A head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout, its preparation method and application

Abstract

This invention discloses a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI dual gene knockout, its preparation method, and its applications. The line is constructed using a CRISPR / Cas9 system containing sgRNA, the nucleotide sequence of which is shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3. The sgRNA provided by this invention can effectively knock out the TGFBI gene in PRAS40 knockout cell lines, achieving further knockout of downstream regulatory genes and obtaining monoclonal cell lines. The PRAS40 and TGFBI dual gene knockout cell lines obtained using this method can serve as stable genetic tool cells, providing a theoretical basis for elucidating the invasion and metastasis mechanisms of tumor cells, and also facilitating the mapping of in-depth gene expression alteration profiles or metabolic alteration profiles.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout, its preparation method, and its application. Background Technology

[0002] PRAS40 is a 40 kDa proline-rich AKT substrate protein located on chromosome 19q13.33. Because PRAS40 was initially discovered as a phosphorylated AKT kinase substrate protein, it was also named AKT1S1. PRAS40 has multiple phosphorylation sites, and its phosphorylation activity is associated with cell growth, apoptosis, autophagy, and angiogenesis, making it a downstream phosphorylated substrate in multiple signaling pathways. PRAS40 is widely expressed in various tissues in vivo and plays a crucial role in the development and progression of cancer. Related studies have found that the PRAS40 gene is an oncogene in melanoma, prostate cancer, liver cancer, and Ewing sarcoma; however, it exhibits tumor-suppressive effects in gallbladder cancer, cervical squamous cell carcinoma, and colon cancer. Overexpression of the mutant form of PRAS40 (PRAS40T246A) inhibits keratinocyte migration and delays wound healing. This study demonstrates the important role of PRAS40 in cell migration. Epithelial-mesenchymal transition (EMT) refers to the process by which polarized epithelial cells transform into mesenchymal cells that lose polarity and have a stronger ability to migrate and invade due to cytoskeleton remodeling. Molecular manifestations associated with EMT include decreased expression of epithelial cell markers such as E-cadherin and cytokeratin, and increased expression of mesenchymal cell markers such as vimentin and fibronectin.

[0003] TGFBI (also known as βig-h3) is a secreted protein induced by transforming growth factor β (TGF-β). It encodes a protein approximately 68 kDa in size, consisting of 683 amino acids, including an N-terminal secretory sequence, a C-terminal Arg-Gly-Asp (arginine-glycine-aspartic acid) sequence, and four consecutive FAS1 domains. The C-terminal sequence contains arginine, glycine, and aspartic acid, and is therefore also known as the RGD sequence. The RGD sequence is the cell attachment site for many extracellular matrix, blood, and cell surface proteins, specifically recognizing and binding integrins, and is crucial for cell adhesion and motility. In cancer, TGFBI participates in malignant behaviors such as tumor cell proliferation, angiogenesis, invasion, and metastasis through the synergistic action of the RGD motif and FAS1 domains. TGFBI can induce EMT by altering the expression levels of various EMT markers such as Vimentin, Snail, and MMP2, and has shown an enhancing effect on tumor cell metastasis in various tumors. However, no studies have yet reported the molecular mechanisms by which TGFBI mediates tumor cell invasion and metastasis. Both PRAS40 and TGFBI are genes related to tumor cell invasion and metastasis. According to the inventors' previous research, the protein level of TGFBI was significantly increased in PRAS40 knockout cells, indicating that TGFBI is a downstream regulatory gene of PRAS40. Most studies on downstream molecular mechanisms rely on RNAi knockdown of downstream regulatory genes, which is less effective than CRISPR / Cas9 knockout monoclonal cell lines.

[0004] Currently, there are no reports, either domestically or internationally, of simultaneously knocking out upstream and downstream genes and obtaining monoclonal cell lines for in-depth research. In most existing cases of dual gene knockout, the two genes have similar functions, both involved in the same biological behavior such as immune deficiency, or they belong to the same protein but different subtypes. PRAS40 and TGFBI have a regulatory relationship, and further knocking out downstream regulatory genes to obtain monoclonal cell lines is a difficult task. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes an sgRNA.

