Vectors for introduction of functional nucleic acids and proteins
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NAT UNIV CORP KUMAMOTO UNIV
- Filing Date
- 2022-01-26
- Publication Date
- 2026-06-19
Smart Images

Figure GDA0004541347230000101 
Figure GDA0004541347230000131 
Figure GDA0004541347230000181
Abstract
Description
[0001] Cross-references to related applications
[0002] This international application claims priority to Japanese Patent Application No. 2021-010606, filed on January 26, 2021, with the Japan Patent Office, the entire contents of which are incorporated herein by reference. Technical Field
[0003] This disclosure relates to a vector that assists in the stable introduction of nucleic acids and proteins into cells. Background Technology
[0004] In recent years, there has been an urgent need to develop a technology that can safely and efficiently introduce proteins and nucleic acids, such as those used to induce genome editing, into cells. These proteins and nucleic acids include protein / nucleic acid complexes like Cas9 RNP and nucleic acid molecules like siRNA.
[0005] CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats - CRISPR associated proteins 9) is a novel genome editing technology capable of cleaving DNA double strands and deleting, substituting, or inserting at any location in the genome sequence. To induce genome editing via CRISPR-Cas9, the Cas9 protein and guide RNA (nucleic acid) need to be introduced into the cell. Common methods for introduction include introducing plasmid DNA encoding the Cas9 protein and guide RNA, introducing messenger RNA (mRNA) and guide RNA encoding Cas9, and introducing a complex of Cas9 protein and guide RNA (Cas9 RNP). Among these, the method of directly introducing pre-assembled Cas9 RNPs is the most popular due to its high genome editing efficiency, safety, and convenience (Non-Patent Literature 1, 2). Because Cas9 RNPs are membrane-impermeable, a vector is required to deliver them into the cell. Non-viral carriers such as cationic materials (lipids / lipoparticles) (Non-Patent Literature 3-7), nanoparticles (Non-Patent Literature 8-10), and hetero-interacting cationic polymers (Non-Patent Literature 11 and 12) can be used. However, Cas9 RNPs have zwitterionic and complex surface structures derived from Cas9 (protein), resulting in low interaction with cationic materials. While multilayer nanoparticles or hetero-interacting cationic polymers can interact with the basic amino acids of Cas9, they are not suitable for the stereostructure and charge distribution of Cas9 RNPs. On the other hand, in-situ polymerized nanocapsules (NCs) have been reported to provide suitable monomers based on the surface structure of Cas9 RNPs (molecular imprints), thereby enabling more efficient loading of Cas9 RNPs (Non-Patent Literature 13). The cross-linking between NC monomers is biodegradable, thus enabling efficient genome editing of Cas9 RNPs through intracellular dynamic control. However, the preparation of NCs requires not only the addition of interacting monomers but also many steps (nitrogen substitution / reflux, dialysis, freeze-drying), thus hindering the use of NCs and the retargeting of genes.
[0006] Polyrotaxane (PRX) is a polymeric compound with a structure formed by threading multiple macrocyclic molecules, such as cyclodextrin (CD), through axial molecules like PEG, and possessing large caps at both ends of the axial molecules to prevent dissociation of the macrocyclic molecules (Non-Patent Documents 14-19). It has been reported that the CD of PRX can move along the axial molecules (Non-Patent Document 20). Therefore, the modified cationic charge on the CD of PRX can move flexibly and interact strongly with genes (Non-Patent Documents 21 and 22), nucleic acids (Non-Patent Document 23), and acidic proteins (Non-Patent Documents 24 and 25). For example, it has been reported that a compound (DMAE-PRX) formed by introducing a cationic N,N-dimethylaminoethyl (DMAE) into the CD of PRX forms a polyionic complex with anionic plasmid DNA, which is stable and thus facilitates gene introduction. Furthermore, a cell stripping agent that introduces amino groups into the macrocyclic molecules of PRX has also been reported (Patent Document 1).
[0007] Furthermore, a molecule was designed in which the two ends of the axial molecule of DMAE-PRX are bonded to the end cap via a structure that can be cleaved under reducing conditions. This allows the end cap to detach and release CD after gene introduction, thereby promoting nucleic acid release within the cell. It has been reported that, compared to non-releasing DMAE-PRX, the functionality of introduced siRNA and proteins can be enhanced by using this molecule (Non-Patent Literature 26 and 27). Furthermore, it has been reported that the use of a multi-armed PRX can improve blood retention (Non-Patent Literature 28). Additionally, it has been reported that the release of plasmid DNA under reducing conditions within cells can be improved by using a multi-armed PRX formed by bonding DMAE to α-cyclodextrin via a disulfide linker, and a multi-armed PRX formed by bonding a functional peptide has also been reported (Non-Patent Literature 29).
[0008] Existing technical documents
[0009] Patent documents
[0010] Patent Document 1: International Publication WO2015 / 025815
[0011] Non-patent literature
[0012] Non-patent literature 1: S. Kim et al., Genome Res., 24:112-1019 (2014).
[0013] Non-patent literature 2: M.wang et al., Proc. Natl. Acad. Sci., 113: 2868-2873 (2015).
[0014] Non-patent literature 3: Gao, X. et al., Nature 553, 217-221 (2018).
[0015] Non-patent literature 4: Wei, T. et al., Nat Commun 11, 3232 (2020).
[0016] Non-patent literature 5: Lee, K. et al., Elife, 6 (2017).
[0017] Non-patent literature 6: Wang, Y. et al., ACS Appl Mater Interfaces 10, 31915-31927 (2018).
[0018] Non-patent literature 7: Taharabaru, T. et al., ACS Appl Mater Interfaces; 12, 21386-21397 (2020).
[0019] Non-patent literature 8: Lee, K. et al., Nat Biomed Eng 1, 889-901 (2017).
[0020] Non-patent literature 9: Lee, B. et al., Nat Biomed Eng 2, 497-507 (2018).
[0021] Non-patent literature 10: Ch, EY et al., J Nanobiotechnology 17, 19 (2019).
[0022] Non-patent literature 11: Liu, C. et al., Sci Adv 5, eaaw8922 (2019).
[0023] Non-patent literature 12: Rui, Y. et al., Sci Adv 5, eaay3255 (2019).
[0024] Non-patent literature 13: Chen, G. et al., Nat Nanotechnol 14, 974-980 (2019).
[0025] Non-patent literature 14: Akira Harada et al., Nature, 356:325-327 (1992).
[0026] Non-patent literature 15: Akira Harada et al., Chem. Rev., 109: 5974-6023 (2009).
[0027] Non-patent literature 16: Jun Araki et al., Macromolecules, 38:7524-7527 (2005).
[0028] Non-patent literature 17: Wenz, G. et al., Chemical Reviews 106, 782-817 (2006).
[0029] Non-patent literature 18: Tamura, A. et al., Chem Commun (Camb) 50, 13433-13446 (2014).
[0030] Non-patent literature 19: Higashi, T. et al., Chem Pharm Bull (Tokyo) 67, 289-298 (2019).
[0031] Non-patent literature 20: Yasuda, Y. et al., J Am Chem Soc 141, 9655-9663 (2019).
[0032] Non-patent literature 21: Ooya, T. et al., Journal of the American Chemical Society 128, 3852-3853 (2006).
[0033] Non-patent literature 22: Emami, MR et al., Advanced Therapeutics 2, 1900061 (2019).
[0034] Non-patent literature 23: Tamura, A. et al., Biomaterials 34, 2480-2491 (2013).
[0035] Non-patent literature 24: Tamura, A. et al., Sci Rep 3, 2252 (2013).
[0036] Non-patent literature 25: Tamura, A. et al., Macromol Biosci 15, 1134-1145 (2015).
[0037] Non-patent literature 26: Atsushi Tamura et al., Biomaterials; 34:2480-2491 (2013).
[0038] Non-patent literature 27: Atsushi Tamura et al., Sci Rep; 3:2252 (2013).
[0039] Non-patent literature 28: Ying Ji et al., Biomaterials; 192:416-428 (2019).
[0040] Non-patent literature 29: Michael R. Enami et al., Adv. Therap.; 2:1900061 (2019). Summary of the Invention
[0041] The technical problem that the invention aims to solve
[0042] To efficiently introduce nucleic acid / protein complexes such as Cas9 RNP or biopolymers such as proteins and nucleic acids into cells using non-viral vectors, multiple barriers are required, including: introducing the biopolymer into the cell; rapidly escaping the biopolymer from the endosome to prevent degradation; releasing the biopolymer into the cytoplasm; and transporting the biopolymer to the nucleus. However, complexes such as Cas9 RNP are amphoteric substances consisting of a positively charged Cas9 protein and a negatively charged guide RNA, and their three-dimensional structure is relatively complex. Therefore, the following problems exist: it is difficult to form complexes with non-viral vectors such as cationic liposomes or cationic polymers, and the efficiency of introduction into cells is low (TaoWan. Et al., Journal of Controlled Release; 322:236-247. (2020)).
[0043] Technical solutions to the problem
[0044] The inventors of this application investigated and explored superior vectors, discovering that vectors formed by introducing amino groups into the macrocyclic molecules of polyrotaxane (PRX) exhibit flexible and stable binding to proteins or nucleic acids upon mixing, and can be effectively absorbed into cells. Furthermore, it was found that PRX vectors with amino-modified macrocyclic molecules can achieve excellent gene editing effects when introducing Cas9 / sgRNA. Moreover, it was found that by repeatedly designing modifying groups, using modifying portions that have a monovalent proton at neutral pH and a divalent proton at acidic pH (e.g., diethylenetriamine (DET) groups with both secondary and amino groups) to modify the macrocyclic molecules of PRX, the complex is effectively released from the endosome after absorption into the cell. Thus, DET-modified PRX achieves excellent gene editing effects and the silencing effect exhibited by siRNA.
[0045] Furthermore, it was discovered that introducing intracellular degradable bonds between the terminal cap and the axial molecule, and / or between the modified amino groups on the macrocyclic molecule and the macrocyclic molecule, promotes the dissociation of the carrier from nucleic acids / proteins in the cytoplasm. Thus, a carrier has been successfully developed that not only binds to and is absorbed into cells more efficiently than previous carriers, but also effectively releases from the endosome after introduction into the cell, followed by dissociation in the cytoplasm—features that were previously unattainable with carriers. Using the carrier disclosed herein, nucleic acids / proteins can be introduced into cells very efficiently and simply.
[0046] The effects of the invention
[0047] The modified PRX disclosed herein binds to proteins / nucleic acids simply by mixing and is effectively absorbed into cells upon contact only. It also automatically escapes from the endosome and dissociates from the carrier within the cell, thus enabling its use as an excellent carrier for the introduction of nucleic acids / proteins. Attached Figure Description
[0048] Figure 1A This is a diagram showing the structure of Cas9 RNP and the charges of amino acids and phosphates. Figure 1B This is a schematic diagram showing the structure of BAEE-PRX (Amino-PRX(1G)). Figure 1C This is a diagram showing the structure (automatic molecular imprinting) of the BAEE-PRX / Cas9 RNP complex.
[0049] Figure 2 This is a graph showing the zeta potential of the Cas9 RNP complexes using BAEE-PRX and BAEE-DEX. The vertical axis represents the zeta potential (mV), and the horizontal axis represents the imprinting rate of the amino group (%). Each value represents the average ± SE of 3–4 experiments. "*" indicates p < 0.05 compared to the BAEE-DEX complex.
[0050] Figure 3 This graph shows the cellular uptake of BAEE-PRX and Cas9 RNP complexes in HeLa GFP cells at various mixing ratios. Values represent the mean ± SE of 5–6 experiments.
[0051] Figure 4A This is a TEM image of a single Cas9 RNP. Figure 4B This is a TEM image of the BAEE-PRX / Cas9 RNP complex. Figure 4C This is a TEM image of the BAEE-DEX / Cas9 RNP complex. Figures 4A to 4C In the text, the scale bar is 50 nm.
[0052] Figure 5A This diagram shows the stability of the BAEE-PRX and Cas9 RNP complexes, as well as the BAEE-DEX and Cas9 RNP complexes, in the absence and presence of heparin. It is a photograph of the Cas9 RNP complexes cultured with heparin, stained with ethidium bromide, after electrophoresis on an agarose S gel. Numerical values represent the heparin / sgRNA ratio (w / w). Figure 5B This graph shows the stability of the BAEE-PRX and Cas9 RNP complexes and the BAEE-DEX and Cas9 RNP complexes in the absence and presence of heparin, and represents the percentage of residual complexes (%). +BAEE-PRX represents the BAEE-PRX complex, and +BAEE-DEX represents the BAEE-DEX complex. The vertical axis represents the percentage of residual complexes (%), and the horizontal axis represents the heparin / sgRNA ratio (w / w). The percentage of residual complexes was quantified using ImageJ software based on the band intensity ratio of the complexes and released Cas9 RNPs. Each value represents the mean ± SE of 3–4 experiments. "*" indicates p < 0.05 compared to the BAEE-DEX complex.
[0053] Figure 6A This graph shows the uptake of Cas9 RNP complexes with various cationic polymers in HeLa cells. The horizontal axis represents the type of cationic polymer, shown from left to right as: non-cationic polymer (Cas9 RNPalone), BAEE-PRX (Amino-PRX(1G)), BAEE-DEX, linear-polyethyleneimine (L-PEI) (2.5kDa), L-PEI (25kDa), branched-polyethyleneimine (B-PEI) (2kDa), polyamidoamine dendrimer (Dendrimer) (G2), Dendrimer (G3), Dendrimer (G4), and CRISPRMAX results. The concentration of Cas9 RNP was 14.6 nM. Values represent the mean ± SE of four experiments. Figure 6B This diagram shows the chemical structure of the control cationic polymer. L-PEI represents linear polyethyleneimine, B-PEI represents branched PEI, PLL represents poly-L-lysine hydrobromide, and Dendrimer (G2-4) represents polyamide-amine dendritic polymer (G2-4) (df). Furthermore, the dashed lines in the chemical structure of B-PEI represent C9-10 alkyl groups (alkyl groups with 9-10 carbon atoms). Figure 6C This is a table showing the number of amino groups and molecular weight of the control cationic polymer.
[0054] Figure 7 This graph shows the cell viability of HeLa cells treated with a complex at pH 7.4 and pH 5.5, where the complex is a mixture of PRX modified with various amino groups and Cas9 RNP. The concentration of Cas9 RNP was set at 29.2 nM. The amount of the mixed polymer was set to 50% amino groups relative to Cas9 RNP. Values represent the average ± SE of 3–4 experiments. "*" indicates p < 0.05 compared to the complex at pH 7.4.
