A SNP molecular marker related to tomato fruit gloss and its application

Abstract

The present invention discloses a SNP molecular marker associated with the glossiness of tomato fruits and its application, belonging to the technical field of vegetable molecular breeding. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 4; there is an A / G base mutation at the 34bp position of the sequence shown in SEQ ID NO: 4. The present invention develops a PARMS SNP molecular marker associated with the glossiness of tomato fruits, and develops specific molecular marker primers for identifying the glossiness of tomato fruits according to the positioning results, and identifies the difference in glossiness of tomato fruits according to the polymorphism at the detection marker site; the PARMS SNP molecular marker developed by the present invention is co-segregated with the glossiness phenotype of tomato fruits, and can determine the glossiness of fruits in the seedling stage of tomatoes, thereby reducing the cost of seed production, and has important value for the auxiliary breeding and rapid identification of tomato fruit high gloss varieties.

Description

Technical Field

[0001] The invention relates to the technical field of vegetable molecular breeding, and in particular to a SNP molecular marker related to the glossiness of tomato fruits and an application thereof. Background Art

[0002] Tomato (Solanum lycopersicum L.) is one of the most widely cultivated vegetable crops in the world. It is rich in nutrients such as folic acid, vitamin C, potassium, and lycopene. Tomato fruit has bright color and high nutritional value. As a fresh fruit and vegetable, it is loved by people for its unique flavor and rich taste, and the planting area is increasing year by year. my country is the country with the largest tomato production and planting area. In recent years, with the development of my country's social economy and the improvement of people's living standards, people pay attention to the nutrition and flavor of vegetables and fruits when consuming them. Some varieties with bright colors, neat appearance and smooth skin are highly favored by people. The appearance quality of tomatoes includes the color, gloss, shape, etc. of the fruit. The glossiness of the fruit is an indicator to evaluate the ability of the fruit surface to reflect light. The stronger the light reflection ability, the higher the light chromaticity. Glossiness is an important appearance trait of cherry tomato fruit. Cherry tomatoes with high glossiness are deeply loved by consumers because of their bright and beautiful appearance, and their market price is higher than that of cherry tomatoes with low glossiness. From the perspective of the domestic consumer market, as people's consumption level improves, consumers have higher and higher requirements for tomatoes, and fruits and vegetables with good appearance have become the first choice of today's consumers. The appearance and sensory quality of tomatoes has also become one of the most direct factors affecting the purchasing psychology of most consumers. Tomatoes with good appearance quality have a better promotion market. In production, varieties with good gloss are popular with farmers because their prices are higher than those of varieties with poor gloss, which makes varieties with poor gloss gradually eliminated. It is necessary to breed a batch of high-gloss tomato varieties that meet market demand.

[0003] However, in the tomato breeding system, the evaluation and selection of quality traits takes a long time and needs to wait until the tomato fruit matures normally (Li Xiaolei et al., 2010). In conventional breeding, the identification of the gloss trait of the fruit skin needs to wait until the fruit matures, which takes a long time (Zhou Bingyu et al., 2013). Although molecular marker-assisted selection breeding can effectively overcome the defects of traditional breeding, shorten the breeding cycle, and accelerate the breeding process (Zhu Mingtao et al., 2010; Xu Xiangyang et al., 2011; Xu et al., 2015), the current selection of varieties for gloss traits is relatively blind, and there is no trait-linked molecular marker that can be effectively applied to the molecular marker-assisted breeding process. It is urgent to carry out research on the fine positioning of gloss traits.

[0004] As the third generation of molecular marker technology, single nucleotide polymorphism (SNP) has been widely used in germplasm resource research, variety authenticity identification, molecular marker-assisted breeding and other fields due to its wide distribution in biological genomes, rich polymorphism, easy detection and statistics, and high-throughput automated detection. For single base variation, there are currently a variety of PCR-based SNP molecular marker detection methods, such as enzyme-amplified polymorphic sequence method, high-resolution melting curve, allele-specific PCR and competitive allele-specific PCR (KompetitiveAllele Specific PCR).