[0006] The present invention also proposes an expression cassette, recombinant vector or transgenic cell line containing the above-mentioned sgRNA nucleic acid sequence.

[0007] This invention also proposes a CRISPR / Cas9 system.

[0008] The present invention also proposes an application of the above-mentioned sgRNA, expression cassette, recombinant vector, or transgenic cell line or CRISPR / Cas9 system.

[0009] This invention also proposes a method for constructing a head and neck squamous cell carcinoma cell line with double gene knockout of PRAS40 and TGFBI.

[0010] The present invention also proposes a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout constructed by the above construction method.

[0011] This invention also proposes a primer set for detecting head and neck squamous cell carcinoma cell lines with PRAS40 and TGFBI double gene knockout.

[0012] This invention also proposes the application of the above-mentioned head and neck squamous cell carcinoma cell line with double gene knockout of PRAS40 and TGFBI.

[0013] According to one aspect of the present invention, an sgRNA is provided, the nucleotide sequence of which is shown in SEQ ID NO. 3.

[0014] According to a second aspect of the invention, in some embodiments of the invention, the recombinant vector further includes a U6 promoter, a Cas9 protein, and a fluorescent gene.

[0015] In some embodiments of the present invention, the fluorescent gene includes the GFP fluorescent gene.

[0016] In some embodiments of the present invention, the recombinant vector uses a scaffold carrier including CG04.

[0017] According to a third aspect of the invention, a CRISPR / Cas9 system is proposed, comprising the aforementioned sgRNA and Cas9.

[0018] According to a fourth aspect of the present invention, the use of the above-described sgRNA, expression cassette, recombinant vector or transgenic cell line or CRISPR / Cas9 system in any one of the following (1) to (6);

[0019] (1) Specifically recognizes the TGFBI gene;

[0020] (2) Knock out the TGFBI gene;

[0021] (3) Construct a cell line with TGFBI gene knockout;

[0022] (4) Construct a cell line with PRAS40 and TGFBI double gene knockout;

[0023] (5) Prepare products for constructing TGFBI gene knockout cell lines;

[0024] (6) Prepare products for constructing cell lines with PRAS40 and TGFBI double gene knockout.

[0025] In some embodiments of the present invention, the application is for purposes other than disease diagnosis and treatment.

[0026] According to a fifth aspect of the present invention, a method for constructing a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI dual gene knockout is provided, the method comprising the following steps: introducing the above-mentioned CRISPR / Cas9 system into the PRAS40 knockout head and neck squamous cell carcinoma cell line.

[0027] In some embodiments of the present invention, the import method employs transient transfection.

[0028] According to a sixth aspect of the present invention, a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout is proposed, which is constructed by the above-described construction method.

[0029] According to a seventh aspect of the present invention, a primer set for detecting head and neck squamous cell carcinoma cell lines with PRAS40 and TGFBI double gene knockout is provided.

[0030] In some embodiments of the present invention, the nucleotide sequences of the primer set are shown in SEQ ID NO.4-7.

[0031] According to an eighth aspect of the present invention, the application of the above-described PRAS40 and TGFBI double gene knockout head and neck squamous cell carcinoma cell line or the above-described primer set is proposed, wherein the application is in drug screening.

[0032] In some embodiments of the present invention, the drug is used to regulate cell invasion and metastasis.

[0033] In some embodiments of the present invention, the application is in the preparation of drug screening kits.

[0034] In some embodiments of the present invention, the drug is used to regulate cell invasion and metastasis.

[0035] In some embodiments of the present invention, the application is in the preparation of E-cadherin expression promoters.

[0036] In some embodiments of the present invention, the application is in the preparation of a medicament for treating cancer.

[0037] In some embodiments of the present invention, the cancer includes at least one of melanoma, prostate cancer, liver cancer, Ewing sarcoma, gallbladder cancer, cervical squamous cell carcinoma, and colon cancer.

[0038] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the sgRNA provided by the present invention can effectively knock out the TGFBI gene in PRAS40 knockout cell lines, and 100% of the TGFBI gene is cleaved at the target site, with high target activity. Western blot detection shows that the TGFBI protein is basically not expressed after gene knockout, achieving a very ideal effect. It can further knock out downstream regulatory genes and obtain monoclonal cell lines.