[0055] Figure 8 This figure illustrates the uptake of PRX complexes modified with various amino groups and Cas9 RNP in HeLa cells. The concentration of Cas9 RNP was set at 14.6 nM. The amount of the mixed polymer was set to 50% amino group relative to Cas9 RNP. Values represent the mean ± SE of 9 experiments.
[0056] Figure 9A This graph illustrates the genome editing activity of complexes of various amino-modified PRX (BAEE-PRX, DET-PRX, and DMAE-PRX) with Cas9 RNP in HeLa / GFP cells. The vertical axis represents the percentage (%) of knocked-out GFP. From left to right, the results for each group are shown for Cas9 / sgGFP concentrations of 29.2 nM, 58.4 nM, and 116.8 nM, and for sgCont concentration of 116.8 nM. Values represent the mean ± SE of 3–4 experiments. Figure 9B This graph illustrates the genome editing activity of complexes of various amino-modified PRX (BAEE-PRX, DET-PRX, and DMAE-PRX) with Cas9 RNP in HeLa / GFP cells. The vertical axis represents the percentage of GFP knocked out. From left to right, the results for 20%, 50%, 100%, and 100% sgCont are shown for each group. The concentration of Cas9 RNP was set at 29.2 nM. Values represent the mean ± SE of six experiments.
[0057] Figure 10This graph shows the cell viability of HeLa cells treated with the complex at pH 7.4 and pH 5.5, where the complex is a DET-PRX / Cas9 RNP complex and a DET-DEX / Cas9 RNP complex. The concentration of Cas9 RNP was set to 29.2 nM. The amount of the mixed polymer was set to 50% amino relative to Cas9 RNP. Values represent the mean ± SE of 3–4 experiments. "*" indicates p < 0.05 compared to the complex at pH 7.4.
[0058] Figure 11 This is a schematic diagram illustrating the highly efficient endosome disruption effect of the DET-PRX complex, which is generated through the rotational effect of DET-modified macrocyclic molecules.
[0059] Figure 12A This is a schematic diagram of end-cap degradable PRX releasing Cas9 RNP. Figure 12B This is a diagram showing the chemical formula of the candidate end-cap connector. R1 represents the end-cap side, and R2 represents the axial molecular side.
[0060] Figure 13 This is a graph showing the genome editing activity of the Cas9 RNP complex using DET-PRX with various end-cap degradable linkers (amides, carbamates, disulfides, and ketals). The vertical axis represents the percentage (%) of knocked-out GPF. The Cas9 RNP concentration was set at 29.2 nM. All values represent the mean ± SE of three experiments.
[0061] Figure 14A This is a schematic diagram of brush-like degradable PRX releasing Cas9 RNP. Figure 14B This is a diagram showing the structure of an amino group that is modified with α-CD hydroxyl groups and has endosome disruptive and GSH cleavage capabilities.
[0062] Figure 15A This figure illustrates the genome editing activity of the Cas9 RNP complex using a mixture of DET-PRX and Cys-PRX. The molar ratio of DET units to Cys units was set to 1:1. The concentration of Cas9 RNP was set to 29.2 nM. Values represent the mean ± SE of nine experiments. "*" indicates p < 0.05 compared only with Cas9 RNP. Figure 15B This is a graph showing the genome editing activity of the Cas9 RNP complex using Cys-DET-PRX. The concentration of Cas9 RNP was set at 29.2 nM. Values represent the mean ± SE of six experiments.
[0063] Figure 16AThis is a mechanistic diagram illustrating the effect of GSH concentration on the genome editing activity of Cys-DET-PRX. Figure 16B This is a graph showing the genome editing activity at various GSH concentrations. The vertical axis represents the relative value (GFP knockout efficiency relative to cells stably expressing GFP) when the genome editing effect of treating 0 mM GSH and pre-cultured Cys-DET-PRX / Cas9 RNP complex is set to 1. The horizontal axis represents the GSH concentration (mM). The Cas9 RNP concentration was set to 29.2 nM. Each value represents the mean ± SE of 6 experiments.
[0064] Figure 17 This is a comparison graph showing the genome editing activity of CRISPRMAX / Cas9 RNP and Cys-DET-PRX / Cas9 RNP. Values represent the mean ± SE of six experiments.
[0065] Figure 18 This is a schematic diagram of the process leading to efficient genome editing by Cys-DET-PRX, which includes: forming a complex with Cas9 RNP via automated molecular imprinting; disrupting the membrane through protonation and α-CD rotation in the endosome; degradation of the brush linker and release of Cas9 RNP in the cytosol; and nuclear translocation of Cas9 RNP.
[0066] Figure 19A This is a graph showing the particle size of Cys-DET-PRX / Cas9 RNP. Each value represents the average of three experiments ± SE. Figure 19B This is a graph showing the zeta potential of the Cys-DET-PRX / Cas9 RNP. Each value represents the average ± SE of three experiments. Figure 19C This is a graph showing the rate of DET-PRX degradation after treatment with hydroxyesterase. Values represent the mean ± SE of four experiments.
[0067] Figure 20 This is a diagram illustrating the RNAi activity of various amino-modified PRX-siRNA complexes in HeLa / GFP cells. (Lipofectamine) TM The volume ratio of 2000 to siRNA was set at 3.75. Values represent the mean ± SE of six experiments.
[0068] Figure 21This is a graph comparing the genome editing activities of CRISPRMAX / Cas9 RNP and Cys-DET-PRX / Cas9 RNP in vivo. The vertical axis represents the relative values of fluorescence intensity within the tumor of mice transplanted with HeLa GFP cells when the sample was directly applied to the tumor. Each value represents the mean ± SE of experiments with 3–5 mice.
[0069] Figure 22 This graph illustrates the RNAi activity of various amino-modified PRX / siRNA complexes in HeLa / GFP cells. The charge ratio of Amino-PRX to siRNA was set to 10. Values represent the mean ± SE of six experiments. "*" indicates p < 0.05 compared to siRNA alone. This indicates that p < 0.05 compared to +DMAE-PRX. This indicates a p < 0.05 compared to +BAEE-PRX. Furthermore, +BAEE-PRX represents BAEE-PRX / siRNA, +DET-PRX represents DET-PRX / siRNA, and +DMAE-PRX represents DMAE-PRX / siRNA.
[0070] Figure 23 This figure shows the RNAi activity of the Amino-PRX(3G) / siRNA complex in HeLa / GFP cells. The charge ratio of Amino-PRX(3G) to siRNA was set to 10. "*" indicates p < 0.05 compared to siRNA alone. This indicates a p < 0.05 compared to +Amide-DET-PRX. Furthermore, siGFP alone indicates siRNA alone, +Amide-DET-PRX indicates amide-DET-PRX / siRNA, +Carbamate-DET-PRX indicates carbamate-DET-PRX / siRNA, +Disuphide-DET-PRX indicates disulfide-DET-PRX / siRNA, and +Ketal-DET-PRX indicates ketal-DET-PRX / siRNA.
[0071] Figure 24 This indicates a complex of Amino-PRX(5G) and siRNA or Lipofectamine. TM A graph showing the cell viability of HeLa cells after treatment with the 2000+ siRNA complex. (Lipofectamine) TMThe volume ratio of 2000 to siRNA was set to 3.75. Furthermore, the charge ratio of Amino-PRX (5G) to siRNA was set to 10. Values represent the mean ± SE of 7–8 experiments. "*" indicates the ratio with Lipofectamine. TM 2000 / siRNA comparison p<0.05.
[0072] Figure 25 This graph shows the gene knockout activity of the Amino-PRX(5G) / ASO complex in HeLa GFP cells. Values represent the mean ± SE of six experiments. "*" indicates p < 0.05 compared to ASO alone. Indicates +Lipofectamine TM 2000 vs. p<0.05.
[0073] Figure 26 This indicates the presence of a complex of Amino-PRX (5G) and ASO or Lipofectamine. TM A graph showing the cell viability of HeLa cells after treatment with the 2000+ASO complex. (Lipofectamine) TM The volume ratio of 2000 to ASO was set at 3.75. Furthermore, the charge ratio of Amino-PRX (5G) to ASO was set at 10. Values represent the mean ± SE of 7–8 experiments. "*" indicates the ratio with Lipofectamine. TM 2000 / ASO comparison p<0.05.
[0074] Figure 27 This graph shows the gene knockout activity of the Amino-PRX(5G) and gapmer-type ASO complex in HeLa GFP cells. Values represent the mean ± SE of three experiments. Furthermore, GFP gapmer represents a single gapmer-type ASO, +5G NP2 represents Amino-PRX(5G)NP2 / gapmer-type ASO, +5G NP5 represents Amino-PRX(5G)NP5 / gapmer-type ASO, and +5G NP10 represents Amino-PRX(5G)NP10 / gapmer-type ASO.
[0075] Figure 28This is a fluorescence image showing the intracellular β-gal enzyme activity in HeLa cells treated with the Amino-PRX(5G) / β-Gal complex. In the figure, the SPiDER-β-Gal column represents fluorescence derived from SPiDER-β-Gal (green), the Hoechst33342 column represents fluorescence of stained cell nuclei (blue), the Merge column represents the image after combining the two fluorescences, and the FC column represents the phase difference image. Furthermore, +Amino-PRX(5G)NC2 represents Amino-PRX(5G)NC2 / β-gal, +Amino-PRX(5G)NC5 represents Amino-PRX(5G)NC5 / β-gal, and +Amino-PRX(5G)NC10 represents Amino-PRX(5G)NC10 / β-gal. NC represents the ratio of amino groups in Amino-PRX(5G) to acidic amino acid residues (COOH) in β-gal.
[0076] Figure 29 This graph shows the expression of mCherry in HeLa cells after treatment with the Amino-PRX(5G) and mCherry mRNA complex. Values represent the mean ± SE of three experiments. Additionally, +Lipo2000 in the graph indicates Lipofectamine. TM 2000 / mCherry mRNA, +5G NP0.5 represents Amino-PRX(5G)NP0.5 / mCherry mRNA, +5G NP0.75 represents Amino-PRX(5G)NP0.75 / mCherry mRNA, +5G NP1 represents Amino-PRX(5G)NP1 / mCherry mRNA, +5G NP2 represents Amino-PRX(5G)NP2 / mCherry mRNA.
[0077] Figure 30 This graph represents the genome editing activity of various Amino-PRX and Cas9 RNP complexes in HeLa GFP cells. Values represent the mean ± SE of three experiments. The concentration of Cas9 RNP was set at 29.2 nM. "*" indicates a control group with p < 0.05. This indicates that compared with Cas9 RNP, p < 0.05. This indicates a p < 0.05 compared to CRISPRMAX. Furthermore, in the figure, Cas9 RNP represents a standalone Cas9 / sgGFP RNP, CRISPRMAX(cont) represents CRISPRMAX / Cas9 RNP(sgCont), CRISPRMAX represents CRISPRMAX / Cas9 RNP(sgGFP), low-substitution Amino-PRX(5G)(cont) represents low-substitution Amino-PRX(5G) / Cas9 RNP(sgCont), and low-substitution Amino-PRX(5G) represents low-substitution Amino-PRX(5G) / Cas9 RNP(sgGFP). Detailed Implementation
[0078] (Polyrotaxane)
[0079] Polyrotaxanes consist of multiple macrocyclic molecules and axial molecules with end caps running through the macrocyclic molecules. A schematic diagram of the chemical structure of polyrotaxanes is shown below. Polyrotaxanes have multiple macrocyclic molecules and axial molecules with end caps running through the macrocyclic molecules, but lack end cap structures.
[0080]
[0081] "Axial molecules" are typically polymers, and can be polymers of a single monomer (homopolymers) or copolymers composed of two or more monomers. A "polymer" refers to a high-molecular-weight compound formed by the repeated combination of one or more monomers. Monomers are typically molecules with a single carbon-carbon double bond or molecules with at least two functional groups per molecule. Copolymers can be random copolymers, alternating copolymers, and / or block copolymers, etc. When the axial molecules are homopolymers, examples of polymers include polyepoxides, polyethylene glycol, polypropylene glycol, polyethylene ether, polymethyl methacrylate, polyethyleneimine, poly(propylene oxide), poly(ε-caprolactone), polylactic acid, polyamino acids, poly(ε-lysine), polyamide, poly(imino oligomethylene), violet, poly(polyvinylidene chloride), polypropylene, low-polypropylene, polyethylene, low-polyethylene, poly(alkylbenzimidazole), polyurethane, poly(violet), poly(N-dimethyldecamethyleneammonium), poly(dimethylsiloxane), polyaniline, polycarbonate, poly(methyl methacrylate), poly(N-acylethyleneimine), poly(4-vinylpyridine)-dodecylbenzenesulfonic acid complex, fullerene polyethylene glycol conjugate, and hydrated polysaccharides. When the axial molecule is a copolymer, examples include copolymers of polyethylene glycol and polypropylene glycol, copolymers of poly(ε-caprolactone) and polylactic acid, copolymers of polylactic acid and polyethylene glycol, polyethylene glycol polysaccharide graft copolymers, and polypropylene glycol polysaccharide graft copolymers. Furthermore, the axial molecule can be a multi-arm polymer with branches, such as star-shaped polyethylene glycol, hyperbranched polyether, hyperbranched oligoethylene glycol, or hyperbranched oligopropylene glycol. These polymers can be modified or substituted as needed. Regarding the degree of polymerization and molecular weight of the axial molecule, it only needs to have a length sufficient to penetrate the required number of macrocyclic molecules corresponding to the target nucleic acid / protein to be introduced into the cell. For example, polymers with a number average molecular weight (Mn) of approximately 200–1,000,000 Da, approximately 400–50,000 Da, approximately 500–40,000 Da, or approximately 1,000–30,000 Da can be used.
[0082] In this specification, a "macrocyclic molecule" is a cyclic molecule having a sufficiently large internal opening (cavity) through which the axial molecule passes, and having a modifyable group (e.g., hydroxyl group). Examples of macrocyclic molecules include cyclic polyethers, cyclic polyesters, cyclic polyetheramines, cyclic polyamines, crown ethers, cucurbit[n]urea, calixarenes, cyclic amides, transition metal complexes, cyclodextrins, cyclodextrin derivatives, and any combination thereof. A "cyclodextrin" is a cyclic oligosaccharide compound, including, for example, α-cyclodextrin (hexasaccharide), β-cyclodextrin (heptasaccharide), or γ-cyclodextrin (octasaccharide). Macrocyclic molecules may be substituted with substituents other than the "modification portion" described below, and may be substituted with methyl, hydroxyethyl, hydroxypropyl, acetyl, carboxymethyl, succinyl, glucosyl, carboxyethyl, sulfonyl, amino, halogen atoms, and any combination thereof.
