Recombinant dna molecules encoding coronavirus antigens, dna vaccines and uses
By designing recombinant nucleic acid molecules encoding the RBD regions of SARS-CoV and SARS-CoV-2 Beta mutant strains, optimizing nucleotide sequences and signal peptides, inserting them into eukaryotic expression vectors, and activating immune responses, the problem of decreased neutralizing antibody efficiency in COVID-19 vaccines against mutant strains was solved, achieving broad-spectrum immune protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ADVACCINE SUZHOU BIOPHARMACEUTICALS CO LTD
- Filing Date
- 2022-07-25
- Publication Date
- 2026-07-28
AI Technical Summary
Existing COVID-19 vaccines show reduced neutralizing antibody efficiency when facing coronavirus mutant strains, especially the Omeprone variant, making it difficult to provide broad-spectrum immune protection.
Recombinant nucleic acid molecules encoding the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein were designed, and by tandem optimization of nucleotide sequences and signal peptides, they were inserted into eukaryotic expression vectors, introduced into host cells, and activated humoral and cellular immune responses.
It achieved broad-spectrum immunity against SARS-CoV and SARS-CoV-2 viruses and their mutant strains, significantly stimulating antigen-specific antibodies and IFN-γ responses, and effectively preventing and treating viral infections and related diseases.
Smart Images

Figure CN117448362B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to recombinant DNA molecules encoding coronavirus antigens, DNA vaccines, and their applications. Background Technology
[0002] Coronaviruses belong to the family Coronaviridae, which includes four genera: alpha coronavirus, beta coronavirus, gamma coronavirus, and delta coronavirus. The novel coronavirus (SARS-CoV-2) belongs to the beta coronavirus genus. It is mainly transmitted through respiratory droplets and can also be transmitted through contact, causing pneumonia (Novel Coronavirus-infected Pneumonia, NCP). The general population is susceptible to it.
[0003] Currently, the World Health Organization classifies COVID-19 mutant strains into two main categories: mutants of concern (VOI) and mutants of concern (VOC). To date, there are five VOC mutant strains: Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and Omicron (B.1.1.529); and eight VOI mutant strains: Epsilon (B.1.427 / 429), Zeta (P.2), Theta (P.3), Eta (B.1.525), Iota (B.1.526), Kappa (B.1.617.1), Lambda (C.37), and Mu (B.1.621). The Omeprone mutant strain has over 30 mutations in the Spike region of its main protective antigen, and 15 mutation sites in its receptor-binding domain (RBD), 11 of which are in the receptor-binding motif (RBM) region. These include three mutations found in beta and gamma mutants: 417, 484, and 501. N501Y is also present in the alpha mutant. Current research indicates that most RBD antibodies bind to the RBM region; mutations in the RBM region can easily affect antibodies bound to these regions, leading to escape. Notably, four additional mutation sites outside the RBM region are located at the interaction interface of the S monomer, potentially affecting trimer stability. Furthermore, of the 15 mutations, nine sites are not conserved between SARS-CoV-2S and SARS-CoV S, indicating that the majority of mutations occur in non-conserved regions. Meanwhile, mutation sites in the N-terminal domain (NTD) are concentrated in four locations: A67V / Del69-70, T95I, G142D / Del143-145, and Del211 / L212I. These four sites are structurally located on the NTD surface and are also common recognition sites for SARS-CoV-2 NTD antibodies. Therefore, simultaneous mutations at these sites can affect the affinity and neutralizing activity of NTD antibodies. Based on current understanding of the mutation sites, this variant has broken through the protection of most neutralizing antibodies. Some preliminary data indicate that this variant reduces the neutralizing antibody level of SARS-CoV-2 vaccines by about 40 times compared to the wild type. Given the emergence of various frequently occurring variants and the super-spreading omeprazole, developing a broad-spectrum vaccine that can "respond to all changes with the same approach" is an effective means of dealing with the frequent emergence of variants.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] One of the objectives of this invention is to provide a recombinant nucleic acid molecule encoding SARS-CoV and SARS-CoV-2 viral antigens, with the expectation of achieving a broad-spectrum immune effect that is "unchanging in the face of all changes".