[0039] Meanwhile, this invention provides a method for preparing dual-gene knockout human tumor cell lines by further knocking out the TGFBI gene from the PRAS40 knockout cell line. This avoids the introduction of exogenous genes and the formation of frameshift mutations in the genome, resulting in stable PRAS40 and TGFBI dual-gene knockout cell lines. Simultaneously, fluorescent gene-assisted screening of gene-edited cells is introduced, making the screening of gene knockout cells more intuitive and rapid. The PRAS40 and TGFBI dual-gene knockout cell lines obtained using this method can serve as stable genetic tool cells, providing a theoretical basis for elucidating the invasion and metastasis mechanisms of tumor cells, and also facilitating the mapping of in-depth gene expression alteration profiles or metabolic alteration profiles. Attached Figure Description

[0040] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0041] Figure 1 This is a schematic diagram of the human TGFBI gene structure in Example 1 of the present invention, wherein the human TGFBI gene is used as a template and the target site is in the first exon; the bases marked with gray background are the sequences of 3 sgRNAs;

[0042] Figure 2 This is a structural diagram of the CG04 carrier in Embodiment 2 of the present invention;

[0043] Figure 3 This is a graph showing the expression detection results of TGFBI and PRAS40 proteins in PRAS40 knockout monoclonal cells in Example 2 of the present invention.

[0044] Figure 4 This is a graph showing the detection results of green fluorescent protein expression in Example 2 of the present invention, where A is the bright field and B is the dark field.

[0045] Figure 5 This is a Sanger sequencing diagram of the PRAS40 gene in Example 2 of the present invention;

[0046] Figure 6 This is a Sanger sequencing diagram of the TGFBI gene in Example 2 of the present invention;

[0047] Figure 7The image shows the Western blot results of the expression levels of PRAS40 (A) and TGFBI (B) genes in cells #3 of Example 2 of this invention. In this image, A represents the Western blot results of the PRAS40 gene expression level; B represents the Western blot results of the TGFBI gene expression level; Wild type indicates wild-type cells; PRAS40-KO indicates PRAS40 knockout cells; and PRAS40-TGFBI- indicates PRAS40 and TGFBI dual gene knockout cells.

[0048] Figure 8 This is a graph showing the results of detecting the expression level of E-cadherin, a molecular marker of epithelial-mesenchymal transition, in the PRAS40 and TGFBI double gene knockout cell line in Example 3 of the present invention.

[0049] Figure 9 The graphs show the results of tumor cell invasion and metastasis detection after knocking out PRAS40 and TGFBI genes in Example 4 of the present invention. In the graphs, A and B are the results of cell scratch assay; C and D are the results of Transwell assay. "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.005. Detailed Implementation

[0050] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0051] Example 1: Selection and Design of Human TGFBI Gene sgRNA Target Sequence

[0052] Based on the human TGFBI gene sequence (Gene ID: 7045), the target site was designed on the first exon of the PRAS40 gene. A large number of target sequences were designed using the online website: https: / / portals.broadinstitute.org / gpp / public / . A schematic diagram of the exon structure of the human TGFBI gene is shown below. Figure 1 As shown. All target sequences were experimentally verified; some showed no cleavage activity, some showed very low cleavage activity, and some exhibited off-target effects. Finally, three target sequences were selected:

[0053] sgRNA-1: GCTCCATGGCGCTCTCGTG (SEQ ID NO: 1);

[0054] sgRNA-2: TGGCGGGTCCCGCCAAGTC (SEQ ID NO: 2);

[0055] sgRNA-3: GCTCGGCTTACCCGTGCTGG (SEQ ID NO: 3).

