A gene with agglutinating activity isolated from Sinonovacula constricta

Abstract

The gene with agglutinating activity isolated from Sinonovacula constricta provided by the present invention has a nucleotide sequence of SEQ ID NO: 1 and an amino acid sequence of the encoded protein of SEQ ID NO: 2. The present invention also provides an extracellular domain protein with an amino acid sequence of SEQ ID NO: 3, and the extracellular domain protein can be used to bind lipopolysaccharide, peptidoglycan, mannan or bacteria. The present invention constructs a genetically engineered bacterium that has binding activity to lipopolysaccharide, peptidoglycan and mannan, and agglutinating effect on Vibrio splendidus, Vibrio anguillarum, Escherichia coli, Vibrio harveyi, Vibrio parahaemolyticus and Enterococcus faecalis. The extracellular domain protein prepared by the prepared genetically engineered strain has high-efficiency binding activity and agglutinating activity, especially has a strong agglutinating effect on Gram-negative bacteria. The extracellular domain recombinant protein produced by the engineered bacteria is placed in the Sinonovacula constricta breeding environment, thereby enhancing the immunity of the Sinonovacula constricta body and preventing the occurrence of Sinonovacula constricta diseases.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and genetic engineering, and in particular relates to a gene with bacteriostatic activity separated from Sinonovacula constricta. Background Art

[0002] Sinonovacula constricta belongs to the phylum Mollusca, class Bivalvia, and is widely distributed in the intertidal zones and estuarine waters along the western Pacific coast. It is one of the four major cultured shellfish in my country. Sinonovacula constricta has the characteristics of fast growth, high yield, and high efficiency, and is widely used in aquaculture. However, with the expansion of high-density intensive breeding, Sinonovacula constricta germplasm resources are constantly degenerating and threatened by a variety of complex pollutants. During the breeding process, Sinonovacula constricta diseases occur from time to time, especially diseases caused by bacterial pathogens, which greatly restrict the development of Sinonovacula constricta breeding industry.

[0003] At present, the main methods for preventing and controlling bacterial diseases are antibiotics and chemical drugs. However, the long-term use of antibiotics and chemical drugs will lead to the ineffectiveness of antibiotics and also have a certain impact on the breeding environment. Therefore, it is imperative to screen pathogen recognition molecules with good specificity and strong binding activity. Summary of the invention

[0004] The invention provides a gene with agglutinating activity separated from Sinonovacula constricta. The protein encoded by the gene has obvious binding effect on lipopolysaccharide, peptidoglycan and mannan, etc., and has obvious agglutinating effect on Gram-negative bacteria Vibrio splendens, Vibrio anguillarum, Escherichia coli, Vibrio harveyi and Vibrio parahaemolyticus, as well as Gram-positive bacteria Enterococcus faecalis, etc., and can be used as an immunopotentiator for marine aquaculture animals.

[0005] The gene with bacteriostatic activity isolated from Sinonovacula constricta provided by the present invention comprises

[0006] 1) a gene having a nucleotide sequence of SEQ ID NO: 1,

[0007] 2) A gene derived from 1) by replacing, deleting or adding one or more nucleic acids to the gene in 1);

[0008] 3) other alleles from Sinonovacula constricta having no less than 90% homology with the gene having the nucleotide sequence of SEQ ID NO: 1;

[0009] The present invention also provides a protein encoded by the gene, which comprises:

[0010] 1) a protein having an amino acid sequence of SEQ ID NO: 2;

[0011] 2) other allele proteins from Sinonovacula constricta that have no less than 90% homology with the protein with the amino acid sequence of SEQ ID NO: 2;

[0012] In another aspect, the present invention also provides an extracellular domain protein encoded by the gene, wherein the protein comprises:

[0013] 1) a protein having an amino acid sequence of SEQ ID NO: 3;

[0014] 2)) a protein having no less than 90% homology with the protein having the amino acid sequence of SEQ ID NO: 3;

[0015] A specific nucleotide sequence of the gene encoding the extracellular domain protein is SEQ ID NO:4.

[0016] In yet another aspect, the present invention provides a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium is used to recombinantly express the above-mentioned extracellular domain protein.

[0017] The present invention also provides the use of the extracellular domain protein and / or recombinant genetically engineered bacteria in agglutinating bacteria or preparing products for agglutinating bacteria;

[0018] The present invention also provides a product for agglutinating bacteria, wherein the product contains extracellular domain protein and / or recombinant genetically engineered bacteria.

[0019] The bacteria are Gram-negative bacteria Vibrio splendidus, Vibrio anguillarum, Escherichia coli, Vibrio harveyi and Vibrio parahaemolyticus and Gram-positive bacteria Enterococcus faecalis.