[0006] The second objective of this invention is to provide biological materials comprising the above-mentioned recombinant nucleic acid molecules.
[0007] The third objective of this invention is to provide applications of the aforementioned biomaterials.
[0008] The fourth objective of this invention is to provide a DNA vaccine for SARS-CoV and / or SARS-CoV-2 viruses comprising the above-mentioned recombinant nucleic acid molecules and / or biological materials.
[0009] The fifth objective of this invention is to provide a method for preparing the aforementioned DNA vaccine.
[0010] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solutions:
[0011] In a first aspect, the present invention provides a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising any one of the following (a) to (c):
[0012] (a) The recombinant DNA molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Beta mutant strain.
[0013] (b) A DNA molecule derived from (a) in which one or more nucleotides are substituted, deleted or added to the nucleotide sequence of the recombinant DNA molecule defined in (a) and which functions to encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein.
[0014] (c) A nucleic acid molecule that hybridizes under stringent conditions with the nucleotide sequence of a recombinant DNA molecule defined in (a) or a DNA molecule defined in (b) and encodes the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein.
[0015] In an optional embodiment, the amino acid sequence encoded by the first DNA molecule is shown in Seq_1; the amino acid sequence encoded by the second DNA molecule is shown in Seq_2.
[0016] In an optional embodiment, the nucleotide sequence of the first DNA molecule is shown in Seq_3; and the nucleotide sequence of the second DNA molecule is shown in Seq_4.
[0017] In an optional embodiment, the nucleotide sequence of the recombinant nucleic acid molecule is as shown in Seq_5, or has at least 90% identity with the nucleotide sequence shown in Seq_5, and encodes the nucleotide sequence of the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region.
[0018] In a second aspect, the present invention provides biological materials, including:
[0019] (I) A construct comprising the recombinant nucleic acid molecule described in any of the foregoing embodiments; and a third nucleic acid molecule encoding a signal peptide attached to the 5' end of the recombinant nucleic acid molecule;
[0020] (II) A recombinant expression vector, comprising an original expression vector; and, inserting a coding nucleic acid fragment into the original expression vector, wherein the coding nucleic acid fragment is selected from the recombinant nucleic acid molecule described in any of the foregoing embodiments or the construct described in (I); preferably, the original expression vector is a eukaryotic expression vector, more preferably, the original expression vector is a pVAX1 plasmid;
[0021] (III) A transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from insect cells, yeast, avian cells or mammalian cells; preferably, the host cell is HEK293, CHO or COS-7;
[0022] (IV) A polypeptide, including a polypeptide encoded by a recombinant nucleic acid molecule as described in any of the foregoing embodiments, a polypeptide encoded by the construct described in (I), or a polypeptide obtained by expression of a transformant described in (III);
[0023] (V) An antibody that specifically binds to the polypeptide described in (IV).
[0024] In an optional embodiment, the signal peptide encoded by the third nucleic acid molecule includes the following (c) or (d):
[0025] (c) Signal peptide with amino acid sequence as shown in Seq_6;
[0026] (d) A signal peptide derived from (c) that has one or more amino acids substituted, deleted or added to the amino acid sequence of the signal peptide defined in (c) and has the function of a signal peptide.
[0027] Thirdly, the present invention provides the use of the recombinant nucleic acid molecule or the biological material described in any of the foregoing embodiments in the following (A) or (B):
[0028] (A) To prepare vaccines for the prevention and / or treatment of SARS-CoV and / or SARS-CoV-2 virus infection;
[0029] (B) To prepare drugs for the prevention and / or treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 viruses.
[0030] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.
[0031] Fourthly, the present invention provides a DNA vaccine, which includes the recombinant nucleic acid molecule described in any of the foregoing embodiments or the recombinant expression vector described in any of the foregoing embodiments.