[0005] PARMS (Penta-primer amplification refractory mutation system) is a PCR detection technology developed based on the specific resolution of SNP single-base variant sites. This technology can quickly and easily detect SNP allele genotypes. PARMS SNP uses 5 primers for PCR reaction, of which 2 fluorescent universal primers are included in PARMS2×Master Mix. The remaining 3 are marker-specific primers, which need to be custom-designed and synthesized according to the purpose of the experiment. Among these 3 primers, one is a marker locus specific primer (Locus specific primer) and the other two are SNP allele specific primers (Allele specific primer). The 5' of these two primers are added with a specific universal adapter sequence of 21 bases for matching amplification with the fluorescent universal primer. The adapter sequence matching FAM fluorescence is 5'-GAAGGTGACCAAGTTCATGCT-3', and the adapter sequence matching HEX fluorescence is 5'-GAAGGTCGGAGTCAACGGATT-3'. The basic principle of designing marker primers can adopt the general primer design rules. The primer length is 18 to 30 bp, and the amplified fragment is less than 250 bp (including primers). The shorter the better, provided that the primer design conditions are met. Allele 1 and Allele 2 specific amplification primers with two different universal adapter primer sequences are combined with the corresponding SNP DNA template after DNA renaturation. The PARMS PCR enzyme and buffer system can ensure strict allele-specific amplification. With the Locus specific amplification primer, after the first two rounds of PCR, a PCR amplification product with a universal adapter sequence is formed. At this time, the universal probe with a reporter fluorescence and a fluorescence quenching group (no fluorescence signal due to the FRET effect when there is no amplification) can be used as a template for PCR amplification using the PCR amplification product with a universal adapter sequence. Once the amplification is successful, the fluorescence quenching group on the fluorescent probe dissociates from the reporter group, and the FRET effect disappears. At this time, a fluorescence scan can be performed to detect the corresponding fluorescence signal, so it can be known whether the corresponding allele exists.

[0006] PARMS technology has high accuracy and good stability; the detection cost is low. For the detection of different SNP sites, only three common primers for the corresponding sites need to be designed, and the primers with fluorescent labels are universal primers; it is compatible with crude DNA alkaline boiling extraction, and the sample preparation time is extremely short, which is particularly suitable for large-scale high-throughput detection platforms. In recent years, PARMS SNP detection technology has been increasingly widely used in population genetics research, disease diagnosis, plant breeding and other fields. Therefore, the identification of SNP molecular markers related to the glossiness of tomato fruits based on PARMS technology is used to determine whether the tomato material being tested is a high-gloss material, which is of great value for the auxiliary breeding and rapid identification of high-gloss varieties of tomato fruits. Summary of the invention

[0007] The purpose of the present invention is to provide a SNP molecular marker related to the glossiness of tomato fruit and its application to solve the problems existing in the above-mentioned prior art. The PARMS SNP molecular marker developed by the present invention is co-segregated with the tomato fruit glossiness phenotype, which can determine the glossiness of the fruit in the tomato seedling stage, thereby reducing the seed production cost, and is of great value for the auxiliary breeding and rapid identification of tomato fruit high gloss varieties.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The invention provides a SNP molecular marker related to the glossiness of tomato fruits, whose nucleotide sequence is shown in SEQ ID NO: 4; there is an A / G base mutation at the 34 bp position of the sequence shown in SEQ ID NO: 4.

[0010] The present invention also provides a primer set for detecting the SNP molecular marker, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1, a first reverse primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a second reverse primer with a nucleotide sequence as shown in SEQ ID NO: 3.

[0011] Furthermore, the 5' ends of the first reverse primer and the second reverse primer are connected to fluorescent groups of different colors.

[0012] Furthermore, the first reverse primer is connected to a FAM fluorescent group, and the second reverse primer is connected to a HEX fluorescent group.

[0013] The invention also provides a kit for identifying the glossiness of tomato fruits, comprising the primer set.

[0014] The present invention also provides a method for detecting the glossiness of tomato fruit, comprising the following steps:

[0015] Using the DNA of the tomato sample to be tested as a template, performing PCR amplification using the primer set to obtain an amplified product;

[0016] The glossiness of the tomato fruit to be tested is determined based on the fluorescence signal of the amplified product.