[0020] The present invention clones a TLR2-like gene with agglutinating activity from Sinonovacula constricta, and constructs and expresses a recombinant plasmid for the TLR2 extracellular domain LRR protein, thereby obtaining a genetically engineered bacterium having binding activity to lipopolysaccharide, peptidoglycan and mannan, and TLR2-LRR with agglutinating effect on Vibrio splendens, Vibrio anguillarum, Escherichia coli, Vibrio harveyi, Vibrio parahaemolyticus and Enterococcus faecalis. The gene protein of the present invention has a strong agglutinating effect on Gram-negative bacteria. The constructed recombinant strain is placed in a Sinonovacula constricta breeding environment, and the binding ability of TLR2-LRR to negative pathogens and positive pathogens is increased on the basis of the TLR2-LRR produced by the Sinonovacula constricta itself, thereby improving the immunity of the Sinonovacula constricta body and preventing the occurrence of Sinonovacula constricta diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the SDS-PAGE analysis of the recombinant TLR2-LRR protein of Sinonovacula constricta, where lane M is the protein molecular weight standard and lane 1 is the purified recombinant protein.

[0022] Figure 2 This is a diagram for analyzing the binding activity of Sinonovacula constricta recombinant TLR2-LRR protein genetically engineered bacteria to lipopolysaccharide;

[0023] Figure 3 This is a diagram for analyzing the binding activity of Sinonovacula constricta recombinant TLR2-LRR protein genetically engineered bacteria to peptidoglycan;

[0024] Figure 4 This is a diagram for analyzing the binding activity of Sinonovacula constricta recombinant TLR2-LRR protein genetically engineered bacteria to mannan;

[0025] Figure 5 This is a graph showing the agglutination effect of Sinonovacula constricta recombinant TLR2-LRR protein genetically engineered bacteria on Gram-negative bacteria Vibrio splendidus, Vibrio anguillarum, Escherichia coli, Vibrio harveyi and Vibrio parahaemolyticus, as well as Gram-positive bacteria Enterococcus faecalis, where A is the blank control, B is BSA, C is the recombinant TLR2-LRR protein, D is CaCl2 and recombinant TLR2-LRR protein, E is CaCl2, EDTA and recombinant TLR2-LRR protein; and F is lipopolysaccharide, CaCl2 and recombinant TLR2-LRR protein. DETAILED DESCRIPTION

[0026] The present invention amplifies a TLR2-like gene from the genome of Sinonovacula constricta by RACE method. The cDNA sequence of the gene has a total length of 2890 bp, includes an open reading frame of 2169 bp, encodes 722 amino acids, has a 5' non-coding region of 218 bp, a 3' non-coding region of 503 bp, and has a transmembrane domain.

[0027] The gene was amplified using RACE nested primers designed based on the expressed sequence tag EST sequence. The specific steps are as follows:

[0028] (1) Through high-throughput transcriptome sequencing and expression profile analysis of blood cells of Sinonovacula constricta stimulated with Vibrio parahaemolyticus and healthy Sinonovacula constricta, multiple EST sequences encoding TLR2-like genes were discovered, and ESTs encoding partial fragments of Sinonovacula constricta TLR2 were selected for cloning;

[0029] (2) RACE primer design: RACE nested primers were designed based on the EST encoding a partial fragment of Sinonovacula constricta TLR2:

[0030] 3′ upstream specific primer 1: TACAGCTGTGCTTCCACCATTGT,

[0031] 3′ upstream specific primer 2: ACCTGGAGTATAAGAACCTCAGC;

[0032] 5′ downstream specific primer 1: TTCCCGGTATCCGCATAAGCTTC,

[0033] 5′ downstream specific primer 2: TCCTCGTCGATGGTTTCCATTCC;

[0034] Amplify 3' adapter primer Adaptor3: TACCGTCGTTCCACTAGTGATTT,

[0035] Amplify the 5′ adapter primer Adaptor5: CATGGCTACATGCTGACAGCCTA.

[0036] (3) RACE amplification to obtain the full-length sequence of the TLR2 gene of Sinonovacula constricta, the specific steps are as follows:

[0037] a. Total RNA extraction: 1.0 mL of Sinonovacula constricta blood cells were taken, centrifuged at 800 g for 5 min, blood cells were collected, 1.0 mL of Trizol reagent (Takara) was added, vortexed and mixed, and allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was then added, vortexed and mixed, allowed to stand at room temperature for 10 min, centrifuged at 4 ° C, 12000 g for 15 min, the supernatant was drawn into a centrifuge tube, an equal volume of isopropanol was added to the supernatant, mixed, allowed to stand at room temperature for 5 min, centrifuged at 4 ° C, 12000 g for 10 min, the supernatant was removed, 1 mL of 75% ethanol was added to the precipitate, 4 ° C, 12000 g, centrifuged for 5 min, the supernatant was removed, the precipitate was allowed to stand for 5-10 min, 20 μL of RNase-free water was added to obtain an RNA extract;

[0038] b.3′-RACE amplification: The above RNA extract was amplified using 3′-Full RACE Core Set with PrimeScript TM The template for amplification of 3′ was synthesized by reverse transcription using the RTase kit (Takara). The specific synthesis method was performed according to the instructions of the kit. Using this as a template, PCR amplification was performed using the 3′ upstream specific primer 1 and the amplification 3′ adapter primer. 1 μL of the PCR product was taken as a template, and PCR amplification was performed using the 3′ upstream specific primer 2 and the amplification 3′ adapter primer to obtain the 3′ end target band.