[0032] In an optional embodiment, the DNA vaccine further includes at least one of a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient;
[0033] And / or, at least one drug that has therapeutic effects against SARS-CoV and / or SARS-CoV-2 virus;
[0034] Preferably, the adjuvant includes at least one of aluminum adjuvant, TLR ligand, metal ion, cytokine or chemokine adjuvant;
[0035] More preferably, the metal ion includes Mn 2+ and / or Zn 2+ .
[0036] In an optional embodiment, the recombinant nucleic acid molecule or the recombinant expression vector described in any of the foregoing embodiments is introduced into a host cell and cultured, and the recombinant nucleic acid molecule or recombinant expression vector is extracted from the host cell to prepare a DNA vaccine.
[0037] Fifthly, the present invention provides the application of the DNA vaccine described in the foregoing embodiments in the following (i) to (iv):
[0038] (i) Regulate the body's immune function;
[0039] (ii) Anti-SARS-CoV-2 virus infection;
[0040] (iii) Anti-SARS-CoV infection;
[0041] (iv) Prevent immunopathological damage.
[0042] Preferably, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.
[0043] In a sixth aspect, the present invention provides a method for preventing and / or treating mammalian infection with SARS-CoV and / or SARS-CoV-2 virus, the method comprising inoculating the mammal with the aforementioned DNA vaccine.
[0044] Preferably, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.
[0045] Preferably, the mammal is a human.
[0046] This invention recombines a nucleic acid molecule encoding the RBD region of the SARS-CoV S protein with a nucleic acid molecule encoding the RBD region of the SARS-CoV-2 Beta mutant S protein. The polypeptide encoded by the recombinant nucleic acid molecule possesses dual immunogenicity against both the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region. When this dual-immunogenic polypeptide is used as an immune effector component of a vaccine, the induced neutralizing antibodies can simultaneously induce an immune response against both the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region. Furthermore, by employing a dual-antigen design targeting the distantly related SARS-CoV and SARS-CoV-2, the conserved antigenic epitopes against the β-coronavirus genus are amplified to maximize the immune effect, thereby avoiding antigenic drift caused by continuous mutations within the SARS-CoV-2 family and achieving a broad-spectrum immune effect that is "unchanging in the face of all changes." Meanwhile, the tandem sequence of the SARS-Beta RBD chosen in the protein domain tandem strategy, compared to the tandem sequence of the Beta-SARS RBD, keeps the two antigen domains of SARS RBD and Beta RBD far apart and allows for full exposure of the corresponding domains. The more fully the antigen domains are exposed, the more complete the corresponding antibody response spectrum will be, and the better the immune effect will be.
[0047] Based on the beneficial effects of the aforementioned recombinant nucleic acid molecules, this invention also provides a method for preparing the aforementioned recombinant nucleic acid molecules, the biological materials used in preparing the aforementioned recombinant nucleic acid molecules, and the polypeptides expressed by the aforementioned recombinant nucleic acid molecules. Simultaneously, it provides a DNA vaccine using the aforementioned biological materials as the main immune component and its preparation method. Verification has shown that this DNA vaccine can not only be effectively transcribed and expressed in mammalian cells but also exhibits good immunogenicity. For humoral immune responses, this DNA vaccine can significantly induce antigen-specific antibodies in experimental animals on day 14 after primary immunization and day 7 after booster immunization. It can produce antibodies not only against the wild-type antigen of SARS-CoV-2 but also against the Delta mutant antigen, Beta mutant antigen, Omicron mutant antigen, and SARS-CoV antigen, and possesses neutralizing activity. For cellular immune responses, this DNA vaccine can induce high levels of antigen-specific IFN-γ responses.