[0017] Furthermore, if the fluorescence signal is HEX, the tomato to be tested is judged to be genotype A, and the fruit gloss is low; if the fluorescence signal is FAM, the tomato to be tested is judged to be genotype G, and the fruit gloss is high.

[0018] Furthermore, the reaction system of the PCR amplification includes: 2×PARMS master mix 5 μL, forward primer 0.15 μL, first reverse primer 0.15 μL, second reverse primer 0.4 μL, DNA template 10-100 ng, ddH2O supplemented to 10 μL.

[0019] Furthermore, the reaction conditions of the PCR amplification are: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

[0020] The present invention also provides an application of the SNP molecular marker, the primer set or the kit in screening tomato fruit varieties with high glossiness.

[0021] The present invention discloses the following technical effects:

[0022] The present invention develops a PARMS SNP molecular marker associated with the glossiness of tomato fruits, the SNP site of which is located at the 63041874th base of chromosome 1 of tomato. According to the positioning result, a specific molecular marker primer for identifying the glossiness of tomato fruits is developed, and the difference in glossiness of tomato fruits is identified according to the polymorphism at the detection marker site. The PARMS SNP molecular marker developed by the present invention is co-segregated with the glossiness phenotype of tomato fruits, and the glossiness of fruits can be determined in the seedling stage of tomatoes, thereby reducing the cost of seed production, and has important value for the auxiliary breeding and rapid identification of tomato fruit varieties with high glossiness. At the same time, it can also accelerate the breeding process of new tomatoes or other fruit and vegetable vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1This is a GWAS analysis of tomato fruit gloss; the orange origin in the figure shows the SNP detected at the 63041874bp position of chromosome 1 that is significantly associated with tomato fruit gloss;

[0025] Figure 2 is the gloss value of the test material; the gloss values ​​of the fruits of 31 low-gloss materials are between 1.1 and 3.6, and the gloss values ​​of the fruits of 31 high-gloss materials are between 8.9 and 18.7. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1

[0032] Experimental materials: Tomato population materials (from Zhu et al., 2018, Cell 172, 249-261).

[0033] 1. Mining of SNPs associated with tomato fruit gloss: Based on the previous study of the fruit gloss of 297 germplasm resources (from Guangtao Zhu, et al., Rewiring of the Fruit Metabolome in Tomato Breeding. Cell 172, 2018, Pages 249-261.e12), genome data were analyzed for genome-wide association studies (GWAS) with fruit gloss. A SNP significantly associated with tomato fruit gloss was detected at position 63041874 bp on chromosome 1 (NCBI accession number SL2.50 (GCF_000188115.3) of the tomato reference genome) (see Figure 1 ), and an A / G / -base mutation was found.

[0034] 2. Design of molecular marker primer combination for PARMS detection of SNP: According to the SNP site obtained from the GWAS analysis results, search for the 63041874bp position of chromosome 1, design a locus specific primer as the forward primer, and two SNP allele specific primers (Allele specific primers). Allele G primer is connected to the FAM blue fluorescent linker sequence as the first reverse primer; Allele A primer is connected to the HEX green fluorescent linker sequence as the second reverse primer. The primer sequences are shown in Table 1:

[0035] Table 1 Molecular marker primer combinations for detecting SNPs

[0036]

[0037] Note: The underlined sequence in Allele G primer is the FAM fluorescent tag sequence; the underlined sequence in Allele A primer is the HEX fluorescent tag sequence.

[0038] 3. Screening of test germplasm: 31 high-gloss and 31 low-gloss materials were selected from the GWAS population. The gloss of the 62 test materials was as follows: Figure 2 As shown, the fruit gloss values ​​of 31 low-gloss materials are between 1.1 and 3.6, and the fruit gloss values ​​of 31 high-gloss materials are between 8.9 and 18.7.

[0039] 4. Sample material processing: Take a leaf with a length and width of about 1 cm and put it into a deep well plate (96 wells 1.2 ml); add 100 μL of 0.3 M sodium hydroxide, (Shanghai Jingxin tissue grinder) 50 Hz grind for 2 min (until the sample is completely ground); after grinding, centrifuge at 3000 rpm for 1 min, and boil in water bath for 2 min; then add 200 μL 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, and boil in water bath for 2 min again; after the water bath is completed, centrifuge at 3000 rpm for 1 min, take the supernatant and dilute it 20 times, freeze at -20 ° C, and use it as a template for subsequent PCR amplification.