[0039] c. 5′-RACE amplification: The RNA extract was reverse transcribed and synthesized using a 5′-Full RACE Kit (Takara) to amplify the 5′ template. The specific synthesis method was performed according to the instructions of the kit. Using this as a template, 5′ downstream specific primer 1 and amplification 5′ adapter primer were used for PCR amplification. 1 μL of the PCR product was taken as a template, and 5′ downstream specific primer 2 and amplification 5′ adapter primer were used for PCR amplification to obtain the 5′ end target band.

[0040] d. The target bands at the 3′ end and the 5′ end of the amplified product were recovered using a gel recovery kit (Baitech), and the recovered product was connected to the vector pMD19-T (Takara Company), transformed into Escherichia coli DH5α (Takara Company), and then cultured in LB plate medium containing 50 μg / mL of ampicillin (LB plate medium formula is tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) for 8-12 hours, and positive clones were picked, PCR verification was performed, and the colonies were sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The results were analyzed and spliced ​​by DNAMAN software to obtain the full-length sequence of the Sinonovacula constricta TLR2 gene, and its gene sequence is shown in SEQ ID NO.1.

[0041] The above RACE amplification reaction system and reaction conditions: template 1.0 μL, 10× PCR buffer (containing Mg 2+ )2.5μL, 2.0μL of 2.5mM dNTP, 1.0μL of 10μM specific primer, 1.0μL of 10μM adapter primer, 0.2μL of 5U / μL DNA polymerase, ultrapure water: 17.3μL; amplification conditions: 94℃5min, 94℃30s, 60℃30s, 72℃1min, a total of 35 cycles, and finally extension at 72℃ for 10min.

[0042] The amino acid sequence of the protein encoded by the TLR2 gene of Sinonovacula constricta provided by the present invention is SEQ ID NO.2, the protein has a molecular weight of 83.05 kDa, and an isoelectric point of 8.61, wherein positions 238-509 of the encoding sequence are LRR domains, positions 515-537 of the encoding sequence are transmembrane sequences, and positions 572-709 of the encoding sequence are TIR domains.

[0043] The amino acid sequence of the extracellular domain protein of the encoded protein is SEQ ID NO.3.

[0044] The present invention also provides a genetically engineered strain for recombinantly expressing the extracellular domain protein with the amino acid sequence of SEQ ID NO.3. The PCR primers are designed and the extracellular domain of the TLR2 protein of Sinonovacula constricta, i.e., the extracellular protein of the TLR2 encoding protein of Sinonovacula constricta, is amplified using primers containing BamH I site and Xho I site respectively; the cloned target gene is inserted into the pET28a(+) vector to obtain the recombinant plasmid pET28a(+)-TLR2-LRR; the recombinant plasmid pET28a(+)-TLR2-LRR is induced to express, and then purified and renatured to obtain the genetically engineered bacteria.

[0045] The specific steps are as follows:

[0046] (1) Cloning of the extracellular domain of TLR2 protein and construction and expression of recombinant protein

[0047] a. Total RNA extraction: 1.0 mL of Sinonovacula constricta blood cells were taken, centrifuged at 800 g for 5 min, blood cells were collected, 1.0 mL of Trizol reagent (Takara) was added, vortexed and mixed, and allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was then added, vortexed and mixed, allowed to stand at room temperature for 10 min, centrifuged at 4 ° C, 12000 g for 15 min, the supernatant was drawn into a centrifuge tube, an equal volume of isopropanol was added to the supernatant, mixed, allowed to stand at room temperature for 5 min, centrifuged at 4 ° C, 12000 g for 10 min, the supernatant was removed, 1 mL of 75% ethanol was added to the precipitate, 4 ° C, 12000 g, centrifuged for 5 min, the supernatant was removed, the precipitate was allowed to stand for 5-10 min, 20 μL of RNase-free water was added to obtain an RNA extract;

[0048] b. cDNA synthesis: The RNA extract was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Company). The specific synthesis method was performed according to the instructions of the cDNA kit. Then, the synthesized cDNA was used as a template and primers containing BamH I site and Xho I site were used to amplify the gene sequence encoding the extracellular domain of Sinonovacula constricta TLR2 protein (amino acid sequence as shown in SEQ ID NO.3). The sequence information of the primers is as follows:

[0049] Primer for upstream amplification of TLR2-LRR containing BamHI site: GGATCCAATATGCTGGTAAAAGTGCCT Primer for downstream amplification of TLR2-LRR containing XhoI site: CTCGAGGTCCAAAATTGTACAAAGCTCTTC

