e., ΔCT > 8.31), the patient was resistant to pemetrexed / cisplatin combined chemotherapy; if ODC1 expression was high (i.e., ΔCT ≤ 8.31), the patient was sensitive to pemetrexed / cisplatin combined chemotherapy.
[0048] The above description represents a preferred embodiment of the present invention, but the present invention should not be limited to the content disclosed in this embodiment. Therefore, any equivalent or modified versions made without departing from the spirit of the present invention fall within the scope of protection of the present invention.
Claims
1. Detection ODC1 The application of expression level reagents in the preparation of detection products for prognostic assessment of pemetrexed / cisplatin combined chemotherapy for lung adenocarcinoma, among which... ODC1 The full name of the gene is Ornithine Decarboxylase.
Citation Information
Patent Citations
Application of ODC gene in preparation of product for detecting or treating muscle angiogenesis blocking
CN116463409A