[0040] 5. PCR amplification: The PCR amplification reaction system is shown in Table 2 (2×PARMS master mix provided by Wuhan Jingpeptide Biotechnology Co., Ltd.):

[0041] Table 2 PCR amplification reaction system

[0042]

[0043] The PCR amplification reaction conditions are as follows (dual-head 384PCR instrument ABI Gene Amp 9700):

[0044] Table 3 PCR amplification reaction conditions

[0045]

[0046] The sequence of the amplified fragment is as follows (SEQ ID NO: 4):

[0047] TTACGATTTAACGATAAATATCCCTTATTTTTAA[R]AATATTAGGAATTTTATCTATTCGGTT;

[0048] Note: R represents the A / G base mutation site.

[0049] 6. Genotyping: After PCR, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors. The results are shown in Table 1. The genotyping results of the PARMS test of 31 low-gloss materials showed that the genotyping results of 25 materials were HEX, which was consistent with the genotype A of the material itself, confirming that the SNP molecular marker site mutated to A, and the fruit gloss of the tomato material to be tested was low; in addition, there was a deletion in the site in 3 materials, and the genotyping results were FAM, and 2 materials did not show the test results; the genotyping results of the PARMS test of 31 high-gloss materials were all FAM, which was completely consistent with the genotype G of the material, confirming that the SNP molecular marker site mutated to G, and the fruit gloss of the tomato material to be tested was high. The results of PARMS testing of 62 test materials were comprehensively counted, and the PCR genotyping results of 52 materials were consistent with the material genotype. The accuracy of this molecular marker reached 90.3%, indicating that the use of this SNP molecular marker in PARMS experiments on the test samples can effectively detect their genotypes and can be used for the identification of tomato fruit color and auxiliary breeding.

[0050] Table 4 Comparison of genotypes and SNP typing results of PARMS detection in 62 test materials

[0051]

[0052]

[0053] Note: Left: 31 parts of low gloss material; Right: 31 parts of high gloss material.

[0054] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for detecting the glossiness of tomato fruit, characterized in that: The following steps are involved: Using the DNA of the tomato sample to be tested as a template, PCR amplification is performed using a primer set to obtain an amplified product; Judging the glossiness of the tomato fruit according to the fluorescence signal of the amplified product; If the fluorescence signal is HEX, it is judged that the SNP molecular marker site of the tomato to be tested has mutated to A, and the glossiness of the fruit is low; if the fluorescence signal is FAM, it is judged that the SNP molecular marker site of the tomato to be tested has mutated to G, and the glossiness of the fruit is high; The primer set includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1, a first reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2, and a second reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3; the first reverse primer is connected to a FAM fluorescent group, and the second reverse primer is connected to a HEX fluorescent group; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 4; there is an A / G base mutation at the 34 bp position of the sequence shown in SEQ ID NO:

4.

2. The method according to claim 1, characterized in that The PCR amplification reaction system includes: 2×PARMS master mix 5 μL, forward primer 0.4 μL, first reverse primer 0.15 μL, second reverse primer 0.15 μL, DNA template 10-100 ng, ddH2O supplemented to 10 μL.

3. The method according to claim 1, characterized in that The reaction conditions of the PCR amplification were: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min, 10 cycles; 94°C for 20 s, 57°C for 1 min, 32 cycles.

4. An application of the primer set described in claim 1 in screening high gloss varieties of tomato fruits, characterized in that: Using the DNA of the tomato sample to be tested as a template, PCR amplification is performed using a primer set to obtain an amplified product; Judging the glossiness of the tomato fruit according to the fluorescence signal of the amplified product; If the fluorescence signal is HEX, it is judged that the SNP molecular marker site of the tomato to be tested has mutated to A, and the glossiness of the fruit is low; if the fluorescence signal is FAM, it is judged that the SNP molecular marker site of the tomato to be tested has mutated to G, and the glossiness of the fruit is high; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 4; there is an A / G base mutation at the 34 bp position of the sequence shown in SEQ ID NO: 4.

Images