[0048] Based on this, the DNA vaccine provided by the present invention can modulate the body's immune function, effectively prevent infection by SARS-CoV and / or SARS-CoV-2 virus and its mutant strains, and also intervene in the treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 virus and its mutant strains. Attached Figure Description
[0049] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0050] Figure 1 This is a graph showing the DNA sequence codon optimization index scoring results provided in Embodiment 1 of the present invention;
[0051] Figure 2 This is a graph showing the GC content scoring results of the optimized DNA sequence provided in Example 1 of the present invention;
[0052] Figure 3 This is a graph showing the scoring results of the number of negative regulatory elements after DNA sequence optimization provided in Embodiment 1 of the present invention;
[0053] Figure 4 This is a graph showing the fold change of qPCR expression after DNA sequence optimization provided in Example 1 of the present invention;
[0054] Figure 5 This is a structural diagram of the binding protein provided in Embodiment 1 of the present invention;
[0055] Figure 6 The results of qPCR expression of the wild-type SARS-CoV-2 and broad-spectrum candidate DNA vaccine provided in Example 3 of this invention;
[0056] Figure 7 The results of Western Blot detection of antigen proteins for the novel coronavirus wild-type strain and broad-spectrum candidate DNA vaccine provided in Example 4 of this invention;
[0057] Figure 8 The results of ELISA detection of antigen proteins for the novel coronavirus wild-type strain and broad-spectrum candidate DNA vaccine provided in Example 5 of this invention;
[0058] Figure 9 The results of antigen-specific antibodies on day 14 after primary immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 6 of this invention;
[0059] Figure 10 The results of antigen-specific antibodies on day 7 after booster immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 6 of this invention;
[0060] Figure 11 The results of neutralizing antibodies on day 7 after booster immunization with the broad-spectrum candidate DNA vaccine for coronavirus provided in Example 6 of this invention;
[0061] Figure 12 The results of antigen-specific IFN-γ ELISOPT on day 10 after booster immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 6 of this invention;
[0062] Figure 13 This is a visual representation of the antigen-specific ELISOPT results on day 10 after booster immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 6 of this invention. Detailed Implementation
[0063] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature and laboratory procedures and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry described herein are those well known and commonly used in the art.
[0064] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.
[0065] It should be noted that similar reference numerals and letters in the following figures indicate similar items; therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures. Furthermore, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.
[0066] In one specific embodiment, in a first aspect, the present invention provides a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising any one of the following (a) to (c):
[0067] (a) The recombinant DNA molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Beta mutant strain.
[0068] (b) A DNA molecule derived from (a) in which one or more nucleotides are substituted, deleted or added to the nucleotide sequence of the recombinant DNA molecule defined in (a) and which functions to encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein.
[0069] (c) A nucleic acid molecule that hybridizes under stringent conditions with the nucleotide sequence of a recombinant DNA molecule defined in (a) or a DNA molecule defined in (b) and encodes the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein.
[0070] It should be noted that this invention does not limit the connection order of the first and second DNA molecules. In some embodiments, the recombinant nucleic acid molecule includes a first DNA molecule and a second DNA molecule connected sequentially from the 5' end to the 3' end. In other embodiments, the recombinant nucleic acid molecule obtained by changing the order of the first DNA molecule and the second DNA molecule can still have broad-spectrum immunogenicity. Those skilled in the art can select the connection order of the first DNA molecule and the second DNA molecule according to specific experimental conditions and actual needs. The connection methods given in the embodiments of this invention are only examples and not restrictions on the connection order.
[0071] It is understood that the hybridization of the recombinant nucleic acid molecule (c) with the recombinant DNA molecule (a) or DNA molecule (b) under "strict conditions" refers to the recombinant nucleic acid molecule (c) obtained by hybridization using the recombinant DNA molecule (a) or DNA molecule (b) as a template, strictly following the base pairing principle. Furthermore, those skilled in the art should recognize that the recombinant nucleic acid molecule (c) includes both replicated DNA molecules and various RNA molecules transcribed from DNA.
[0072] Furthermore, the nucleotide sequence provided by this invention is obtained by optimizing a unique codon optimization system.
[0073] In an optional embodiment, the amino acid sequence encoded by the first DNA molecule is shown in Seq_1; the amino acid sequence encoded by the second DNA molecule is shown in Seq_2.