[0083] In polyrotaxanes and polycyclic rotaxanes, axial molecules pass through the openings of macrocyclic molecules, thus permeating the macrocyclic molecules. Polyrotaxanes and polycyclic rotaxanes have multiple macrocyclic molecules permeated by axial molecules as described above. The number of macrocyclic molecules in one polyrotaxane molecule can be set according to the purpose, for example, the average number can be from about 5 to about 200, or from about 10 to about 100. The macrocyclic molecules are not covalently bonded to the axial molecules; therefore, they can move relative to the axial molecules in both the rotational direction and the axial direction.
[0084] In the polyrotaxanes disclosed herein, at least a portion of the macrocyclic molecule is bonded to a "modifying moiety" that has a monovalent proton at a neutral pH and a divalent proton at an acidic pH (preferably a weakly acidic pH, e.g., pH 5.5) (hereinafter sometimes simply referred to as "modifying moiety"). The modifying moiety is preferably a group having both a secondary amine and an amino group, typically consisting of -L... 1 -NH-L 2 -NH2 (here, -L) 1 and L 2 The modified portion, whether identical or different, represents a C1-6 olefinic group (either straight-chain or branched), such as diethylenetriamine. The modified portion has a monovalent proton at neutral pH, thus ensuring safety relative to in vivo components. On the other hand, the modified portion has a divalent proton at an acidic pH (preferably a weakly acidic pH, e.g., pH 5.5) which is the intracellular environment, thereby disrupting the endosome membrane. This promotes the disruption of the endosome by the polyionic complex absorbed into the cell and its release into the cytoplasm.
[0085] In this specification, examples of "straight-chain or branched C1-6 olefinic groups" include -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -CH(CH3)CH2-, -CH2CH(CH3)-, -CH(CH2CH3)CH2-, -CH2CH(CH2CH3)-, -CH(CH3)CH2CH2-, -CH2CH(CH3)CH2-, and -CH2CH2CH(CH3)-.
[0086] In another embodiment, in the polyrotaxane of this disclosure, at least a portion of the macrocyclic molecule is bonded to a group having an amino group (hereinafter sometimes referred to as "intracellularly degradable amino group") by a bond that is capable of being degraded intracellularly. The group having an amino group by a bond that is capable of being degraded intracellularly is typically composed of -L... 3 -XL 4 -NH2 (here, -L) 3 and L 4 The same or different, whether it is a straight-chain or branched C1-6 olefinic group or a C1-6 olefinic group without a straight-chain or branched group, where X is a bond that can be degraded in cells. As a group containing an amino group (in the formula, corresponding to -L...), 4 Groups with -NH2 can include -CH2-NH2, -(CH2)2-NH2, -(CH2)3-NH2, -(CH2)4-NH2, -(CH2)5-NH2, -(CH2)6-NH2, and -CH(CH3)CH2-NH2, etc.
[0087] "Intracellular degradable bonds" refers to bonds that are easily degraded under conditions different from those outside the cell, such as physicochemical conditions like pH or biological conditions like intracellular enzymes. Bonds that are degradable intracellularly are preferably bonds that are difficult to degrade extracellularly. Here, the terms "degradable" and "difficult to degrade" are not absolute and do not respectively mean completely degradable and completely non-degradable. "Degradable" and "difficult to degrade" refer to bonds that are relatively easy to degrade and relatively difficult to degrade when comparing extracellular and intracellular conditions, respectively. For example, the intracellular environment, which differs from extracellular conditions, could be a GSH concentration. In this case, bonds that are degradable intracellularly could be bonds that are difficult to degrade at GSH concentrations of ~0.2 mM (extracellular concentration) but degradable at GSH concentrations of 2–10 mM (intracellular concentration). Bonds that can be degraded within cells can include, for example, urethane (-NH(C=O)O-) bonds, ketal (-OC(CH3)2O-) bonds, amide (-NHCO-) bonds, disulfide (-SS-) bonds, acetal (-C(OH)O-) bonds, orthoester bonds, vinyl ether (-CH2=CH-O-) bonds, hydrazide bonds, and ester (-COO-) bonds.
[0088] As "a group having an amino group by means of a bond that can be degraded within the cell", -(CH2)2-SS-(CH2)2-NH2 (cystamine) is preferred.
[0089] In the polyrotaxane disclosed herein, when an intracellularly degradable amino group is bonded in addition to the modified portion, the modified portion and the intracellularly degradable amino group are typically different groups. Furthermore, in this case, the modified portion is preferably bonded to the macrocyclic molecule via a bond that is not or is difficult to degrade intracellularly. Thus, even if some of the bonds of the intracellularly degradable amino group are degraded, leading to dissociation of the amino group from the macrocyclic molecule, the amino acid in the modified portion can maintain the bond between the polyrotaxane and the biological material before the polyionic complex is released into the cell. Upon release into the cytoplasm, almost all the bonds of the intracellularly degradable amino group are broken, thereby weakening the bond between the biological material and the polyrotaxane and promoting the dissociation of the biological material from the polyrotaxane.
[0090] For example, when the macrocyclic molecule has a hydroxyl group such as that of cyclodextrin, the hydroxyl group can be replaced by the modified portion and / or by a group having an amino group bonded via a bond that can be degraded within the cell (hereinafter collectively referred to as "substituents of the macrocyclic molecule"). The hydroxyl group of cyclodextrin can be the hydroxyl group in glucose that forms cyclodextrin. In this case, the substituent of the macrocyclic molecule can be bonded to the oxygen atom that forms the hydroxyl group via -O-CO-NH-, -O-COO-, -O-OC-, -O-, -OC(OH)-, or -OC(=S)NH- (the leftmost -O- represents an oxygen atom derived from the hydroxyl group). For example, if the macrocyclic molecule is α-cyclodextrin, the oxygen atom of the hydroxyl group forming the α-cyclodextrin is bonded to the oxygen atom that forms the hydroxyl group via -O-CO-NH- and -L-. 1 -NH-L 2 -NH2 represents a substituent bond, which can be represented by the following structural formula.
[0091]
[0092] A "cap" (CAP) is a large substituent bonded to the end of a polyrotaxane that prevents the macrocyclic molecule from detaching from the axial molecule. Examples of caps include dinitrophenyl, cyclodextrin, adamantyl, triphenylmethyl, fluorescein, sesquioxane, pyrene, substituted benzenes (which can be substituted by one or more alkyl, alkoxy, hydroxyl, halogen, cyano, sulfonyl, carboxyl, amino, and phenyl substituents), steroids, amino acids, oligopeptides, oligosaccharides, sugar derivatives, groups with one or more benzene rings (benzyloxycarbonyl(Z), 9-fluorenylmethoxycarbonyl(Fmoc), benzyl ester(OBz)), or groups with one or more tert-butyl groups (tert-butylcarbonyl(Boc), amino tert-butyl ester(OBu)), etc. Preferably, the compounds are dinitrophenyl, cyclodextrin, adamantyl, triphenylmethyl, fluorescein, silsesquioxane, or pyrene, with adamantyl or cyclodextrin being more preferred. The end cap is bonded to the end of the polyrotaxane, thereby preventing the macrocyclic molecule, which is penetrated by the axial molecule, from detaching from the axial molecule. Therefore, the end cap has a sufficient size to prevent the macrocyclic molecule from detaching from the axial molecule.
[0093] The end cap is preferably bonded to the axial molecule via a bond that is degradable within the cell. The term "bond that is degradable within the cell" as used herein follows the definition described above. The end cap is preferably bonded to the axial molecule via a urethane bond. The method of bonding the end cap to the axial molecule via a bond that is degradable within the cell can be referred to, for example, the methods described in Journal of Controlled Release 76 (2001) 11-25; Biomacromolecules 2003, 4, 1426-1432; Langmuir 2011, 27(2), 612-617; Angew. Chem. Int. Ed. 2013, 52, 7300-7305; J. Mater. Chem. B, 2013, 1, 3535-3544; Biomaterials, 34, 2480-2491 (2013); Scientific Reports, 3, 2252 (2013).
[0094] The polyrotaxane disclosed herein can be manufactured using methods known to those skilled in the art and in accordance with the methods described in Manufacturing Examples 1 to 10 below.
[0095] In other embodiments, this disclosure provides a polyrotaxane composition comprising: a polyrotaxane in which at least a portion of the macrocyclic molecules are bonded to a modified portion containing an amine, and a polyrotaxane in which at least a portion of the macrocyclic molecules are bonded to a group having an amino group by means of intracellularly degradable bonds.
[0096] In addition, in other embodiments, this disclosure provides a polyrotaxane having a plurality of macrocyclic molecules, an axial molecule of a ring extending through the macrocyclic molecules, and an end cap bonded to the end of the axial molecule, wherein at least a portion of the macrocyclic molecules are bonded to a modification portion containing an amine, and at least a portion of the macrocyclic molecules are bonded to a group having an amino group by means of intracellularly degradable bonds.
[0097] (Polyionic complex)
[0098] In other embodiments, this disclosure relates to a biological material and a polyionic complex of the said polyrotaxane, and a method for manufacturing the same. "Biological material" refers to a substance intended to be introduced into cells, comprising natural or artificial amino acids or nucleic acids, such as nucleic acid molecules, vectors, proteins or peptides; or fusions of the above, or complexes thereof. Nucleic acid molecules include: guide RNAs (single-stranded guide RNAs; sgRNAs) and primer-editing guide RNAs (PEGRNAs) (including derivatives of Chow, R.DET al. Nat Biomed Eng (2020)), CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), siRNA (including derivatives of shRNA), decoys, CpG oligomers, miRNAs, antisense DNA, antisense RNA, aptamers, mRNA, and nucleic acid vaccines (mRNA vaccines, DNA vaccines, etc.). Vectors include viral vectors and plasmid vectors. Proteins / peptides include functional proteins / peptides such as nucleases (e.g., Cas9 nuclease, Cas9 nickase, Cas12a, Cas13a, etc.), deaminases (cytidine deaminase, adenosine deaminase, etc.), and reverse transcriptases, as well as labeled proteins / peptides such as luciferases and fluorescent / radioactive labeled proteins. Proteins / peptides can be nucleic acid-binding proteins / peptides, for example, those possessing DNA-binding domains (zinc fingers, helix-turn-helix, helix-loop-helix, wing helix, or leucine zippers, etc.) or RNA-binding domains (zinc fingers, KH, S1, PAZ, PUF, PIWI, and RRM (RNA recognition motif) domains, etc.). Examples of fusion compounds include zinc finger nucleases or transcription activator-like effector nucleases (TALENs). Complexes include protein-DNA complexes or protein-RNA complexes, and examples include the complex of Cas protein and guide RNA (as a representative example, the complex of Cas9 and sgRNA (Cas9 RNP)).
[0099] The imprinting rate of the polyionic complex can be, for example, set to 20% or more, or 20–100%, 20–90%, 20–80%, and 20–50%. The imprinting rate can also be, for example, 50% or more, or 50–100%, 50–90%, and 50–80%. In this specification, "imprinting rate" refers to the ratio of the total number of amines (primary, secondary, or tertiary amines) present at the end (including near the end) of the group (modified portion and / or intracellular degradable amino group) bonded to the macrocyclic molecule of the polyrotaxane to the maximum number of cationic monomers that can bind to the biological material contained in the polyionic complex. For example, when the group bonded to the macrocyclic molecule is DET, only the terminal amino group of DET is counted as "amine present at the end of the group bonded to the macrocyclic molecule," while internal secondary amines are not counted. In other words, a DET group provides an amine to the macrocyclic molecule on the polyrotaxane.
[0100] The polyionic complex of this disclosure can be prepared by mixing the biological material and the polyrotaxane disclosed herein. Mixing can be carried out at room temperature in a buffer or culture medium by stirring. The mixing time can be set as appropriate according to the polyrotaxane and biological material used, as well as their concentrations, and is typically in the range of 5 minutes to overnight, 5 minutes to 6 hours, 5 to 180 minutes, 5 to 120 minutes, 5 to 60 minutes, or 5 to 30 minutes.
[0101] (Methods for introducing biological materials into cells)
[0102] In other embodiments, this disclosure relates to a method for introducing biological material into cells, comprising: contacting the polyionic complex of this disclosure with cells, thereby allowing the polyionic complex to be absorbed into the cells. This method may, as needed, include: forming the polyionic complex by mixing the biological material with the polyrotaxane of this disclosure; and contacting the polyionic complex with cells, thereby allowing the polyionic complex to be absorbed into the cells.
[0103] Furthermore, by using a complex of Cas9 protein and guide RNA as the biological material, this method can be used as a method for genome editing. Therefore, one aspect of this disclosure relates to a method for genome editing, comprising: contacting a polyionic complex with a cell to allow the polyionic complex to be absorbed into the cell, wherein the polyionic complex is a polyionic complex of a complex and the polyrotaxane of this disclosure, the complex being a complex of Cas9 protein and guide RNA (Cas9 RNP). This method may, as needed, include: mixing the complex of Cas9 protein and guide RNA (Cas9 RNP) and the polyrotaxane of this disclosure to create the polyionic complex; and contacting the polyionic complex with a cell to allow the polyionic complex to be absorbed into the cell.
[0104] Polyionic complexes can be added to the cell culture medium and cultured to establish contact between the polyionic complexes and cells. The culture medium and conditions used can be determined according to the cell type, typically 37°C and 5% CO2. Culture time can be set to 1 hour to overnight, 1 to 12 hours, 2 to 6 hours, or 3 to 5 hours. Cells can be washed to remove the polyionic complexes as needed, and then cultured for 1 to 4 days or more, or for 6 to 10 days or less.
[0105] (Cell delivery agent)
[0106] The polyrotaxane disclosed herein is adsorbed into endosomes and released from endosomes within the cell. Upon release, it effectively dissociates from biological material within the cytoplasm, thereby enabling the efficient introduction of biological material into the cytoplasm or nucleus. Therefore, the polyrotaxane of this disclosure can be used as a cell-introducing agent for biological material, particularly as an intracytoplasmic or intranuclear introducing agent. In addition to polyrotaxane, the cell-introducing agent may contain buffers and / or stabilizers as needed.