[0050] c. PCR amplification: cDNA 1.0 μL, 10× PCR buffer (containing Mg 2+ ) 2.5 μL, 2.0 μL of dNTP with a concentration of 2.5 mM, 1.0 μL of TLR2-LRR upstream amplification primer with a concentration of 10 μM containing BamH I site, 1.0 μL of TLR2-LRR downstream amplification primer with a concentration of 10 μM containing Xho I site, 0.2 μL of DNA polymerase with a concentration of 5 U / μL, and 17.3 μL of ultrapure water; amplification conditions: 94°C for 5 min, 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, for a total of 35 cycles, and finally extension at 72°C for 10 min;

[0051] d. PCR positive clone plasmid: After the amplification reaction, the PCR product was recovered using a gel recovery kit (Biotech), and then the recovered product was connected to the vector pMD19-T (Takara), transformed into E. coli DH5α (Takara), and cultured in LB plate medium containing 50 μg / mL of ampicillin (LB plate medium formula is tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L) for 8-12 hours, and the positive clone colony was picked for PCR verification and sequencing identification to obtain the correct PCR positive clone plasmid;

[0052] e. Recombinant plasmid: The PCR positive clone plasmid was double-digested with BamH I and Xho I (New England Biolabs, NEB) restriction enzymes, and the target band with a molecular weight of 816 bp was recovered by agarose gel electrophoresis, and ligated with the digestion product of the pET28 (a) prokaryotic expression vector digested with the same enzymes, and transformed into E. coli DH5α, and the positive clones were screened by PCR, and the expression vector pET28 (a)-TLR2-LRR recombinant plasmid with the correct coding frame was obtained by sequencing;

[0053] f. Expression of recombinant protein: The recombinant plasmid pET28(a)-TLR2-LRR of the positive strain was purified using a plasmid extraction kit (Omega) and transformed into the expression host Rosetta (DE3) (Novagen) to obtain the positive strain. The positive strain was then inoculated into LB culture medium with a kanamycin concentration of 50 μg / mL and cultured at 37°C and 200 r / min until the bacterial solution OD reached 0. 600 When the value of is 0.4-0.6, add isopropyl-β-D-thiogalactopyranoside (IPTG) to make the final concentration 1mmol / L, induce expression at 37℃ for 3-6h, collect the bacterial solution, centrifuge at 12000g / min for 5min, discard the supernatant, and obtain the bacterial precipitate;

[0054] (2) Purification and renaturation of recombinant proteins

[0055] a. Protein purification: resuspend 100 mL of bacterial precipitate with 10 mL of inclusion body washing solution, ultrasonically disrupt the bacteria, centrifuge at 12000 g for 10 min, remove the supernatant, resuspend the precipitate with 10 mL of inclusion body dissolution solution, ultrasonically disrupt until the solution becomes clear, centrifuge at 12000 g for 20 min again, and take the supernatant; take 1 mL of Ni-NTA Sefinose TM Resin (Shanghai Biotechnology) was loaded onto the column, washed twice with sterile water, and then equilibrated once with inclusion body solution; the supernatant was mixed with Ni-NTA Sefinose TMResin, mix at 4℃ for 1h, collect the effluent, repeat the column loading twice; wash the medium with impurity protein washing solution, 10mL each time, elute 10 times; add 1mL denatured protein elution solution to soak for 10min, collect the eluate, repeat elution 5 times, collect each eluate and combine, take the eluate for SDS-PAGE electrophoresis to identify the protein bands, and obtain the target protein, i.e., the recombinant TLR2 extracellular domain protein;

[0056] b. Protein renaturation: The purified recombinant TLR2 extracellular domain protein was dialyzed with Buffer 1, Buffer 2, and Buffer 3, respectively, with each dialysis step lasting 6-18 hours. Finally, centrifuge at 12,000 g / min at 4°C for 30 minutes, collect the precipitate, dissolve it to the required concentration, and store it at -20°C for later use.

[0057] In the above step (2),

[0058] The inclusion body washing solution is formulated as follows: 2M urea, 20mM Tris-HCl, 150mM NaCl, 1mM EDTA, 0.5% Triton×100, pH=7.9;

[0059] The inclusion body dissolving solution has a formula of: 8M urea, 20mM Tris-HCl, 150mM NaCl, 0.1% β-mercaptoethanol, 0.2% Triton×100, 30mM imidazole, pH=7.9;

[0060] The formula of the protein washing solution is: 6M urea, 20mM Tris-HCl, 150mM NaCl, 0.1% β-mercaptoethanol, 0.1% Triton×100, 2M imidazole, pH=7.9;

[0061] The formula of the denatured protein eluent is: 6M urea, 20mM Tris-HCl, 150mM NaCl, 2M imidazole, pH=4.5.