[0056] Example 2: Preparation of a head and neck squamous cell carcinoma cell line with double gene knockout of PRAS40 and TGFBI

[0057] This embodiment prepared a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout. The specific process is as follows:

[0058] 1. Constructing a CRISPR / Cas9 targeting vector (Cas9 / gRNA(amp-GFP) Vector)

[0059] The three sgRNAs designed in Example 1 were ligated to donor vectors using Getway cloning technology to form entry clones. Then, the entry clones containing the attL site were subjected to an attR reaction with the CG04 vector containing the attR site, allowing the sgRNAs to recombine from the entry clones into the CG04 vector containing the U6 promoter, GFP fluorescent gene, and Cas9 protein (purchased from Guangzhou Funeng Biotechnology Co., Ltd., structure shown below). Figure 2 As shown in the figure, expression clones were formed, and finally, transformation and positive clone screening were performed. Ultimately, CRISPR / Cas9 targeting vectors containing three different sgRNAs were constructed.

[0060] 2. Carrier transformation

[0061] PRAS40 knockout head and neck squamous cell carcinoma monoclonal cells (PRAS40-KO, prepared using the same method as in the literature "The Molecular Landscape and Biological Alterations Induced by PRAS40-Knockout in Head and Neck Squamous Cell Carcinoma") were used. The results of TGFBI and PRAS40 protein level detection in the PRAS40 knockout head and neck squamous cell carcinoma monoclonal cells are shown in the figure below. Figure 3As shown in the figure, TGFBI protein levels were significantly elevated, while PRAS40 protein was not expressed. The cells were removed from liquid nitrogen and quickly placed in a 37°C water bath to thaw, with the cryovials being shaken continuously during the thawing process. After 2 minutes, the cell suspension was added to 10 mL of culture medium (1640 medium + 10% FBS + 1% penicillin antibiotic) (purchased from Gibco) to resuspend the cells. After mixing, the cells were transferred to 100 mm culture dishes and incubated at 37°C in a 5% CO2 incubator. Transfection was prepared when the passaged cells reached 80% confluency.

[0062] Before transfection, add 1.5 mL of culture medium to each well of a 6-well plate and incubate to equilibrate. Remove the cells to be transfected, wash with 1×PBS (Corning), discard the 1×PBS, add 1 mL of 0.25% trypsin (Gibco), and digest at 37°C for 2 min. Stop digestion by adding serum-containing culture medium. Count the cells using the cell suspension, ensuring the cell count in each group is approximately 0.5 × 10⁻⁶ cells / well. 5 -2×10 5 Each group of cells, after cell counting, has a cell count of 1×10⁻⁶. 5 Centrifuge at 1000 rpm for 5 min, resuspend cells in 500 μL and add to 6-well plates. The experiment was divided into four groups: group 1 was the control group, group 2 was the sgRNA1 group, group 3 was the sgRNA2 group, and group 4 was the sgRNA3 group.

[0063] Transfection steps: (1) Digest, centrifuge and resuspend the cells and seed them into a six-well plate. The cell density should be about 60%-80%. Note that too low or too high cell density will affect the transfection efficiency.

[0064] (2) Observe the cells under a microscope 8-12 hours after the cells are seeded. If the cells have adhered to the wall and fully spread out, it means that transfection can be performed.

[0065] (3) Transfection reagent preparation: Prepare the following transfection working solutions using the transfection kit. Experimental group working solution A: Opti-MEM: 125 μL, Lipo3000: 7.5 μL; Solution B: Opti-MEM: 125 μL, P3000: 5 μL; DNA plasmid: 2.5 μg (representing the CRISPR / Cas9 targeting vectors of the three different sgRNAs constructed in step 1). Transfer solution A to solution B and mix thoroughly, being careful not to vigorously pipette. For the control group working solution, replace the DNA plasmid in solution B with an equal volume of sterile PBS; the remaining components and procedures are the same as for the experimental group working solutions. After preparing the experimental and control group working solutions, let them stand at room temperature for 15 min.

[0066] (4) Remove the prepared cells, discard the original culture medium, and replace it with 2 mL of fresh culture medium (containing 2% to 5% serum) that is low in serum and free of antibiotics.

[0067] (5) Add the above-mentioned settled transfection working solution evenly to the cells that have been replaced with fresh culture medium. Be careful to add it gently and slowly. Shake well and then place the cells in an incubator to continue culturing.