[0107] (Pharmaceutical Composition)
[0108] In other embodiments, this disclosure relates to a pharmaceutical composition containing the polyrotaxane or the polyionic complex. In the pharmaceutical compositions of this disclosure, the biological material is a substance such as a Cas protein / sgRNA complex, a nucleic acid drug, or a vaccine, which is introduced into the cell or cell nucleus to exert a therapeutic effect.
[0109] One aspect of this disclosure relates to a method for treating or improving a patient's disease or condition, the method comprising administering an effective amount of the polyionic complex to a patient in need. "Treatment" is a method for achieving a beneficial or intended clinical outcome. For the purposes of this disclosure, beneficial or intended clinical outcomes, whether detectable or undetectable, include: relief of one or more symptoms; reduction of disease extent; a state of disease stabilization (i.e., no worsening); delay or slowing of disease progression; recovery or relief of disease state; and remission (local or systemic), although beneficial or intended clinical outcomes are not limited to these. "Treatment" may also refer to an extension of life expectancy relative to life expectancy without treatment. "Effective amount" is an amount sufficient to achieve a beneficial or intended clinical outcome, including clinical outcomes. The effective amount may be administered in one or more doses. Subjects of treatment include mammals such as humans, cattle, horses, dogs, cats, pigs, and sheep, preferably humans.
[0110] Pharmaceutical compositions may contain pharmacologically permissible supports (pharmaceutical additives). Those skilled in the art can appropriately select the type of pharmaceutical additive used in manufacturing the pharmaceutical composition, the ratio of the pharmaceutical additive to the active ingredient, or the method of manufacturing the pharmaceutical composition, depending on the form of the composition. Pharmaceutical additives may be inorganic or organic substances, or solid or liquid substances (such as physiological saline). Generally, pharmaceutical additives may be incorporated in quantities ranging from 1% to 99% by weight relative to the active ingredient.
[0111] The pharmaceutical compositions disclosed herein can be for oral or non-oral administration, and can be injectable, including injectables for intravenous injection, subcutaneous injection, intramuscular injection, infusion, etc. Alternatively, the pharmaceutical compositions disclosed herein can also be cell treatment agents in cell therapy. When administered to subjects such as mammals (including model animals such as mice and humans), the above-mentioned preparations can be administered orally, or can be administered as injections or infusions in the blood (in veins or arteries). The dosage and frequency of administration vary depending on the mammalian species, symptoms, disease or disability, age, sex, weight, form of administration, etc. For example, when administered in human blood, the daily dose can be 0.001 to 100 g, or 0.01 to 1000 mg / kg. In addition, the daily dose can be administered in multiple doses. The frequency of administration can be once daily, once weekly, once every two weeks, once monthly, or once every few months. The duration of application can be determined as needed based on the improvement of symptoms, and can be 1 month, several months, half a year, 1 year, several years, 5 years, or 10 years.
[0112] The present disclosure will be described in detail below with reference to embodiments, but the scope of the disclosure is not limited thereto. Furthermore, all references cited throughout this application are incorporated herein by reference in their entirety.
[0113]
Example
[0114] (Material)
[0115] α-CD was donated by Nippon Food Chemical Co., Ltd. (Tokyo, Japan). N,N-carbonyldiimidazole (CDI), ethylenediamine, BOP reagent, 1-hydroxybenzotriazole (HOBt), N-ethyldiisopropylamine (EDIPA), triethylamine (TEA), cystamine dihydrochloride, and 1-adamantane formaldehyde were purchased from Fujifilm and Koko Pure Chemicals Co., Ltd. (Osaka, Japan). 1-adamantaneacetic acid, 1-adamantaneamine, diethylenetriamine (DET), DMAE, and dextran 70 were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). PEG (20kDa), BAEE, 2,2-bis(aminoethoxy)propane, and dendritic polymer (G2-4) were purchased from Sigma-Aldrich Japan (Tokyo, Japan). PEI and PLL were purchased from Polysciences Asia Pacific, Inc. (Taipei, Taiwan, China). Recombinant Streptococcus pyogenes Cas9 protein (N-terminus modified with NLS) was purchased from TaKaRa Bio (Shiga, Japan). sgRNA, crRNA, and ATTO-tracrRNA were purchased from Integrated DNA Technologies Japan (Tokyo, Japan). The sequences of the sgRNA target and PCT primers are shown in Table 1. CRISPRMAX and Opti-MEM were purchased from Thermo Fisher Scientific KK (Tokyo, Japan). All other chemicals and solvents were of analytical grade, and deionized water was used.
[0116] Table 1
[0117] Sequences of sgRNA targets and PCT primers for T7E1 detection
[0118]
[0119] sgRNA sequences only show the DNA target region
[0120] (Cell Culture)
[0121] HeLa cells, a human neuroblastoma cell line and a candidate for human cervical epithelial carcinoma, were obtained from the RIKEN Bioresource Center (Ibaraki, Japan). These HeLa cells were maintained at 37°C in DMEM (high glucose) containing glutamine (2 mM), penicillin (100 U / mL), and streptomycin (100 mg / L), supplemented with 10% fetal bovine serum (FBS), and replaced with a humidified 5% CO2 environment. HeLa GFP cells, i.e., HeLa cells stably expressing GFP, were purchased from CellBiolabs, Inc. (San Diego, USA) and were maintained in the same manner as the HeLa cells, except that the DMEM contained 10 μg / mL of cyproheptadine.
[0122] (Data Analysis)
[0123] Data are provided in mean ± SE form, and statistical significance was determined by the Scheffe test. A p-value < 0.05 was considered statistically significant.
[0124] (Manufacturing Example 1) Preparation of Carbamate-PRX
[0125] Carbamate-PRX was prepared with slight modifications according to the method reported by Araki et al. (Araki, J. et al., Macromolecules 38, 7524-7527 (2005)). To obtain PEG (20 kDa) (PEG-DAT) with a diamino group at the end, PEG (20 kDa) (56 g, 2.8 mmol) and CDI (20 g, 12.4 mmol) were dissolved in tetrahydrofuran (THF) (200 mL) and stirred at 50 °C for 18 hours under nitrogen purging. The reactants were added dropwise to ethylenediamine (6.0 mL, 88.0 mmol) and stirred at 50 °C for 2 hours. Ethanol (200 mL) was added, and after standing at -20 °C for 2 hours, the precipitate was recovered by centrifugation, washed several times with cold ethanol, and dried under reduced pressure. Yield: 52.7 g, 94%.
[0126] To obtain α-CD / PEG-DAT polyrotaxane, PEG-DAT (3.0 g) was added to 12% (w / v) α-CD aqueous solution (100 mL). After stirring overnight at 4 °C, the precipitate was recovered by centrifugation and then dried by freeze-drying.
[0127] To obtain urethane-PRX, 1-adamantaneacetic acid (2.45 g, 12.6 mmol), BOP reagent (5.25 g, 11.8 mmol), HOBt (1.75 g, 11.4 mmol), and EDIPA (2.28 mL, 13.2 mmol) were dissolved in dimethylformamide (DMF) (100 mL), and α-CD / PEG-DAT polyrotaxane (14 g) was added. After stirring at 4 °C for 48 hours under nitrogen purging, the precipitate was recovered by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in dimethyl sulfoxide (DMSO), and excess water was added to precipitate it. The same procedure was repeated three times, and the precipitate was dried by freeze-drying. Yield: 10.23 g, 82% (based on PEG).
[0128] (Manufacturing Example 2) Preparation of Amide-PRX
[0129] Amide-PRX was prepared with slight modifications according to the method reported by Araki et al. (Araki, J. et al., Macromolecules 38, 7524-7527 (2005)). To obtain HOOC-PEG-COOH(20kDa) (PEG-COOH), PEG (20kDa) (10g, 0.5mmol), 2,2,6,6-tetramethylpiperidine-1-oxy (100mg, 0.64mmol), NaBr (100mg, 0.97mmol), and NaClO (effective chlorine concentration >5%, 10mL) were placed in water and stirred at room temperature for 15 minutes. To quench the reaction, ethanol (10mL) was added to the reactants, and 1-NHCl was added to adjust the pH to <2, thereby performing deionization. Spectra / Por TM Membrane MWCO: After dialysis with 10 kDa relative to water, the sample was concentrated using an evaporator and then dried by freeze-drying. Yield: 9.53 g, 95%.
[0130] α-CD / PEG-COOH polyrotaxanes were prepared using PEG-COOH and according to the method described above.
[0131] To obtain amide-PRX, 1-adamantanamine (72.5 mg, 0.48 mmol), BOP reagent (212.5 g, 0.48 mmol), and EDIPA (90.25 μL, 0.52 mmol) were dissolved in DMF (25 mL), and α-CD / PEG-COOH polyrotaxane (3.5 g) was added. After stirring at 4 °C for 48 hours under nitrogen purging, the precipitate was recovered by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in DMSO, and excess water was added to precipitate it. This process was repeated three times, and the precipitate was dried by freeze-drying. Yield: 3.12 g, 92.4% (based on PEG).
[0132] (Manufacturing Example 3) Preparation of Ester-PRX
[0133] Ester-PRX was prepared using PEG-bissuccinic acid (20 kDa) (PEG-bis SA) according to Manufacturing Example 2. To obtain PEG-bis SA, PEG (20 kDa) (5.8 g, 0.29 mmol), 1,8-diazabicyclo[5.4.0]undec-7-ene (85.5 μL, 0.57 mmol), and succinic anhydride (1.7 g, 17 mmol) were dissolved in pyridine (26 mL) and stirred at 55 °C for 18 hours under nitrogen purging. Ethanol (25 mL) was added, and after standing at -20 °C for 2 hours, the precipitate was recovered by centrifugation, washed several times with cold ethanol, and dried under reduced pressure. Yield: 4.68 g, 81%.
[0134] α-CD / PEG-bis SA polyrotaxane was prepared using PEG-bis SA and according to the method described above.
[0135] To obtain ester-PRX, 1-adamantanamine (72.5 mg, 0.48 mmol), BOP reagent (212.5 mg, 0.48 mmol), and EDIPA (90.3 μL, 0.52 mmol) were dissolved in DMF (25 mL), and α-CD / PEG-bis SA polyrotaxane (3.5 g) was added. After stirring at 4 °C for 48 hours under nitrogen purging, the precipitate was recovered by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in DMSO, and excess water was added to precipitate it. The above steps were repeated three times, and the precipitate was dried by freeze-drying. Yield: 2.71 g, 87% (based on PEG).
[0136] (Manufacturing Example 4) Preparation of Disulfide-PRX
[0137] Disulfide-PRX was prepared using PEG-biscysteine (20 kDa) (PEG-bis Cys) according to Manufacturing Example 1. To obtain PEG-bis Cys, PEG (20 kDa) (14.5 g, 0.73 mmol), CDI (3.3 g, 20.0 mmol), and TEA (208 μL, 1.5 mmol) were dissolved in DMSO (500 mL) and stirred at room temperature for 24 hours under nitrogen purging. Cystamine dihydrochloride (3.5 g, 15.5 mmol) was dissolved in DMSO (50 mL) and stirred for 30 minutes in the presence of TEA (2.3 mL, 31.0 mmol) to desalt the cysteine. The reactants were added dropwise to the desalted cysteamine and stirred at room temperature for 48 hours. Ethanol (550 mL) was added, and after standing at -20°C for 2 hours, the precipitate was recovered by centrifugation, washed several times with cold ethanol, and dried under reduced pressure. Yield: 14.2g, 98%.
[0138] α-CD / PEG-bis Cys clustered rotaxanes were prepared using PEG-bis Cys and according to the method described above.
[0139] To obtain disulfide-PRX, 1-adamantaneacetic acid (0.61 g, 3.2 mmol), BOP reagent (1.31 g, 3.0 mmol), HOBt (0.44 g, 2.9 mmol), and EDIPA (0.57 mL, 3.3 mol) were dissolved in DMF (22 mL), and α-CD / PEG-bis Cys polyrotaxane (3.5 g) was added. After stirring at 4 °C for 48 hours under nitrogen purging, the precipitate was collected by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in DMSO and precipitated with excess acetone. The precipitate was washed three times with water and dried by freeze-drying. Yield: 1.41 g, 51% (based on PEG).
[0140] (Manufacturing Example 5) Preparation of Ketal-PRX (Method A)
[0141] Ketal-PRX was prepared using PEG-bis ketal (20 kDa) according to Manufacturing Example 1. To obtain the PEG-bis ketal, PEG (20 kDa) (2 g, 0.1 mmol) and CDI (72 mg, 0.44 mmol) were dissolved in THF (7.15 mL) and stirred at 50 °C for 18 hours under nitrogen purging. The reactants were added dropwise to ethylenediamine (0.5 mL, 3.14 mmol) and stirred at 50 °C for 2 hours. Ethanol (14.3 mL) was added, and the mixture was allowed to stand at -20 °C for 2 hours. The precipitate was recovered by centrifugation, washed several times with cold ethanol, and dried under reduced pressure. Yield: 1.7 g, 83.6%.
[0142] α-CD / PEG-bis ket polyrotaxanes were prepared using PEG-bis ket according to the method described above. However, the yield of polyrotaxanes was low.
[0143] (Manufacturing Example 6) Preparation of Ketal-PRX (Method B)
[0144] A ketal-PRX was prepared using 1-adamantane ketal (Ad-ket) according to Manufacturing Example 2. To obtain Ad-ket, 1-adamantaneacetic acid (194 mg, 1.0 mmol), N-hydroxysuccinimide (230 mg, 2 mmol), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (382 mg, 2 mmol) were dissolved in dichloromethane (DCM) (10 mL) and stirred at room temperature for 5 hours. The reactants were added dropwise to a solution of 2,2-bis(aminoethoxy)propane (796.8 μL, 5 mmol) in DCM (10 mL) and stirred overnight at room temperature. The organic layer was recovered after the addition of a saturated aqueous NaCl solution. This extraction was repeated three times, followed by drying under reduced pressure. Yield: 308 mg, 91%.
[0145] To obtain the ketal-PRX, Ad-ket (300 mg, 0.89 mmol), BOP reagent (393.1 mg, 0.89 mmol), and EDIPA (167 μL, 0.96 mmol) were dissolved in DMF (40.7 mL), and α-CD / PEG-COOH polyrotaxane (6.475 g) was added. After stirring at room temperature for 48 hours under nitrogen purging, the precipitate was collected by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in DMSO and precipitated in excess water. The above steps were repeated three times, and the precipitate was dried by freeze-drying. Yield: 4.69 g, 89% (based on PEG).