[0062] The dialysate Buffer 1 formula is: 20 mM Tris-HCl, 150 mM NaCl, 0.614 g reduced glutathione, 0.0122 g oxidized glutathione, 0.1 M imidazole, 3 M urea, 50 mL glycerol, 50 μL Tween-20, fixed to 1 L, pH = 7.9;

[0063] The dialysate Buffer 2 formula is: 20 mM Tris-HCl, 150 mM NaCl, 0.614 g reduced glutathione, 0.0122 g oxidized glutathione, 50 mM imidazole, 1 M urea, 50 mL glycerol, 50 μL Tween-20, fixed to 1 L, pH = 7.9;

[0064] The dialysate Buffer 3 formula is: 20 mM Tris-HCl, 150 mM NaCl, 50 mL glycerol, fixed to 1 L, pH = 7.9.

[0065] The present invention also provides the application of the recombinant TLR2-LRR genetic engineering bacteria, and the TLR2-LRR protein expressed by the recombinant TLR2-LRR bacteria has obvious binding effects on lipopolysaccharide, peptidoglycan and mannan; and has obvious agglutination effects on Gram-negative bacteria Vibrio splendidus, Vibrio anguillarum, Escherichia coli, Vibrio harveyi and Vibrio parahaemolyticus as well as Gram-positive bacteria Enterococcus faecalis.

[0066] The present invention is further described in detail below with reference to the accompanying drawings.

[0067] Example 1: Cloning and sequence analysis of TLR2-like genes

[0068] 1) Through high-throughput transcriptome sequencing and expression profile analysis of blood cells of Sinonovacula constricta stimulated by Vibrio parahaemolyticus and healthy Sinonovacula constricta, multiple EST sequences encoding TLR2-like genes were discovered, and some EST fragments were selected for cloning;

[0069] 2) RACE primer design: RACE nested primers were designed based on the EST clone encoding a partial fragment of Sinonovacula constricta TLR2:

[0070] 3′ upstream specific primer 1: TACAGCTGTGCTTCCACCATTGT,

[0071] 3′ upstream specific primer 2: ACCTGGAGTATAAGAACCTCAGC;

[0072] 5′ downstream specific primer 1: TTCCCGGTATCCGCATAAGCTTC,

[0073] 5′ downstream specific primer 2: TCCTCGTCGATGGTTTCCATTCC;

[0074] Amplify 3' adapter primer Adaptor3: TACCGTCGTTCCACTAGTGATTT,

[0075] Amplify the 5′ adapter primer Adaptor5: CATGGCTACATGCTGACAGCCTA.

[0076] 3) RACE amplification to obtain the full-length sequence of TLR2 gene, the specific steps are as follows:

[0077] a. Total RNA extraction: 1.0 mL of Sinonovacula constricta blood cells were taken, centrifuged at 800 g for 5 min, blood cells were collected, 1.0 mL of Trizol reagent (Takara) was added, vortexed and mixed, and allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was then added, vortexed and mixed, allowed to stand at room temperature for 10 min, centrifuged at 4 ° C, 12000 g for 15 min, the supernatant was drawn into a centrifuge tube, an equal volume of isopropanol was added to the supernatant, mixed, allowed to stand at room temperature for 5 min, centrifuged at 4 ° C, 12000 g for 10 min, the supernatant was removed, 1 mL of 75% ethanol was added to the precipitate, 4 ° C, 12000 g, centrifuged for 5 min, the supernatant was removed, the precipitate was allowed to stand for 5-10 min, 20 μL of RNase-free water was added to obtain an RNA extract;

[0078] b.3'-RACE amplification: The above RNA extract was amplified using 3'-Full RACE Core Set with PrimeScript TM The template for 3' amplification was synthesized by reverse transcription using the RTase kit (Takara). The specific synthesis method was performed according to the instructions of the kit. Using this as a template, PCR amplification was performed using the 3' upstream specific primer 1 and the 3' adapter amplification primer Adaptor3. 1 μL of the PCR product was taken as a template, and PCR was performed using the 3' upstream specific primer 2 and the 3' adapter amplification primer Adaptor3 to obtain the 3' end target band.

[0079] c. 5'-RACE amplification: The RNA extract was reverse transcribed and synthesized using a 5'-Full RACE Kit (Takara) to amplify the 5' template. The specific synthesis method was performed according to the instructions of the kit. Using this as a template, 5' downstream specific primer 1 and 5' adapter primer Adaptor5 were used for PCR amplification. 1 μL of the PCR product was taken as a template, and 5' downstream specific primer 2 and 5' adapter primer Adaptor5 were used for PCR to obtain the 5' end target band.