[0068] (6) Change the medium as needed after 24–36 h of culture, depending on the cell condition; after 48 h, observe the expression of green fluorescent protein using a fluorescence microscope (e.g., Figure 4 (As shown).

[0069] 3. Screening of positive clones

[0070] Cell sorting was performed using flow cytometry. Cells were digested with 0.25% trypsin, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Cells were resuspended in culture medium. Cells were filtered through a 100 μm cell sieve (Corning Corporation), and the cell suspension was transferred to flow cytometry tubes (Corning Corporation). Single cells expressing green fluorescent protein were sorted into 96-well plates, resulting in three 96-well plates. Cells were cultured for 4-5 days, with medium changes. Wells containing cells were individually labeled. Once confluent, the cells were transferred to 48-well plates, and then to 24-well plates. After the 24-well plates were confluent, they were transferred to 6-well plates. A small amount of cells was then separated for protein extraction to verify the knockout effect.

[0071] 4. Verification of knockout effect

[0072] Table 1

[0073] Primer name Primer sequence (5'-3') PRAS40-F CTCTGAGTGGGTGGCGATG(SEQ ID NO:4) PRAS40-R GTCTCTGTGGGCTCATCCTC(SEQ ID NO:5) TGFBI-F CCCGCTCGCAGCTTACTTA(SEQ ID NO:6) TGFBI-R CTGCGTCGAAAGTCTCTGGT(SEQ ID NO:7)

[0074] After the monoclonal cells reached confluence, the cells were collected and DNA was extracted. PCR amplification was performed using primers for amplifying long fragments (sequences shown in SEQ ID NO: 4-7 in Table 1). The reaction conditions were: 98℃, 2 min, 1 cycle; 98℃, 10 s, 57℃, 10 s, 72℃, 10 s, 35 cycles; 72℃, 2 min, 1 cycle. The reagent used was 2×T8 High-Fidelity Master Mix (purchased from Qingke Biotechnology Co., Ltd.). After the PCR products were detected by 1.5% agarose gel electrophoresis, the three obtained monoclonal cell lines were subjected to Sanger sequencing.

[0075] Of the three monoclonal cell lines obtained (the cell lines corresponding to the sgRNA1 group, sgRNA2 group, and sgRNA3 group, respectively), only cell line #3 corresponding to the sgRNA3 group was a PRAS40 and TGFBI gene knockout cell line (PRAS40 gene Sanger sequencing diagram is shown below). Figure 5 As shown, the Sanger sequencing diagram of the TGFBI gene is as follows. Figure 6 As shown, neither the sgRNA1 group nor the sgRNA2 group could achieve PRAS40 and TGFBI dual gene knockout. The experiment was repeated three times, and the sequencing results showed that the target sequence of the TGFBI gene in this invention has high cleavage activity. Cell lines constructed using the sgRNA3 target from this embodiment of the invention were cleaved with 100% accuracy. This indicates that the target site of this invention is reliable with 100% accuracy and can be used as an effective method for constructing PRAS40 and TGFBI dual gene knockout cell lines.

[0076] Western blot validation results of PRAS40 and TGFBI genes in cell line #3 are as follows: Figure 7 As shown in the figure, the head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout does not express PRAS40 and TGFBI genes. The embodiment of the present invention successfully constructed a head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout.

[0077] Example 3: Effects of PRAS40 and TGFBI gene knockout on the expression of E-cadherin, a molecular marker of epithelial-mesenchymal transition.

[0078] Experimental methods: (1) Total protein was extracted from the head and neck squamous cell carcinoma cell line with PRAS40 and TGFBI double gene knockout prepared in Example 2: the cell culture medium was discarded, and the cells were washed 2-3 times with pre-cooled 1×PBS. The PBS was dried, and an appropriate amount of cell lysis buffer was added. The cells were then placed on a circular shaker on ice for lysis. After lysing on ice for 30 min, the adherent cells were scraped off thoroughly with a cell scraper and transferred to a 1.5 mL centrifuge tube with a 200 μL pipette. The cells were then broken up in an ultrasonic cell disruptor for 5-10 s until the viscous lysate became clear. The cells were centrifuged at 4 °C and 1200 g for 5 min in a small benchtop refrigerated centrifuge. After centrifugation, the supernatant was transferred to a new 1.5 mL centrifuge tube and stored at -80 °C for later use.