[0146] (Manufacturing Example 7) Preparation of hydrazone-PRX
[0147] PEG-diazid (Creative PEGWorks, Chapel Hill, USA) was used to prepare α-CD / PEG-diazid (20 kDa) polyrotaxanes according to the method described above. To obtain hydrazone-PRX, 1-adamantaneformaldehyde (59.1 mg, 0.36 mmol) was dispersed in DMF (2.86 mL), and α-CD / PEG-diazid polyrotaxane (400 mg) was added. After stirring at room temperature under nitrogen purging for 48 hours, the precipitate was recovered by centrifugation and washed twice with methanol / DMF (1:1 v / v) and methanol, respectively. The obtained product was dissolved in DMSO and precipitated with excess acetone. The precipitate was washed twice with water and dried by freeze-drying. Yield: <5 mg, <2% (based on PEG).
[0148] (Manufacturing Example 8) Modification of BAEE, DET and DMAE in the hydroxyl groups of α-CD in PRX
[0149] The hydroxyl groups of α-CD in various PRX prepared according to the above method were activated by CDI, and the reactants were added to a solution containing a diamine or an amine at one end, thereby preparing BAEE-PRX (Amino-PRX(1G)), DET-PRX (Amino-PRX(2G)), and DMAE-PRX.
[0150] As a typical procedure, in the preparation of urethane-DET-PRX, urethane-PRX (100 mg, 1.25 μmol, α-CD: 76.8 μmol) and CDI (114 mg, 0.7 mmol) were dissolved in DMSO (3 mL) and stirred overnight at room temperature under nitrogen purging. The reactants were then added dropwise to DET (758.6 μL, 7.0 mmol) and stirred overnight at room temperature under nitrogen purging.
[0151] To purify BAEE-PRX, DET-PRX, DMAE-PRX, and DET-PRX, the sample was dialyzed relative to water (Spectra / Por TM The membrane (MWCO: 10 kDa) was dried by freeze-drying. To purify disulfide-DET-PRX, the sample was dialyzed relative to methanol (Spectra / Por). TMThe membrane (MWCO: 10 kDa) was evaporated and dissolved in water, and then dried by freeze-drying. To purify ketal-DET-PRX, the sample was precipitated with excess cold ethanol, washed five times with ethanol, evaporated and dissolved in water, and then dried by freeze-drying. The yields of BAEE-PRX, BAEE-DET-PRX, DMAE-PRX, amide-DET-PRX, disulfide-DET-PRX, and ketal-DET-PRX were 133.0 mg (80%), 116.2 mg (84%), 92.5 mg (69%), 574 mg (85%), 110.6 mg (73%), and 27.7 mg (42%), respectively.
[0152] (Manufacturing Example 9) Preparation of Cys-PRX (Amino-PRX(4G))
[0153] Carbamate-PRX (100 mg, 1.25 μmol, α-CD: 76.8 μmol) and CDI (114 mg, 0.7 mmol) were dissolved in DMSO (3 mL) and stirred at room temperature for 24 hours under nitrogen purging. Cystamine dihydrochloride (3.16 g, 14.0 mmol) was dissolved in DMSO (45 mL) and stirred for 30 minutes in the presence of TEA (3.9 mL, 28.1 mol) to carry out desalting. The reactants were added dropwise to the desalted cystamine and stirred overnight at room temperature under nitrogen atmosphere. For purification, the sample was precipitated with excess cold ethanol, washed five times with ethanol, evaporated and dissolved in water, and then dried by freeze-drying. Yield: 82.1 mg, 66%.
[0154] (Manufacturing Example 10) Preparation of Cys-DET-PRX (Amino-PRX(5G))
[0155] Carbamate-PRX (100 mg, 1.25 μmol, α-CD: 76.8 μmol) and CDI (114 mg, 0.7 mmol) were dissolved in DMSO (3 mL) and stirred at room temperature for 24 hours under a nitrogen atmosphere. Cystamine dihydrochloride (1.58 g, 7.0 mmol) was dissolved in DMSO (22.5 mL) and stirred for 30 minutes in the presence of TEA (20 mL, 14.0 mol) to carry out desalting. DET (758.0 μL, 7.0 mol) was then added to the desalted cystamine solution. The reactants were added dropwise to the DET / desalted cystamine mixture and stirred overnight at room temperature under a nitrogen atmosphere. The sample was purified using the same protocol as Cys-PRX described above. Yield: 98.2 mg, 76%.
[0156] (Manufacturing Example 11) Preparation of BAEE-DEX
[0157] Dextran 70 (7.56 g, 11 mmol) and CDI (10.07 g, 62 mmol) were dissolved in DMSO (250 mL) and stirred overnight at room temperature under a nitrogen atmosphere. The reactants were then added dropwise to 1,2-bis(2-aminoethoxy)ethane (92.1 mL, 630 mmol) and stirred overnight at room temperature under a nitrogen atmosphere. The reaction mixture was then dialyzed against water (Spectra / Por). TM After the membrane (MWCO: 10kDa) is dried, the sample is dried by freeze drying.
[0158] (Manufacturing Example 12) Preparation of DET-DEX
[0159] In the preparation of DET-DEX, dextran 70 (0.5 g, 7.14 μmol) and CDI (1.33 g, 8.2 mmol) were dissolved in DMSO (15 mL) and stirred overnight at room temperature under a nitrogen atmosphere. The reactants were then added dropwise to DET (9.0 mL, 83.4 mmol) and stirred overnight at room temperature under a nitrogen atmosphere. The reaction mixture was then compared with water dialysis (Spectra / Por...). TM After membrane MWCO (10 kDa), the sample was dried by freeze-drying. Yield: 433.6 mg, 65%.
[0160] (Manufacturing Example 13) Preparation of Cas9 RNP composites using various cationic materials
[0161] Recombinant Cas9 protein (N-terminally NLS-modified) and sgRNA were mixed in a 1:1 molar ratio and incubated at room temperature for 10 minutes in nuclease-free water (for evaluating physical properties) or Opti-MEM (for cell experiments) (25 μL relative to 0.24 μg sgRNA). Next, the Cas9RNP solution was added to an equal volume of Hank's balanced salt solution (HBSS) or Opti-MEM (containing various amounts of Amino-PRX, cationic polymers, and CRISPRMAX), and incubated with stable stirring at room temperature for 15 minutes. The polymer content was determined based on the percentage of blot (927 amino / Cas9 RNP = 100%). Essentially, primary, secondary, and tertiary amino groups were counted as one amine, DET was counted as one amine per unit, and only the surface amines of the dendritic polymer were used in the calculation. The CRISPRMAX / Cas9 RNP complex was prepared strictly following the manufacturer's specifications regarding mixing ratios, dilution times, and incubation times. Following the same procedures, intracellular uptake and distribution were tested using the crRNA / ATTO-tracrRNA complex instead of sgRNA.
[0162] (Experimental Example 1) Effect of pH on the protonation of DET-PRX
[0163] Adding DCl adjusts the pD of DET-PRX dissolved in D2O to neutral or acidic. 1 NMR was used to observe the downward shift of the protons in the methylene unit of DET. Following a previous report (Liu, F. et al. Nat Cell Biol. 19, 1358-1370 (2017)), pD was calculated using the values displayed by a pH meter in the following formula.
[0164] pD = pH + 0.41
[0165] (Experimental Example 2) Measurement of the size and zeta potential of the Cas9 RNP complex
[0166] The Cas9 RNP complex (sgRNA: 0.96 μg, total 200 μL) was diluted with 800 μL of HBSS (pH 7.4). The size and zeta potential of the complex were determined by dynamic light scattering using a Zetasizer Nano ZS device (Malvern Instruments, Worcestershire, UK).
[0167] (Experimental Example 3) Observation using cryo-electron microscopy (Cryo-TEM)
[0168] Cryo-TEM measurements were performed using a JEM-2100F field emission TEM system (JEOL Ltd.) at an accelerating voltage of 120 kV. In the Cryo-TEM, a 2 μL suspension containing a high concentration of the Cas9 RNP complex (sgRNA: 2.85 μg, total 10 μL) was placed on a 200-mesh copper grid (Nisshin EM CO., Ltd., Tokyo, Japan) covered with a perforated carbon membrane. Excess liquid was aspirated to prepare a thin aqueous film (approximately 100 nm thick) of the suspension. Furthermore, the film was rapidly vitrified by immersing it in liquid ethane using a Leica CPSC cryogenic preparation chamber (Leica Microsystems, Wetzlar, Germany). The grid of the vitrified film was then placed on a sample holder and transferred to the microscope chamber. Liquid nitrogen was used to maintain the sample temperature below -170°C.
[0169] (Experimental Example 4) Heparin Competition Assay
[0170] The Cas9 RNP complex (sgRNA: 0.2 μg, total 7 μL) was mixed with 1 μL of various concentrations of heparin sodium salt (Nacalai Tesque, Kyoto, Japan) solutions (0 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 0.75 mg / mL, 1 mg / mL) and incubated at room temperature for 10 min. After adding 2 μL of 6× loading buffer (TaKaRa Bio, Shiga, Japan), the mixture was electrophoresed on a 2% (w / v) agarose S gel at room temperature and 100 V for 40 min in Tris-borate EDTA buffer (45 mM Tris-borate, 1 mM EDTA, pH 8.0 (0.5×TBE)). The gel was stained with ethidium bromide. The sgRNA and Cas9 RNP bands were visualized using an Amersham Typhoon scanner (FLA-9000, Fujifilm, Tokyo, Japan). The percentage of the remaining complex was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA) based on the relative band intensity of the complex and the released Cas9 RNP.
[0171] (Experimental Example 5) Intracellular uptake of Cas9 RNPs, which form complexes with various cationic materials, by transfecting HeLa cells (3.75 × 10⁻⁶ cells) 24 hours prior to transfection. 4 Cells were seeded (cells / well) into 24-well plates and washed twice with serum-free medium. 500 μL of Cas9 RNP complex (crRNA / ATTO tracrRNA, non-targeted) diluted to a final concentration of 14.6 nM in DMEM was added to each well, and the plates were incubated at 37°C for 4 h. Cells were washed twice with HBSS, separated using the trypsin-EDTA method, recovered by centrifugation, and then dispersed in 500 μL of HBSS containing 10% FBS, filtered through a nylon mesh. Cells from 1 × 10⁶ cells / well were analyzed using a BD Accuri C6 flow cytometer (BD Bioscience Japan, Tokyo) and BD Accuri C6 software (BD Bioscience Japan, Tokyo). 4 The data of each cell were analyzed.
[0172] (Experimental Example 6) Cell Viability
[0173] 24 hours before transfection, HeLa cells (1.5 × 10⁻⁶) were... 4Cells were seeded into 96-well plates and washed twice with serum-free medium. 200 μL of Cas9 RNP complex (sgCont) diluted to a final concentration of 14.6–58.4 nM in DMEM was added to each well, and the plates were incubated at 37°C for 4 h. Cells were washed twice with DMEM, and 200 μL of DMEM (10% FBS) was added to each well, and the plates were incubated at 37°C for 20 h. After washing twice with HBSS, 100 μL of fresh HBSS and 10 μL of Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) were added to each well, and the plates were incubated at 37°C for 1 h. The absorbance of the solutions was measured using an Epoch microplate reader (Bio Tek Instruments, Winuschi, Vermont, USA) (450 nm (sample), 655 nm (reference)).
[0174] To measure cell viability at pH 5.5 to investigate endosome membrane disruption, Cas9 RNP complex diluted with acidic DMEM (pH 5.5) was used, and other steps were performed in the same manner as described above, wherein the acidic DMEM (pH 5.5) was either regular DMEM (pH 7.4) or acidic DMEM adjusted with HCl.
[0175] (Experimental Example 7) Genome editing activity of various Cas9 RNP complexes in HeLa GFP cells
[0176] 24 hours before transfection, HeLa / GFP cells (3.75 × 10⁻⁶) were... 4 Cells were seeded per well into 24-well plates and washed twice with serum-free medium. 500 μL of Cas9 RNP complex (sgCont (sgRNA not targeting GFP) or sgGFP) diluted to a final concentration of 29.2–116.8 nM in DMEM was added to each well, and the plates were incubated at 37°C for 4 hours. Cells were washed twice with DMEM, and 500 μL of DMEM (10% FBS) was added to each well, and the plates were incubated for 5 days. Cells were washed twice with HBSS, pipetteed into HBSS, and recovered by centrifugation to disperse them in 1 mL of HBSS containing 10% FBS, followed by filtration through a nylon mesh. Flow cytometry analysis was performed according to the above method. GFP knockout (%) was calculated using the following formula.
[0177] GFP knockout (%) = 100 - 100 × (GFP-positive cells in the sample / GFP-positive cells in the untreated control group)
[0178] (Experimental Example 8) Genome editing activity of the Amino-PRX(5G) / Cas9 RNP complex in the presence of GSH
[0179] The Amino-PRX(5G) / Cas9 RNP complex was diluted with DMEM containing various concentrations of GSH (0–10 mM), and genome editing activity was measured according to the method described above.
[0180] (Experimental Example 9) T7E1 Determination
[0181] Genomic DNA was extracted from cells treated with the Cas9 RNP complex using MightyPrep reagent (Takera Bio, Shiga, Japan). The target sequence of GFP was amplified using MightyAmp DNA polymerase Ver.3 (TaKaRa Bio, Shiga, Japan). PCR amplicons were purified using NucleoSpin gel electrophoresis and PCR Clean-up (TaKaRa Bio, Shiga, Japan). The purified amplicons were modified, annealed, and digested with T7E1 using a T7 endonuclease I assay kit (GeneCopoeia, Inc., Rockville, MD, USA). Gel electrophoresis was performed for 40 minutes at room temperature, on a 0.5×TBE, 4% (w / v) agarose gel at 100V. Bands were visualized by staining using the same method described above.
[0182] (Experimental Example 10) The response of Amino-PRX / Cas9 RNP complex particles to various stimuli
[0183] The Cas9 RNP complex (sgRNA: 0.96 g, total 200 μL) was diluted with 800 μL of HBSS (pH 7.4: normal), acetate buffer (pH 5.5: endosome environment), or HBSS (GSH: 2 mM: reducing environment in cytosol). The size and zeta potential of the complex were then determined according to the method described above.