[0080] d. The amplified product was recovered using a gel recovery kit (Biotech), and the recovered product was connected to the vector pMD19-T (Takara), transformed into E. coli DH5α (Takara), and then cultured in LB (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) plate medium containing 50 μg / mL of ampicillin for 8-12 hours, and the positive clone colonies were picked, PCR verified and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The results were analyzed and spliced ​​by DNAMAN software to obtain the full-length sequence;

[0081] Among them, the RACE amplification reaction system and reaction conditions: template 1.0 μL, 10× PCR buffer (containing Mg 2+ )2.5μL, 2.0μL of 2.5mM dNTP, 1.0μL of 10μM specific primer, 1.0μL of 10μM Adaptor, 0.2μL of 5U / μL DNA polymerase, 17.3μL of ultrapure water; amplification conditions: 94℃5min, 94℃30s, 60℃30s, 72℃1min, a total of 35 cycles, and finally 72℃ extension for 10min;

[0082] The cDNA sequence of the TLR2 gene of Sinonovacula constricta obtained is shown in SEQ ID NO: 1, which has a total length of 2890 bp, including an open reading frame of 2169 bp, encoding 723 amino acids, a 5' non-coding region of 218 bp, and a 3' non-coding region of 503 bp. The amino acid sequence of the protein encoded by the TLR2 gene of Sinonovacula constricta is shown in SEQ ID NO: 2, and the molecular weight of the protein is 83.05 kDa, and the isoelectric point is 8.61, wherein the 515-537 positions of the coding sequence are transmembrane sequences, and the 238-509 positions of the coding sequence are extracellular domain proteins (the amino acid sequence is shown in SEQ ID NO: 3). The nucleotide sequence encoding the extracellular domain protein is SEQ ID NO: 4.

[0083] Example 2: Construction of genetically engineered bacteria for recombinant Sinonovacula constricta TLR2-LRR

[0084] 1. Cloning of the extracellular domain of TLR2 protein and construction and expression of recombinant protein

[0085] a. Total RNA extraction: 1.0 mL of Sinonovacula constricta blood cells were collected by centrifugation at 800 g for 5 min, 1.0 mL of Trizol reagent (Takara) was added, the mixture was shaken and mixed, and the mixture was allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was then added, the mixture was shaken and mixed, and the mixture was allowed to stand at room temperature for 10 min. The mixture was centrifuged at 4°C, 12000 g for 15 min, the supernatant was aspirated into a centrifuge tube, an equal volume of isopropanol was added to the supernatant, the mixture was mixed, the mixture was allowed to stand at room temperature for 5 min, the mixture was centrifuged at 4°C, 12000 g for 10 min, the supernatant was removed, 1 mL of 75% ethanol by mass was added to the precipitate, the mixture was centrifuged at 4°C, 12000 g for 5 min, the supernatant was removed, the precipitate was allowed to stand for 5-10 min, 20 μL of RNase-free water was added to obtain an RNA extract;

[0086] b. cDNA synthesis: The RNA extract was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Company). The specific synthesis method was performed according to the instructions of the cDNA kit. Then, the synthesized cDNA was used as a template and primers containing BamH I site and Xho I site were used to amplify the gene sequence encoding the extracellular domain of TLR2 protein of Sinonovacula constricta (the amino acid sequence is shown in SEQ ID NO.3), which is as follows:

[0087] The upstream amplification primer of TLR2-LRR containing BamH I site is GGATCCAATATGCTGGTAAAAGTGCCT, and the downstream amplification primer of TLR2-LRR containing Xho I site is CTCGAGGTCCAAAATTGTACAAAGCTCTTC.

[0088] c. PCR amplification: cDNA 1.0 μL, 10× PCR buffer (containing Mg 2+ ) 2.5μL, 2.0μL of 2.5mM dNTP, 1.0μL of upstream and downstream primers at 10μM, 0.2μL of 5U / μL DNA polymerase, and 17.3μL of ultrapure water; amplification conditions: 94℃5min, 94℃30s, 60℃30s, 72℃1min, a total of 35 cycles, and finally 72℃ extension for 10min;

[0089] d. PCR positive clone plasmid: After the amplification reaction, the PCR product was recovered using a gel recovery kit (Biotech), and then the recovered product was connected to the vector pMD19-T (Takara), transformed into E. coli DH5α (Takara), and cultured in LB (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) plate medium containing 50 μg / mL of ampicillin for 8-12 hours, and the positive clone colonies were picked for PCR verification and sequencing identification to obtain the correct positive clone plasmid;

[0090] e. Recombinant plasmid: The PCR positive clone plasmid was double-digested with restriction endonucleases BamH I and Xho I (New England Biolabs, NEB), and the target band with a molecular weight of 816 bp was recovered by agarose gel electrophoresis, and ligated with the digestion product of the pET28(a) prokaryotic expression vector digested with the same enzymes, and transformed into E. coli DH5α. Positive clones were screened by PCR, and the expression vector pET28(a)-TLR2-LRR recombinant plasmid with the correct coding frame was obtained by sequencing;