[0079] (2) After determining the protein concentration, denature the protein. Mix the target protein and 5× loading buffer in a 4:1 ratio in a 100μL centrifuge tube or an eight-tube. After mixing, place the mixture in a PCR instrument at 99℃ for 10 min. After cooling to room temperature, use directly or store in a -20℃ refrigerator.

[0080] (3) SDS-PAGE gels were prepared using the Beyotime gel preparation kit. The concentration of the separating gel used in this experiment was 10%, and the concentration of the stacking gel was 5%.

[0081] (4) Sample loading: Calculate the sample loading volume of the protein to be tested based on the concentration of the protein to be tested and the total sample loading amount of 30 μg. The sample loading volume of the protein to be tested should not exceed 20 μL, depending on the size of the sample loading lane (15 wells).

[0082] (5) Electrophoresis: After loading the sample, connect the power supply, close the electrophoresis apparatus cover, ensure good electrode contact, set the initial voltage to 80V, observe the separation of the protein marker staining band after 30 minutes of electrophoresis, and increase the voltage to 120V. When the bromophenol blue indicator band reaches the bottom of the separating gel, end the electrophoresis, take out the gel glass plate and immerse it in the pre-cooled transfer solution.

[0083] (6) Transfer: During the transfer, the program is set to a constant current of 200mA, and the voltage is approximately 70-90mV. The transfer time is 90min.

[0084] (7) Blocking: Prepare 5% skim milk or BSA, add 2.5g milk powder / BSA to 50mL PBST or TBST, place on a shaker and mix thoroughly to completely dissolve the milk or BSA; immerse the PVDF membrane completely in the blocking solution and block at room temperature for 1h.

[0085] (8) Antibody incubation: Prepare primary and secondary antibodies of appropriate concentrations using antibody dilution buffer: Primary antibodies: E-cadherin (1:1000, mouse anti-human, molecular weight: 105 kDa), GAPDH (1:10000, mouse anti-human, molecular weight: 37 kDa); Secondary antibodies: HRP-conjugated goat anti-mouse IgG and goat anti-rabbit IgG (1:2500). Store the prepared primary and secondary antibodies at -20°C for later use. After blocking, remove the PVDF membrane, cut the appropriate PVDF membrane according to the marker staining band and the molecular weight of the target protein, paying attention to distinguishing the front and back sides, and then place it in an antibody incubation box containing the corresponding primary antibody, and incubate overnight at 4°C on a shaker for 10-12 hours. The next day, remove the antibody incubation box, warm it to room temperature for 30 minutes, and then wash it 4 times in a container containing an appropriate amount of PBST for 15 minutes each time. Then incubate with secondary antibody for 1 hour, and then wash with PBST 3-5 times.

[0086] (9) Chemiluminescence: Use tweezers to pick out the washed PVDF membrane, use filter paper to absorb the liquid on the membrane, place it on the luminescence plate of the luminescence instrument, and drop luminescence working solution (prepare an appropriate amount of luminescence working solution according to the ratio of A solution: B solution = 1:1 of the ultrasensitive chemiluminescence detection kit and mix well) on the surface of the membrane to make it evenly cover it; set the instrument parameters to expose and image, and after imaging, select the required image, save and copy it.

[0087] Experimental results are as follows Figure 8As shown in the figure, after knockout of PRAS40 and TGFBI genes, the expression of E-cadherin, a molecular marker of epithelial-mesenchymal transition, was significantly increased compared with PRAS40 knockout cells.