[0184] (Experimental Example 11) Intracellular distribution of various Amino-PRX / Cas9 RNP complexes
[0185] HeLa cells (1.0 × 10⁻⁶) 4Cells were seeded into 35 mm glass dishes 24 hours before transfection and washed twice with serum-free medium. 200 μL of Cas9 RNP complex (crRNA / ATTO tracrRNA, non-targeted) diluted to a final concentration of 14.6 nm in DMEM was added to each dish, and the dishes were incubated at 37°C for 4 hours (4h samples). For a subset of samples, cells were washed twice with DMEM, and 2 mL of DMEM was added to each dish, followed by incubation for another 4 hours (8h samples) or 8 hours (12h samples). Next, cells were washed twice with HBSS, fixed with 4% paraformaldehyde solution at room temperature for 10 minutes, and stained with 2 μg / mL Hoechst 33342 (Thermo Fisher Scientific KK, Tokyo, Japan) at room temperature for 10 minutes. Observation was performed using a Leica TCS-SP5 (Leica Japan, Tokyo, Japan) using confocal laser scanning microscopy. Fluorescence intensity / nuclear area was quantified using ImageJ software.
[0186] (Example 1) Automated molecular imprinting of Cas9 RNPs using Amino-PRX (BAEE-PRX)
[0187] Cas9 RNPs possess zwitterionic properties and a three-dimensional charge distribution. Figure 1A Therefore, conventional cationic polymers cannot form complexes with Cas9 RNP. This study investigated whether BAEE-PRX could effectively form complexes with Cas9 RNP through mixing alone, similar to molecular imprinting, via the movement and rotation effects of amino-modified α-CDs. In other words, it investigated whether BAEE-PRX could function as an auto-molecular imprinting agent for Cas9 RNP.
[0188] PRX with a PEG (20 kDa) backbone, threaded in the α-CD and capped with adamantane (Ad), was synthesized. Then, the hydroxyl groups of the α-CD of the PRX were modified with 1,2-bis(2-aminoethoxy)ethane (BAEE) to obtain a primary amino-modified PRX (Amino-PRX). Figure 1C As a control polymer, a glucose-based polymer, BAEE-DEX, was prepared with almost the same BAEE modification rate and molecular weight.
[0189] The formation efficiency of BAEE-PRX and Cas9 RNP complexes, as well as BAEE-DEX and Cas9 RNP complexes, was evaluated based on their zeta potentials. Figure 2According to previous reports in NC, molecular imprinting of one Cas9 RNP molecule requires 927 cationic monomers (Chen, G. et al. Nat Nanotechnol 14, 974-980 (2019)). Therefore, as an indicator of complex formation, the mixing ratio of this amino group was set to an amount capable of applying 100% imprinting. By adding BAEE-PRX, the zeta potential of Cas9 RNP immediately reversed and reached a plateau corresponding to 10% imprinting of the amino group. On the other hand, the reversal of the zeta potential by adding BAEE-DEX was slower than that by BAEE-PRX, and sufficient complexation was only achieved with the addition of Amino-DEX in an amount equivalent to 100% imprinting of the amino group.
[0190] Next, the ratio of intracellular uptake of the BAEE-PRX / Cas9 RNP complex to the maximum amino group was examined, and it was found that the maximum intracellular uptake was achieved at 50% blot. Figure 3 ).
[0191] Furthermore, the BAEE-PRX / Cas9 RNP complex prepared at a mixing ratio that achieved maximum intracellular uptake (50% blot) was observed using Cryo-TEM. Figures 4A to 4C Cas9 RNP exhibits a crystal morphology resembling small crystal aggregation. Figure 4A However, the BAEE-PRX / Cas9 RNP composite can also replace Cas9RNP crystals to exhibit low-contrast particles of approximately 100–200 nm. Figure 4B The low contrast of the BAEE-PRX / Cas9 RNP particles indicates a decreased degree of crystallization of the Cas9 RNP, suggesting a strong molecular-level interaction between the Cas9 RNP and BAEE-PRX. (Image of the BAEE-DEX / Cas9 RNP complex) Figure 4C The changes are almost negligible compared to the case of a standalone Cas9 RNP, thus it is possible that the Cas9 RNPs that did not interact remain as is.
[0192] These results strongly demonstrate that the mobility of macrocyclic molecules enables BAEE-PRX to provide interacting groups to Cas9 RNPs with greater efficiency than previous low-motor polymers, thereby forming complexes with greater efficiency.
[0193] Furthermore, the stability of BAEE-PRX / Cas9 RNP and BAEE-DEX / Cas9 RNP in the presence of heparin (a negatively charged substance) that electrostatically disrupts the complex was compared. This was achieved by a heparin competition assay to determine which carrier could generate a stronger interaction with Cas9 RNP and stabilize the complex. The results of the heparin competition assay indicated that, in terms of the stability of the Cas9 RNP complex, the Cas9 RNP / BAEE-PRX complex was more stable than the Cas9 RNP / BAEE-DEX complex. Figure 5A as well as Figure 5B This indicates that, compared to previous polymers, the formation of a complex via BAEE-PRX and Cas9 RNP is not only more efficient but also more potent.
[0194] Furthermore, in addition to using BAEE-DEX, using a total of eight cationic polymers exhibiting various structures / molecular weights / charge distributions, and using Lipofectamine, which is widely used as a reagent for introducing Cas9 RNPs under conditions that can ensure safety, this method was employed. TM and CRISPRMAX TM Compared to the previous case, the complex of BAEE-PRX and Cas9 RNP showed the highest intracellular uptake in HeLa cells. Figures 6A to 6C ).
[0195] These results demonstrate that BAEE-PRX, through supramolecular conversion with Cas9 RNP, can efficiently form strong complexes simply by mixing, thus enabling its use as a carrier with superior intracellular introduction efficiency compared to previous polymers. In particular, it showcases the practicality of automatically molecularly imprinting the PRX group onto Cas9 RNP.
[0196] (Example 2) Coordinated endosome disruption effect of the Cas9 RNP complex achieved by the dynamic properties of diethylenetriamine (DET) and PRX.
[0197] Similar to the case of genes / nucleic acids, in the case of Cas9 RNPs, the ingestion of Cas9 RNPs into the cell followed by release from the endosome is crucial for avoiding lysosomal digestion and thus enabling efficient genome editing. Therefore, the amino groups of the PRX used to enhance the endosome release capacity of Amino-PRX were investigated. To date, no studies have been conducted on the amino group optimization of PRX, not only regarding Cas9 RNPs but also regarding the introduction of genes / nucleic acids. In addition to BAEE-PRX with a primary amino group, which is used as BAEE-PRX, PRX modified with DET and DMAE at the same modification ratio were also prepared as DET-PRX and DMAE-PRX, respectively. The DET is DET reported as an endosome-mediated amino unit disruption (Miyata, Ketal., Journal of the American Chemical Society 130, 16287-16294 (2008)); the DMAE is 2-(dimethylamino)ethylamine (DMAE), a tertiary amine widely reported as a PRX-modified amine (Ooya, T. et al. (2006), ibid.; Emami, MR et al. (2019), ibid.; Tamura, A. et al., Biomaterials 34, 2480-2491 (2013); Tamura, A. et al., Sci Rep 3, 2252 (2013); Tamura, A. et al. (ibid., al. (2015)). In Table 2, “Number (CyD)” indicates the number of amino groups modified relative to one molecule of PRX. In particular, the charge states of the two cations of the DET unit are monoprotonated (safe form) at neutral pH and diprotonated (membrane-damaging form) under acidic conditions. Therefore, although the DET unit does not cause membrane (cell / organelle) damage when present in the extracellular space and cytosol, it has been reported to cause membrane damage in acidic environments (later endosomes, etc.), thereby promoting the release of contents from the membrane (Miyata, Ketal. (2008) ibid.). NMR spectra in acidic, neutral, and alkaline solutions were measured, and the two-stage protonation of DET-PRX was confirmed (not illustrated).
[0198] Table 2
[0199]
[0200] To evaluate the endosome membrane disruption ability of Cas9 RNP complexes with various amino-modified PRXs, a cell membrane at pH 5.5 was assumed to be the endosome membrane, and cytotoxicity assays were performed. Figure 7At neutral pH, the DET-PRX and DMAE-PRX complexes exhibited lower cytotoxicity compared to the BAEE-PRX complex. In an endosome environment (pH 5.5), the DET-PRX complex, through enhanced zeta potential, demonstrated stronger cell membrane disruption activity than both the BAEE-PRX and DMAE-PRX complexes, indicating that DET-PRX induced the most efficient endosome release of Cas9 RNPs among the three Amino-PRXs.
[0201] Regarding the efficiency of intracellular uptake of the complexes, the DMAE-PRX / Cas9 RNP complex was the highest, while the DET-PRX / Cas9 RNP complex was the lowest. Figure 8 However, the genome editing activity of the DET-PRX / Cas9 RNP complex is higher than that of the BAEE-PRX / Cas9RNP complex and the DMAE-PRX / Cas9 RNP complex. Figure 9A as well as Figure 9B This strongly demonstrates the improving effects of DET-PRX and the importance of intracellular dynamics, particularly endosome escape.
[0202] Furthermore, under endosome conditions, the membrane disruption activity of Cas9 RNPs was compared using DET-PRX and DET-DEX prepared in a manner that ensured nearly identical DET modification rates and molecular weights. Figure 10 The endosome disrupting activity of the DET-PRX complex was slightly higher than that of the DET-DEX complex, indicating that the dynamic properties of DET and PRX have a synergistic effect on the escape of endosomes and Cas9RNPs, and highlighting the importance of the PRX backbone. It was found that DET-PRX causes CD rotation in an endosome environment, thereby eliminating the three-dimensional structural mismatch between the endosome membrane and DET units. Through effective interaction, a higher membrane disruption effect than that of conventional polymers modified with DET can be obtained. DET-PRX was successfully developed, promoting endosome escape in addition to automatic molecular imprinting through a second-stage molecular structure transition. Figure 11 ).
[0203] (Example 3) Imparting intracellular degradability to Amino-PRX to effectively release Cas9 RNP
[0204] If Cas9 RNPs are released from Amino-PRX, nuclear translocation of Cas9 RNPs is promoted through nuclear localization signals, thereby improving genome editing efficiency. To date, reports have shown that PRXs with intracellularly cleavable linkers (end-cap linkers) introduced into the bond between the end-cap and axial molecules release the loaded components into the cell due to the destruction of the linker intracellularly (Ooya, T. et al. (2006) ibid.; Tamura, A. et al. (2013) ibid.; Tamura, A. et al. (2013) ibid.; Tamura, A. et al. (2015) ibid.). However, to date, no studies have been conducted on optimizing end-cap linkers suitable for each molecule, and there are no reports related to Cas9 RNPs. Therefore, an attempt was made to prepare DET-PRX containing six end-cap linkers—amide, carbamate (DET-PRX of Example 2), disulfide, ketal, ester, and hydrazone—by changing the functional groups at the end of the PEG. Figure 12A as well as Figure 12B The 2-methyl group at the PEG terminus hinders the penetration of α-CD through steric effects, resulting in low yields of polyrotaxanes. An exception is the introduction of ketal linkers to the adamantane (terminal cap) side, which generates ketal-PRX. Since adamantane aldehydes are poorly soluble in DMF, the yield of hydrazone-PRX is low. Furthermore, degradation inevitably occurs during the reaction with the slightly hygroscopic and basic DET, making the modification of ester-PRX with DET impossible.
[0205] The genome editing efficiency of the low-concentration Cas9 RNP complex containing four Amino-PRXs (carbamate-DET-PRX, ketal-DET-PRX, amide-DET-PRX, and disulfide-DET-PEX) was evaluated. Figure 13 All Amino-PRX strains demonstrated genome editing efficacy, with urethane-DET-PEX, ketal-DET-PRX, and amide-DET-PRX exhibiting equivalent genome editing efficiency. Considering biocompatibility, urethane linkers capable of long-term hydrolysis were selected as the optimal end-cap linkers for Amino-PRX.
[0206] As another strategy to release molecules loaded with PRX, a linker capable of intracellular cleavage (brush linker) was introduced to the CD-amino bond. Intracellular stimulation was expected to cleave the linker, reducing the number of amino groups bound to CD and weakening the interaction between CD and Cas RNP. Since the drug release function of biodegradable PRX is considered more pronounced in the cap-type than in the brush-type, disulfide bonding was chosen as the brush linker. A novel Cys-PRX (with primary amine added via disulfide bond) was synthesized by modifying the hydroxyl group of α-CD with cystamine (Cys). Figure 14A as well as Figure 14B For the same primary amine as in Example 2, Cys-PRX, the ability of Cas9 RNPs to be released from the endosome is low, thus failing to exhibit genome editing at low concentrations (not illustrated). Therefore, a strategy of mixing Cys and DET was explored.
[0207] The genome editing activity of the Cas9 RNP complex was detected using a 1:1 mixture of Cys-PRX and DET-PRX (DET-PRX / Cys-PRX) and Amino-PRX modified with Cys and DET on the same PRX (Cys-DET-PRX). Figure 15A as well as Figure 15B All three studies demonstrated genome editing effects, but a significant improvement was observed in Cys-DET-PRX. This effect indicates that release from the endosome was achieved through DET, and release of Cas9 RNPs from the vector was achieved through intracellular degradation of Cys, which halved the interacting functional groups.
[0208] The above experimental results indicate that not only intracellular uptake, but also the control of intracellular dynamics after uptake, are factors determining genome editing efficiency. Furthermore, the genome editing activity of Cys-DET-PRX pre-cultured with GSH is not reduced in extracellular GSH concentrations (~0.02 mM), but is reduced in intracellular GSH concentrations (2–10 mM). Figure 16A as well as Figure 16B This indicates that Cys-DET-PRX maintains a good balance between stability and stimuli responsiveness, and the complex is only destroyed under intracellular reducing conditions.
[0209] Furthermore, the Cys-DET-PRX / Cas9 RNP complex can induce genome editing with the same efficiency as the CRISPRMAX / Cas9 RNP complex. Figure 17Furthermore, Cys-DET-PRX has higher safety than CRISPRMAX, thus enabling treatment at high concentrations. Therefore, by employing high concentrations that CRISPRMAX cannot induce, gene introduction can be achieved with greater efficiency. Figure 17 ).