[0091] f. Expression of recombinant protein: The recombinant plasmid pET28(a)-TLR2-LRR of the positive strain was purified using a plasmid extraction kit (Omega) and transformed into the expression host Rosetta (DE3) (Novagen) to obtain the positive strain. The positive strain was then inoculated into LB culture medium with a kanamycin concentration of 50 μg / mL and cultured at 37°C and 200 r / min until the bacterial solution OD 600 When the value of is 0.4-0.6, add isopropyl-β-D-thiogalactopyranoside (IPTG) to make the final concentration 1mmol / L, induce expression at 37℃ for 3-6h, collect the bacterial solution, centrifuge at 12000g / min for 5min, discard the supernatant, and obtain the bacterial precipitate;

[0092] 2. Purification and refolding of recombinant proteins

[0093] a. Protein purification: resuspend every 100 mL of bacterial precipitate with 10 mL of inclusion body washing solution, ultrasonically disrupt the bacteria, centrifuge at 12000g for 10 min, remove the supernatant, resuspend the precipitate with 5 mL of inclusion body dissolution solution, ultrasonically disrupt until the solution becomes clear, centrifuge at 12000g for 20 min again, and take the supernatant; take 1 mL of Ni-NTA Sefinose TM Resin (Shanghai Biotechnology) was loaded onto the column, washed twice with sterile water, and then equilibrated once with inclusion body solution; the supernatant was mixed with the Ni-NTA Sefinose TM Resin, mixed at 4℃ for 1h, collected the effluent, and repeated the column loading twice; washed the medium with impurity protein washing solution, 10mL each time, eluted 10 times; added 1mL denatured protein elution solution to soak for 10min, collected the eluate, repeated elution 5 times, collected each eluate and combined, took a small amount of eluate for SDS-PAGE electrophoresis to identify each protein band, and obtained the recombinant Sinonovacula constricta TLR2 extracellular domain protein ( Figure 1 , the arrow indicates the target protein);

[0094] b. Protein renaturation: The purified recombinant Sinonovacula constricta TLR2 extracellular domain protein was dialyzed with dialysis buffer 1, dialysis buffer 2, and dialysis buffer 3, respectively, with each dialysis step lasting 6-18 hours. Finally, the protein was centrifuged at 4°C and 12000 g / min for 30 minutes, and the precipitate was collected, which was the recombinant Sinonovacula constricta TLR2-LRR genetically engineered bacteria, and dissolved to the required concentration for PAMPs binding activity analysis.

[0095] The above inclusion body washing solution has the following formula: 2M urea, 20mM Tris-HCl, 150mM NaCl, 1mM EDTA, 0.5% Triton×100, pH=7.9;

[0096] The above inclusion body dissolving solution has the following formula: 8M urea, 20mM Tris-HCl, 150mM NaCl, 0.1% β-mercaptoethanol, 0.2% Triton×100, 30mM imidazole, pH=7.9;

[0097] The formula of the protein washing solution is: 6M urea, 20mM Tris-HCl, 150mM NaCl, 0.1% β-mercaptoethanol, 0.1% Triton×100, 2M imidazole, pH=7.9;

[0098] The formula of the denatured protein eluent is: 6M urea, 20mM Tris-HCl, 150mM NaCl, 2M imidazole, pH=4.5.

[0099] The dialysate Buffer 1 formula is: 20 mM Tris-HCl, 150 mM NaCl, 0.614 g reduced glutathione, 0.0122 g oxidized glutathione, 0.1 M imidazole, 3 M urea, 50 mL glycerol, 50 μL Tween-20, fixed to 1 L, pH = 7.9;

[0100] The dialysate Buffer 2 formula is: 20 mM Tris-HCl, 150 mM NaCl, 0.614 g reduced glutathione, 0.0122 g oxidized glutathione, 50 mM imidazole, 1 M urea, 50 mL glycerol, 50 μL Tween-20, fixed to 1 L, pH = 7.9;

[0101] The dialysate Buffer 3 formula is: 20 mM Tris-HCl, 150 mM NaCl, 50 mL glycerol, fixed to 1 L, pH = 7.9.

[0102] Example 3: Analysis of endotoxin binding activity of Sinonovacula constricta recombinant protein

[0103] (1) Lipopolysaccharides (LPS from Escherichia coli 0111:B4, Sigma), peptidoglycan (PGN from Staphylococcus aureus, source leaf), and mannan (MAN from Saccharomyces cerevisiae, Sigma) were dissolved in 50 mM carbonate buffer, pH 9.6, to a final concentration of 2 mg / mL. 20 μL of each was added to a 96-well plate, with five replicates per group, and incubated overnight at 4°C.