[0088] Example 4: Effects of PRAS40 and TGFBI gene knockout on tumor cell invasion and metastasis

[0089] Cell scratch assay to detect cell migration ability: Well-grown wild-type head and neck squamous cell carcinoma cells, head and neck squamous cell carcinoma cells with PRAS40 and TGFBI double gene knockout prepared in Example 2, and PRAS40 gene knockout cells (PRAS40-KO) were digested and diluted to 5×10⁻⁶ cells respectively. 5 2 mL of cell suspension was added to each well of a six-well plate and cultured for 24 h. When the cell confluence reached 100%, the medium was changed and a scratching operation was performed to wash away the floating cells in the wells. 2 mL of serum-free medium was added. Then, three scratches were selected from each group and photographed under a microscope and marked. After culturing for another 24 h, photographs were taken at the previously marked points. The scratch area at 0 h and 24 h was compared. The scratch healing rate of each group of cells was calculated according to the formula: Healing rate = (0 h scratch area - 48 h scratch area) / 0 h scratch area.

[0090] Transwell assay to detect cell invasion ability: Wild-type head and neck squamous cell carcinoma cells, head and neck squamous cell carcinoma cells with PRAS40 and TGFBI double gene knockout prepared in Example 2, and PRAS40 gene knockout cells (PRAS40-KO) were digested and diluted with medium containing 2% FBS to a concentration of 2×10⁻⁶ cells. 5 Single-cell suspension of / mL was added; 500μL of culture medium containing 10% FBS was added to the lower chamber of the chamber, and 100μL of single-cell suspension was added to the inner chamber of each chamber (purchased from Corning) that was pre-coated with matrix gel (purchased from Corning). The chambers were then placed in an incubator for culture. After 48h of culture, the liquid and cells in the chambers were wiped off, and the chambers were fixed with 4% paraformaldehyde for 20min. After washing, the chambers were transferred to 0.1% crystal violet staining solution for 20min, the staining solution was rinsed off, and the chambers were air-dried. The chambers were inverted on a glass slide, and 5 fields of view were randomly selected under a microscope at 200x magnification to take pictures. The number of cells passing through the chambers was counted and compared for analysis.

[0091] Cell scratch assay results are as follows Figure 9 As shown in the figure, the migration ability of the PRAS40 and TGFBI dual gene knockout cell lines is weakened compared to the PRAS40 gene knockout cell lines (e.g., ...). Figure 9 (As shown in Figures A and B).

[0092] Transwell experimental results are as follows: Figure 9 As shown in the figure, the invasive ability of the PRAS40 and TGFBI dual gene knockout cell lines is weakened compared to the PRAS40 gene knockout cell lines. (e.g.) Figure 9 (As shown in Figures C and D).

[0093] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. Use of an sgRNA in constructing a PRAS40, TGFBI double gene knockout cell line or a product for constructing a PRAS40, TGFBI double gene knockout cell line, characterized in that, The nucleotide sequence of the sgRNA is shown as SEQ ID NO. 3, and the cell line is a PRAS40 knockout head and neck squamous cell carcinoma cell line.

2. The use of an expression cassette, a recombinant vector, a transgenic cell line, or a CRISPR / Cas9 system in constructing a PRAS40, TGFBI double gene knockout cell line or in preparing a product for constructing a PRAS40, TGFBI double gene knockout cell line, characterized in that, The expression cassette, the recombinant vector, the transgenic cell line, and the CRISPR / Cas9 system contain the sgRNA as claimed in claim 1, and the cell line is a PRAS40 knockout head and neck squamous cell carcinoma cell line.

3. Use according to claim 2, characterized in that, The recombinant vector further comprises a U6 promoter, a Cas9 protein, and a fluorescent gene.

4. Use according to claim 3, characterized in that, The fluorescent gene is a GFP fluorescent gene.

5. A method of constructing a PRAS40, TGFBI double-knockout head and neck squamous cell carcinoma cell line, characterized by, The method comprises the following step: introducing the CRISPR / Cas9 system containing the sgRNA as claimed in claim 1 into a PRAS40 knockout head and neck squamous cell carcinoma cell line.

6. A PRAS40, TGFBI double knockout head and neck squamous cell carcinoma cell line, characterized in that, Prepared by the construction method of claim 5.

7. Use of the head and neck squamous cell carcinoma cell line of claim 6 in the preparation of a medicament for reducing the invasion and metastasis of head and neck squamous cell carcinoma cells.

Images