[0210] (Example 4) Effective nuclear translocation and genome editing of Cas9 RNP achieved through five morphological changes of Cys-DET-PRX
[0211] Effective genome editing achieved by Cys-DET-PRX can be considered to be accomplished through the following ( Figure 18 The Cys-DET-PRX / Cas9 RNP complex undergoes a process involving autoimaging to form a complex with Cas9 RNP; membrane disruption in the endosome via protonation and α-CD rotation; degradation of the brush linker and release of Cas9 RNP into the cytosol; and nuclear translocation of Cas9 RNP. To demonstrate this, the physical properties of the Cys-DET-PRX / Cas9 RNP complex under various stimuli were first evaluated. Figures 19A-19C The zeta potential of the Cys-DET-PRX complex increases in the endosome environment, and the particles are disrupted by intracellular GSH treatment. Furthermore, it exhibits excellent biocompatibility due to its ability to achieve long-term degradation via urethane bonds as end-cap linkers. Cys-DET-PRX delivers Cas9 RNPs very efficiently, simply, and safely through five morphological changes: (1) pre-complex formation, (2) complex (extracellular / cytosol), (3) high-charge complex (endosome), (4) unstable complex (GSH stimulation), and (5) monomeric PRX of Cys-DET-PRX (long-term degradation). In fact, the nuclear translocation ability of the Cas9 RNP complex introduced using Cys-DET-PRX is very high due to its endosome expulsion ability and the release ability of Cas9 RNP in the cytosol. These results indicate that Cys-DET-PRX achieves highly efficient Cas9 RNP delivery through five stages of change.
[0212] (Example 5) RNAi effect of Cys-DET-PRX / siRNA
[0213] HeLa GFP cells were seeded into 24-well plates and cultured at 37°C for 24 hours. 500 μL of serum-free medium containing the following sample was added to the cells after washing twice with serum-free medium.
[0214] (sample)
[0215] siRNA alone (25nM, 50nM, 100nM)
[0216] Lipofectamine TM 2000 / siRNA(25nM, 50nM, 100nM)
[0217] Amino-PRX(2G) / siRNA(25nM, 50nM, 100nM)
[0218] Amino-PRX(5G) / siRNA(25nM, 50nM, 100nM)
[0219] After incubation at 37°C for 4 hours in the presence of the sample, the sample was washed twice with serum-free medium and 500 μL of DMEM containing 10% FBS was added. RNAi was then evaluated after incubation for another 68 hours.
[0220] The results are as follows Figure 20 As shown. The Amino-PRX(2G) / siRNA complex exhibits interaction with Lipofectamine. TM The 2000 / siRNA complex showed comparable RNAi efficacy, while the Amino-PRX(5G) / siRNA (25nM, 50nM, 100nM) complexes exhibited significantly higher RNAi efficacy than the others. This indicates that Amino-PRX(2G) and Amino-PRX(5G) are excellent siRNA vectors, especially Amino-PRX(5G), which represents a novel and revolutionary vector with superior efficacy compared to Lipofectamine, a commercially available nucleic acid introduction reagent. TM 2000 higher siRNA introduction effect.
[0221] (Example 6) Genome editing of Cys-DET-PRX / Cas9 RNP in vivo
[0222] HeLa / GFP cells (1×10) 6 Cells (100 mL) were transplanted into the left hind limb of Balb / c nu / nu (♂, 4-w old) mice. Tumors in mice with a tumor long diameter of 5 mm (approximately 5 days after transplantation) were directly administered with 250 pmol (200 mL) of the sample.
[0223] (sample)
[0224] HBSS (Control)
[0225] Cas9 / sgGFP
[0226] Amino-PRX(5G) / Cas9 RNP(sgCont)
[0227] Amino-PRX(5G) / Cas9 RNP(sgGFP)
[0228] CRISPRMAX / Cas9 RNP (sgCont)
[0229] CRISPRMAX / Cas9 RNP(sgGFP)
[0230] Five days after incubation, the tumors were refluxed with PBS and recovered. 1 mL of RIPA buffer was added to 100 mg of tumor, and the mixture was stirred thoroughly. After centrifugation (5000 rpm, 5 min), the supernatant was recovered. This procedure (centrifugation and recovery) was repeated twice, and the fluorescence intensity of the obtained supernatant was measured using a fluorescence plate reader.
[0231] The results are as follows Figure 21 As shown, CRISPRMAX / Cas9 RNP failed to induce genome editing in in vivo, while Amino-PRX(5G) / Cas9 RNP did. This indicates that Amino-PRX(5G) is a superior Cas9 RNP capable of inducing in vivo genome editing that cannot be induced by commercially available induction reagents.
[0232] (Example 7) Optimization of amino groups modified in nucleic acid delivery
[0233] To optimize the amino group modification of PRX during nucleic acid delivery, siRNA was used as a model nucleic acid, and the RNAi effect of introducing complexes of three amino-modified PRXs with siRNA into cells was investigated. The three amino-modified PRXs used were BAEE-PRX, DET-PRX, and DMAE-PRX, prepared using the same method as in Example 2. Furthermore, siGFP was used as the siRNA.
[0234] (siGFP)
[0235] Serial Number: 5'-GCAAGCUGACCCUGAAGUUCAU dTdT-3' (Serial Number 6)
[0236] antiSence: 5'-AUGAACUUCAGGGUCAGCUUGCCG-3' (Serial No. 7)
[0237] HeLa / GFP cells were seeded at 3.75 × 10⁻⁶ cells. 4 Cells / well were transferred to 24-well plates and incubated at 37°C for 24 hours. 300 μL of serum-free medium containing the following samples was added to the cells after washing twice with serum-free medium.
[0238] (sample)
[0239] siRNA alone (0 nM, 25 nM, 50 nM, 100 nM)
[0240] BAEE-PRX / siRNA(0nM, 25nM, 50nM, 100nM)
[0241] DET-PRX / siRNA(0nM, 25nM, 50nM, 100nM)
[0242] DMAE-PRX / siRNA (0nM, 25nM, 50nM, 100nM)
[0243] After culturing at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. Then, 500 μL of DMEM containing 10% FBS was added, and the cells were incubated at 37°C for 68 hours. The RNAi effect was then evaluated by flow cytometry.
[0244] The results are as follows Figure 22 As shown, among BAEE-PRX / siRNA, DET-PRX / siRNA, and DMAE-PRX / siRNA, DET-PRX / siRNA exhibited the highest RNAi effect. This indicates that, similar to the case of Cas9RNP, DET, with its endosome expulsion capability, is the optimal amino group for modification in previous nucleic acid delivery processes.
[0245] (Example 8) Optimization of end-cap-axial intermolecular bonding in nucleic acid delivery
[0246] To optimize cap-axial intermolecular bonding in nucleic acid delivery, siRNA was used as a model nucleic acid, and the RNAi effect of introducing complexes of DET-PRX (amide-DET-PRX, carbamate-DET-PRX, disulfide-DET-PRX, and ketal-DET-PRX) with siRNA into cells was investigated.
[0247] HeLa / GFP cells were seeded at 3.75 × 10⁻⁶ cells. 4 Cells / well were transferred to 24-well plates and incubated at 37°C for 24 hours. 300 μL of serum-free medium containing the following samples was added to the cells after washing twice with serum-free medium.
[0248] (sample)
[0249] siRNA alone (0 nM, 25 nM, 50 nM, 100 nM)
[0250] Amide-DET-PRX / siRNA (0 nM, 25 nM, 50 nM, 100 nM)
[0251] Carbamate-DET-PRX / siRNA (0 nM, 25 nM, 50 nM, 100 nM)
[0252] Disulfide-DET-PRX / siRNA (0 nM, 25 nM, 50 nM, 100 nM)
[0253] Kettal-DET-PRX / siRNA (0 nM, 25 nM, 50 nM, 100 nM)
[0254] After incubation at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. Following the addition of 500 μL of DMEM containing 10% FBS, the cells were incubated at 37°C for 68 hours. RNAi was evaluated by flow cytometry.
[0255] The results are as follows Figure 23 As shown, among the DET-PRX / siRNA complexes with four types of end-cap-axial intermolecular bonds, urethane-DET-PRX / siRNA exhibited the highest RNAi efficiency. In previous nucleic acid delivery studies, DET-PRX with urethane bonds between the end-cap and axial molecules (urethane-DET-PRX), which may be subject to long-term hydrolysis, showed superior nucleic acid delivery capability compared to DET-PRX with amide bonds (amide-DET-PRX). This indicates that intracellular enzymatic degradation of urethane bonds is crucial not only for biocompatibility but also for the release of the loaded molecules.
[0256] (Example 9) Cytotoxicity of Amino-PRX(5G) / siRNA
[0257] To combine the cytotoxicity of Amino-PRX(5G) / siRNA with Lipofectamine TM To compare with 2000 / siRNA, the following experiments were conducted.
[0258] HeLa cells were seeded (1.5 × 10⁻⁶). 4 Cells / well were transferred to 96-well plates and cultured at 37°C and 5% CO2 for 24 hours. 200 μL of serum-free medium containing the following samples was added to the cells after washing twice with serum-free medium.
[0259] (sample)
[0260] Amino-PRX(5G) / siRNA(0nM, 25nM, 50nM, 100nM, 150nM, 200nM, 300nM, 400nM)
[0261] Lipofectamine TM 2000 / siRNA(0nM, 25nM, 50nM, 100nM, 150nM, 200nM, 300nM, 400nM)
[0262] After incubation at 37°C and 5% CO2 for 4 hours in the presence of the sample, the sample was washed twice with serum-free medium. 200 μL of medium containing 10% FBS was added, and the sample was incubated at 37°C and 5% CO2 for 20 hours. After washing twice with HBSS, 100 μL of HBSS and 10 μL of WST-8 (Dojindo, Kumamoto, Japan) were mixed. 110 μL of the HBSS / WST-8 mixture was added to each well, and the sample was incubated at 37°C for 1 hour. The absorbance was measured using a microplate reader (measurement wavelength: 450 nm, reference wavelength: 655 nm).
[0263] The results are as follows Figure 24 As shown. Amino-PRX(5G) / siRNA and Lipofectamine TM Amino-PRX (5G) showed significantly lower cytotoxicity compared to Lipofectamine, a commercially available nucleic acid introduction reagent, when introducing siRNA. TM Compared to 2000, it has superior security.
[0264] (Example 10) GFP knockout effect of Amino-PRX(5G) / ASO
[0265] To evaluate the nucleic acid delivery capability of Amino-PRX(5G) by enabling the model nucleic acid to function as an antisense nucleic acid (antisense oligonucleotide: ASO), the following experiments were conducted.
[0266] HeLa / GFP cells were seeded (3.75 × 10⁴ cells / well) into 24-well plates and cultured at 37°C for 24 hours. After washing the cells twice with serum-free medium, 300 μL of serum-free medium containing the following samples was added. Additionally, GFP ASO (TTGCCGGTGGTGCAGATAAA (SEQ ID NO. 8)) was used as the ASO for GFP knockout.
[0267] (sample)
[0268] ASO standalone (50nM, 100nM, 200nM)
[0269] Lipofectamine TM 2000 / ASO(50nM, 100nM, 200nM)
[0270] Amino-PRX(5G) / ASO(50nM, 100nM, 200nM)
[0271] After culturing at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. Then, 500 μL of DMEM containing 10% FBS was added, and the cells were incubated at 37°C for 68 hours. The gene suppression effect was evaluated by flow cytometry.
[0272] The results are as follows Figure 25 As shown. Amino-PRX(5G) / ASO with -Lipofectamine TM Compared to 2000 / ASO, it exhibits a significantly higher GFP knockout effect. This indicates that Amino-PRX(5G) is also practical for ASO delivery.
[0273] (Example 11) Cytotoxicity of Amino-PRX(5G) / ASO
[0274] To compare the cytotoxicity of Amino-PRX(5G) / ASO with that of Lipofectamine TM To compare with 2000 / siRNA, the following experiments were conducted.
[0275] HeLa cells were seeded (1.5 × 10⁴ cells / well) into 96-well plates and cultured at 37°C and 5% CO₂ for 24 hours. 200 μL of serum-free medium containing the following samples was added to the cells after washing twice with serum-free medium.
[0276] (sample)
[0277] Amino-PRX(5G) / ASO(0nM, 50nM, 100nM, 200nM, 300nM, 400nM)
[0278] Lipofectamine TM 2000 / ASO(0nM, 50nM, 100nM, 200nM, 300nM, 400nM)
[0279] After incubation at 37°C and 5% CO2 for 4 hours in the presence of the sample, the sample was washed twice with serum-free medium. 200 μL of medium containing 10% FBS was added, and the sample was incubated at 37°C and 5% CO2 for 20 hours. After washing twice with HBSS, 100 μL of HBSS and 10 μL of WST-1 (Dojindo, Kumamoto, Japan) were mixed. 110 μL of the HBSS / WST-1 mixture was added to each well, and the sample was incubated at 37°C for 1 hour. The absorbance was measured using a microplate reader (measurement wavelength: 450 nm, reference wavelength: 655 nm).
[0280] The results are as follows Figure 26 As shown. Amino-PRX(5G) / ASO with Lipofectamine TM Amino-PRX (5G) showed significantly lower cytotoxicity compared to Lipofectamine, a commercially available nucleic acid introduction reagent, when introducing ASO. TM It offers superior security compared to the 2000.
[0281] (Example 12) mRNA knockout effect of Amino-PRX(5G) / gapmer type ASO
[0282] To evaluate the nucleic acid delivery capability of Amino-PRX (5G) by using model nucleic acids as antisense nucleic acids (gapmer-type ASOs), the following experiments were conducted.
[0283] HeLa / GFP cells were seeded (3.75 × 10⁴ cells / well) into 24-well plates and cultured at 37°C for 24 hours. After washing the cells twice with serum-free medium, 300 μL of serum-free medium containing the following samples was added. Among these, GFP ASO gapmer (...) was used as the gapmer type ASO for GFP knockout. GAA CTTCAGGGTC AGC (Sequence number 9); Phosphothioate modification (S-type) was added between all nucleic acids. The lower part of the S-type is LNA.
[0284] (sample)
[0285] HBSS (Control)
[0286] Standalone gapmer type ASO (100nM)
[0287] Amino-PRX(5G)NP2 / gapmer type ASO(100nM)
[0288] Amino-PRX (5G) NP5 / gapmer type ASO (100nM)
[0289] Amino-PRX (5G) NP10 / gapmer type ASO (100nM)
[0290] In the above NP2, NP5, and NP10, NP represents the ratio of the amino group (positive charge) of Amino-PRX (5G) to the phosphate group (negative charge) of gapmer-type ASO.
[0291] After culturing at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. Then, 500 μL of DMEM containing 10% FBS was added, and the cells were incubated at 37°C for 44 hours. The gene suppression effect was evaluated by flow cytometry.
[0292] The results are as follows Figure 27 As shown, when gapmer-type ASO was introduced into cells using Amino-PRX(5G), the GFP knockout effect was enhanced. This indicates that Amino-PRX(5G) is also practical for gapmer-type ASO delivery.