[0104] (2) The three pathogen-associated molecular patterns (PAMPs) incubated overnight were washed three times with PBST buffer, blocked with 200 μL of 5% BSA buffer, and allowed to stand at 37°C for 1 h;

[0105] (3) Pour off the BSA buffer in the previous step, wash three times with PBST buffer, add 100 μL of the recombinant Sinonovacula constricta TLR2-LRR genetic engineering bacteria prepared in Specific Example 2, blank control (0.05 M, pH 7.4 Tris-HCl buffer solution TBS), and control protein (BSA), respectively, and set the concentrations to 0, 2.5, 5, 7.5, 10, 12.5, 17.5, and 20 μg / 100 μL, respectively, and incubate at 37° C. for 1 h;

[0106] (4) Wash three times with PBST buffer, add 100 μL Mouse Anti-His Tag monoclonal antibody (1:1000) to each well, and incubate at 37°C for 1 h;

[0107] (5) Gently pour out the solution from the previous step, wash three times with PBST buffer, add 100 μL of alkaline phosphatase-labeled goat anti-mouse IgG secondary antibody (1:3000), and incubate at 37°C for 1 h;

[0108] (6) Gently pour out the solution from the previous step, wash four times with PBST buffer, add 100 μL PNPP colorimetric solution (Beijing Saichi Biotechnology Co., Ltd.), and incubate at room temperature in the dark for 30 min;

[0109] (7) Add 50 μL of 3 M NaOH stop solution to the 96-well plate in the previous step, incubate for 15 min to terminate the reaction, and measure the absorbance of the solution at 405 nm.

[0110] The results show that Figure 2 , Figure 3 and Figure 4As shown, the recombinant protein TLR2-LRR of Sinonovacula constricta has significant binding activity to lipopolysaccharide, peptidoglycan and mannan, and the maximum binding parameters are 2.6026, 2.6366 and 2.0567, respectively.

[0111] Example 4: Analysis of the bacteriostatic activity of Sinonovacula constricta recombinant protein TLR2-LRR

[0112] (1) Bacterial FITC labeling: The bacteria to be labeled were cultured to the middle and late exponential growth stages, centrifuged at 4°C, 5000 g for 10 min, the supernatant discarded, washed twice with PBS (0.01 M, pH 7.4), centrifuged at 4°C, 5000 g for 10 min, and then prepared into a bacterial suspension with carbonate buffer (0.5 M, pH 9.5). FITC solution (see instructions) was added to make the final concentration of FITC in the bacterial suspension 50-100 μg / mL. The suspension was stirred at room temperature for 1-2 h, centrifuged at 4°C, 5000 g for 10 min, the supernatant discarded, washed twice with PBS, centrifuged at 4°C, 5000 g for 10 min, and the precipitate was prepared with PBS to a concentration of 0.5 × 10 9 After labeling, the suspension was confirmed by fluorescence microscopy and stored at 4℃ in the dark.

[0113] (2) FITC-labeled Vibrio splendens, Vibrio anguillarum, Escherichia coli, Vibrio harveyi, Vibrio parahaemolyticus, and Enterococcus faecalis were resuspended in TBS buffer (50 mM Tris-HCl, 50 mM NaCl, pH 7.5) and TBS-CaCl2 buffer (50 mM Tris-HCl, 50 mM NaCl, 10 mM CaCl2, pH 7.5), respectively, to a concentration of 1 × 10 9 CFU / mL.

[0114] (3) In a 1.5 mL EP tube, take 200 μL of resuspended bacterial solution and mix with 100 μL BSA; take 100 μL of resuspended bacterial solution and mix with 100 μL recombinant protein; take 100 μL of resuspended bacterial solution, 100 μL recombinant protein and CaCl2 (10 mM) and mix; take 100 μL of resuspended bacterial solution, 100 μL recombinant protein and CaCl2 (10 mM) and mix. 2+ Chelating agent EDTA (10mM) was mixed, and in the control group, 200μL of the resuspended bacterial solution was mixed and incubated at room temperature in the dark for 1h, and 10μL was observed under a fluorescence microscope.

[0115] The results are as follows Figure 5As shown, the recombinant protein TLR2 of Sinonovacula constricta has significant agglutination activity against Vibrio anguillarum, Vibrio splendidus, Vibrio harveyi, Enterococcus faecalis, Escherichia coli, and Vibrio parahaemolyticus in a calcium ion environment. Compared with the calcium ion chelation conditions, the agglutination activity was significantly increased by 7.298 times, 4.732 times, 6.095 times, 11.354 times, 16.534 times, and 18.128 times, respectively.

[0116] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A gene, characterized in that The nucleotide sequence of the gene is SEQ ID NO:

1.

2. A protein, characterized in that The protein is encoded by the gene according to claim 1, and its amino acid sequence is SEQ ID NO:

2.

3. An extracellular domain protein, characterized in that The extracellular domain protein is encoded by the gene fragment of claim 1, and its amino acid sequence is SEQ ID NO:

3.

4. A recombinant engineering strain, characterized in that: The recombinant engineering strain is used to recombinantly express the extracellular domain protein described in claim 3.

5. A product for improving immunity of Sinonovacula constricta, characterized in that: The product contains the extracellular domain protein according to claim 3 and / or the recombinant engineering strain according to claim 4.

Images