[0293] (Example 13) Acidic protein delivery capability of Amino-PRX (5G)
[0294] The acidic protein delivery capability of Amino-PRX(5G) was evaluated using β-galactosidase (β-Gal) as an acidic model protein. Specifically, the Amino-PRX(5G)-β-Gal complex was introduced into cells, and the release of β-Gal from the endosome and within the cell was investigated by measuring intracellular β-Gal enzyme activity.
[0295] Intracellular β-Gal enzyme activity was measured using SPiDER-β-Gal (Dojindo, Kumamoto, Japan), a kit for detecting intracellular β-Gal activity. SPiDER-β-Gal permeates the cell membrane and is cleaved by intracellular β-Gal. It then emits fluorescence by binding to intracellular proteins, thus enabling the specific detection of only intracellular β-Gal enzyme activity.
[0296] HeLa cells were seeded (1.5 × 10⁻⁶). 4Cells were transferred to 35 mm glass dishes and incubated at 37°C for 24 hours. After washing twice with serum-free medium, 200 mL of Amino-PRX(5G) / β-Gal complex solution (β-Gal 25 nm) was added to the cells. After incubation at 37°C and 5% CO2 for 4 hours, the cells were washed twice with serum-free medium. 200 mL of SPiDER-β-Gal was added, and the cells were incubated at 37°C for 15 minutes. The cells were fixed with 4% paraformaldehyde for 10 minutes, stained with Hoechst 33342, and the fluorescence originating from SPiDER-β-Gal was observed under a fluorescence microscope (excitation wavelength: 480 nm, fluorescence wavelength: 530 nm).
[0297] The results are as follows Figure 28 As shown, β-Gal introduced into cells using Amino-PRX(5G) maintained high enzyme activity. This indicates that Amino-PRX(5G) is a useful carrier that ensures protein uptake within cells, endosome release, and cytoplasmic release in protein introduction.
[0298] (Example 14) mRNA delivery capability of Amino-PRX(5G)
[0299] To evaluate the mRNA delivery capability of Amino-PRX(5G) using mCherry mRNA, the following experiments were conducted.
[0300] HeLa cells were seeded (3.75 × 10⁻⁶). 4 Cells / well) were transferred to 24-well plates and incubated at 37°C for 24 hours. After washing the cells twice with serum-free medium, 300 μL of serum-free medium containing the following samples was added.
[0301] (sample)
[0302] mCherry mRNA alone (1500 ng)
[0303] Lipofectamine TM 2000 mCherry mRNA (1500 ng)
[0304] Amino-PRX(5G)NP0.5 / mCherry mRNA(1500ng)
[0305] Amino-PRX(5G)NP0.75 / mCherry mRNA(1500ng)
[0306] Amino-PRX(5G)NP1 / mCherry mRNA(1500ng)
[0307] Amino-PRX(5G)NP2 / mCherry mRNA(1500ng)
[0308] Furthermore, the NP in NP0.5, NP0.75, NP1, and NP2 above represents the ratio of the amino group (positive charge) of Amino-PRX (5G) to the phosphate group (negative charge) of mCherry mRNA.
[0309] After culturing at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. Following the addition of 500 μL of DMEM containing 10% FBS, the cells were incubated at 37°C for 44 hours. The mean fluorescence intensity (MFI) of mCherry was evaluated by flow cytometry.
[0310] The results are as follows Figure 29 As shown, when mCherry mRNA was introduced into cells using Amino-PRX(5G), an increase in mCherry expression was observed. This indicates that Amino-PRX(5G) is a viable mRNA delivery vector.
[0311] (Example 15) Optimizing the Substitution Rate of Amino-PRX (5G)
[0312] The degree of substitution of Amino-PRX(5G) was optimized, and the Cas9 RNP introduction capability of the constructed low-substitution Amino-PRX(5G) was evaluated. Here, "degree of substitution" refers to the number of functional groups modified in a single macrocyclic molecule of the PRX. When the macrocyclic molecule of the PRX is bonded to multiple functional groups, the number of functional groups is the total number of modifications of all functional groups in a single macrocyclic molecule. When the macrocyclic molecule of the PRX is bonded to a single type of functional group, the number of functional groups is the number of modifications of that functional group in a single macrocyclic molecule. Furthermore, in Amino-PRX(5G), the macrocyclic molecule is a cyclodextrin (CyD). Low substitution refers to a smaller number of functional group modifications. Here, "a smaller number of functional group modifications" means that the number of modifications of each functional group in a single macrocyclic molecule of the PRX is less than or equal to 1 (when the macrocyclic molecule of the PRX is bonded to a single type of functional group, the number of modifications of that functional group is less than or equal to 1). That is, when it is Amino-PRX (5G), low substitution degree (i.e., fewer functional group modifications) means that the number of Cys and DET modifications in one CyD1 molecule of PRX is less than or equal to 1.
[0313] As a low-substitution degree Amino-PRX(5G), Cys(0.6)-DET(0.7)-PRX was used. “Cys(0.6)-DET(0.7)-PRX” means that, relative to the CyD1 molecule in the PRX, there are an average of 0.6 Cys and an average of 0.7 DETs bonded.
[0314] HeLa / GFP cells were seeded (3.75 × 10⁴ cells / well) into 24-well plates and cultured at 37°C for 24 hours. After washing the cells twice with serum-free medium, 500 μL of serum-free medium containing the following samples was added.
[0315] (sample)
[0316] HBSS (Control)
[0317] Standalone Cas9 / sgGFP RNP (29.2 nM)
[0318] CRISPRMAX / Cas9 RNP(sgCont)(29.2nM)
[0319] CRISPRMAX / Cas9 RNP(sgGFP)(29.2nM)
[0320] Low-substitution degree Amino-PRX(5G) / Cas9 RNP(sgCont)(29.2nM)
[0321] Low-substitution degree Amino-PRX(5G) / Cas9 RNP(sgGFP) (29.2 nM)
[0322] After culturing at 37°C for 4 hours in the presence of the sample, the cells were washed twice with serum-free medium. 500 μL of DMEM containing 10% FBS was added, and the cells were incubated at 37°C for 44 hours. After a total of 120 hours of culture with the medium changed daily, the GFP knockout rate was evaluated by flow cytometry.
[0323] The results are as follows Figure 30 As shown, low-substitution Amino-PRX(5G) / Cas9 RNP(sgGFP) exhibited superior genome editing performance compared to CRISPRMAX / Cas9 RNP(sgGFP). Conversely, at the same Cas9 RNP concentration (29.2 nm), high-substitution Amino-PRX(5G) / Cas9 RNP demonstrated equivalent genome editing performance to CRISPRMAX / Cas9 RNP. Figure 17 ).also, Figure 17The highly substituted Amino-PRX(5G) is Cys(1.2)-DET(1.3)-PRX. This indicates that, compared with the highly substituted Amino-PRX(5G), the low-substituted Amino-PRX(5G) exhibits improved Cas9 RNP release capacity and enhanced genome editing performance. Furthermore, it is shown that the number of Cys modifications and the number of DET modifications in one CyD1 molecule of the PRX are preferably less than or equal to 1, more preferably less than or equal to 0.7.
[0324] Furthermore, if the degree of substitution is too low, the solubility of the carrier in water decreases, thereby weakening the interaction between the carrier and the drug. Therefore, the degree of substitution is preferably greater than or equal to 0.5, more preferably greater than or equal to 1. For example, when it is Amino-PRX (5G), the total number of Cys modifications and DET modifications in one CyD1 molecule of PRX is preferably greater than or equal to 0.5, more preferably greater than or equal to 1. sequence list <110> National University Corporation Kumamoto University <120> Vectors for introducing functional nucleic acids and proteins <130> PG03213A <150> JP 2021-010606 <151> 2021-01-26 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> RNA <213> Artificial sequence <220> <223> sgRNA targeting GFP (sgGFP) <400> 1 gggcgaggag cuguucaccg 20 <210> 2 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Non-targeting sgRNA (sgCont) <400> 2 aaaugugaga ucagaguaau 20 <210> 3 <211> 20 <212> RNA <213> Artificial sequence <220> <223> crRNA (non-targeted) <400> 3 aaaugugaga ucagaguaau 20 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <220> <223> GFP forward primer <400> 4 atggtgagca agggcgag 18 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> GFP reverse primer <400> 5 ccggtggtgc agatgaactt 20 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides (sense strands of siRNA targeting GFP) (siGFP)) <400> 6 gcaagcugac ccugaaguuc autt 24 <210> 7 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> GFP targets the antisense strand of siRNA (siGFP) <400> 7 augaacuuca gggucagcuu gccg 24 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <220> <223> ASO targeting GFP <400> 8 ttgccggtgg tgcagataaa 20
Claims
1. A cell-introducing agent for a biological material comprising polyrotaxane, said polyrotaxane comprising: a plurality of macrocyclic molecules, an axial molecule of a ring penetrating each macrocyclic molecule, and an end cap bonded to the end of said axial molecule, wherein The amine-containing modification moiety is bonded to at least one of the macrocyclic molecules, and the modification moiety has a monovalent proton at neutral pH or a divalent proton at acidic pH. Each macrocyclic molecule is an α-cyclodextrin, the axial molecule is PEG, and the biological material is a nucleic acid molecule, a protein, or a complex of Cas9 protein and guide RNA (Cas9 RNP). The modified portion is diethylenetriamine.
2. The cell introducer of the biological material according to claim 1, wherein an amino group different from the modified portion is bonded to at least one of the macrocyclic molecules in the polyrotaxane via a bond that is degradable in the cell.
3. The cell-introducing agent of the biological material according to claim 2, wherein the intracellularly degradable bonds are selected from: urethane bonds, ketal bonds, amide bonds, ester bonds, and disulfide bonds.
4. The cell-introducing agent of the biological material according to claim 3, wherein the bond that can be degraded in the cell is a disulfide bond.
5. The cell introducer of the biological material according to claim 4, wherein cystamine is bonded to at least one of the macrocyclic molecules.
6. A cell-introducing agent for biological materials according to any one of claims 1 to 5, wherein the end cap is bonded to the axial molecule via a bond that is degradable within the cell.
7. The cell-introducing agent of the biological material according to claim 6, wherein the intracellularly degradable bond is selected from: urethane bond, ketal bond, amide bond, ester bond, and disulfide bond.
8. The cell introducer of the biological material according to claim 7, wherein the bond that can be degraded in the cell is a carbamate bond.
9. A polyrotaxane composition comprising: A polyrotaxane comprising: a plurality of macrocyclic molecules, an axial molecule of a ring penetrating each macrocyclic molecule, and an end cap bonded to the end of the axial molecule, wherein a modifying moiety containing an amine is bonded to at least one of the macrocyclic molecules, and the modifying moiety has a monovalent proton at a neutral pH or a divalent proton at an acidic pH, wherein the modifying moiety is diethylenetriamine; and Another polyrotaxane comprises: a plurality of macrocyclic molecules, an axial molecule of a ring running through each macrocyclic molecule, and an end cap bonded to the end of the axial molecule, wherein an amino group is bonded to at least one of the macrocyclic molecules via a bond that is degradable within the cell; Each macrocyclic molecule is an α-cyclodextrin, and the axial molecule is PEG.
10. A biological material and a polyionic complex of polyrotaxane, wherein the polyrotaxane comprises: a plurality of macrocyclic molecules, axial molecules of a ring penetrating each macrocyclic molecule, and end caps bonded to the ends of the axial molecules, wherein The amine-containing modification moiety is bonded to at least one of the macrocyclic molecules, and the modification moiety has a monovalent proton at neutral pH or a divalent proton at acidic pH. Each macrocyclic molecule is an α-cyclodextrin, the axial molecule is PEG, the modified portion is diethylenetriamine, and the biological material is a nucleic acid molecule, a protein, or a complex of Cas9 protein and guide RNA (Cas9 RNP).
11. The polyionic composite according to claim 10, wherein the imprinting rate of the polyionic composite is 20% to 100%.
12. A method for manufacturing the polyionic composite of claim 10 or 11, comprising: The biological material and polyrotaxane are mixed to form a polyionic complex, wherein the polyrotaxane comprises: a plurality of macrocyclic molecules, axial molecules of a ring penetrating each macrocyclic molecule, and end caps bonded to the ends of the axial molecules, wherein The amine-containing modification moiety is bonded to at least one of the macrocyclic molecules, and the modification moiety has a monovalent proton at neutral pH or a divalent proton at acidic pH. Each macrocyclic molecule is α-cyclodextrin, the axial molecule is PEG, and the modified portion is diethylenetriamine.
13. A non-therapeutic method for introducing biological materials into cells, comprising: The polyionic complex of claim 10 or 11 is brought into contact with the cell phase, thereby allowing the polyionic complex to be absorbed into the cell.
14. A non-therapeutic method for introducing biological material into cells, comprising: The polyionic complex is prepared using the method of claim 12; as well as The manufactured polyionic complex is brought into contact with the cell phase, thereby allowing the polyionic complex to be absorbed into the cell.
15. A non-therapeutic method for genome editing, comprising: The Cas9 protein and guide RNA complex (Cas9 RNP) is brought into contact with a polyrotaxane polyionic complex and a cell, thereby allowing the polyionic complex to be absorbed into the cell. The polyrotaxane comprises: a plurality of macrocyclic molecules, axial molecules of a ring extending through each macrocyclic molecule, and end caps bonded to the ends of the axial molecules. The amine-containing modification moiety is bonded to at least one of the macrocyclic molecules, and the modification moiety has a monovalent proton at neutral pH or a divalent proton at acidic pH. Each macrocyclic molecule is α-cyclodextrin, the axial molecule is PEG, and the modified portion is diethylenetriamine.
16. A non-therapeutic method for genome editing, characterized in that, include: The Cas9 protein-guide RNA complex (Cas9 RNP) was mixed with polyrotaxane to form a polyionic complex; and The polyionic complex is brought into contact with the cell, thereby allowing the polyionic complex to be absorbed into the cell; The polyrotaxane described herein comprises: a plurality of macrocyclic molecules, axial molecules of a ring penetrating each macrocyclic molecule, and end caps bonded to the ends of the axial molecules, wherein The amine-containing modification moiety is bonded to at least one of the macrocyclic molecules, and the modification moiety has a monovalent proton at neutral pH or a divalent proton at acidic pH. Each macrocyclic molecule is α-cyclodextrin, the axial molecule is PEG, and the modified portion is diethylenetriamine.
17. A pharmaceutical composition comprising: a cell-introducing agent of the biological material according to any one of claims 1 to 5, or a polyionic complex according to claim 10 or 11.