[0074] It should be noted that the SARS-CoV S protein RBD region fragment and the SARS-CoV-2 Beta mutant S protein RBD region fragment influence each other during polypeptide spatial conformation folding. The tandem sequence of the SARS-Beta RBD, compared to the Beta-SARS RBD, keeps the two antigenic domains of the SARS RBD and Beta RBD far apart, allowing for sufficient exposure of the corresponding domains. The more fully the antigenic domains are exposed, the more complete the corresponding antibody response spectrum will be, resulting in a better immune effect. The above-mentioned Seq_1 and Seq_2 are the optimal combination sequences of the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region selected in this invention to achieve broad-spectrum, long-lasting immunogenicity with minimal interference, aiming to achieve consistent performance. Based on the above description, it can be understood that there are other SARS-CoV S protein RBD regions that can be used in the first DNA molecule of this invention, such as derivative polypeptides obtained by deleting or adding one or more amino acids from the 5' and / or 3' ends of Seq_1. Similarly, the SARS-CoV-2 Beta mutant S protein RBD region that can be used in the second DNA molecule of this invention also includes derivative polypeptides obtained by deleting or adding one or more amino acids from the 5' and / or 3' ends of Seq_1.
[0075] In an optional embodiment, the nucleotide sequence of the first DNA molecule is shown in Seq_3; and the nucleotide sequence of the second DNA molecule is shown in Seq_4.
[0076] Preferably, the nucleotide sequence of the recombinant nucleic acid molecule is as shown in Seq_5, or has at least 90% identity with the nucleotide sequence shown in SEQ_5, and encodes the nucleotide sequence of the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region.
[0077] It is understood that, in this invention, “identity” refers to the similarity between nucleotide sequences, including nucleotide sequences that are at least 90% (e.g., but not limited to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) identical to the nucleotide sequence shown in SEQ_5 of this invention.
[0078] In a second aspect, the present invention provides biological materials, including:
[0079] (I) A construct comprising the recombinant nucleic acid molecule described in any of the foregoing embodiments; and a third nucleic acid molecule encoding a signal peptide attached to the 5' end of the recombinant nucleic acid molecule;
[0080] (II) A recombinant expression vector, comprising an original expression vector; and, inserting a coding nucleic acid fragment into the original expression vector, wherein the coding nucleic acid fragment is selected from the recombinant nucleic acid molecule described in any of the foregoing embodiments or the construct described in (I); preferably, the original expression vector is a eukaryotic expression vector, more preferably, the original expression vector is a pVAX1 plasmid;
[0081] (III) A transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from insect cells, yeast, avian cells or mammalian cells; preferably, the host cell is HEK293, CHO or COS-7;
[0082] (IV) A polypeptide, including a polypeptide encoded by a recombinant nucleic acid molecule as described in any of the foregoing embodiments, a polypeptide encoded by the construct described in (I), or a polypeptide obtained by expression of a transformant described in (III);
[0083] (V) An antibody that specifically binds to the polypeptide described in (IV), such as a monoclonal antibody or a polyclonal antibody.
[0084] It should be noted that the aforementioned original expression vector can be a eukaryotic expression vector, which generates the protein encoded by the DNA molecule through cellular transcription and translation mechanisms. Optionally, the original expression vector may have expression signals, such as a strong promoter, a strong stop codon, regulation of the distance between the promoter and the cloning gene, and insertion of a transcription termination sequence. Preferably, the eukaryotic expression vector includes pVAX1, but is not limited to any other expression vector capable of expressing DNA and enabling cells to translate the sequence into an antigen recognized by the immune system.
[0085] The host cells described above are merely typical preferred cells provided by this invention. Those skilled in the art may select other suitable host cells, not limited to eukaryotic or prokaryotic cells, based on actual experimental conditions or actual needs.
[0086] It is understood that the biomaterials provided by this invention can all be directly applied as biomodules in production for different needs and scenarios.
[0087] In an optional embodiment, the signal peptide encoded by the third nucleic acid molecule includes the following (c) or (d):
[0088] (c) Signal peptide with amino acid sequence as shown in Seq_6;
[0089] (d) A signal peptide derived from (c) that has one or more amino acids substituted, deleted or added to the amino acid sequence of the signal peptide defined in (c) and has the function of a signal peptide.
[0090] The aforementioned signal peptides are signal peptides that match the efficient expression of SARS-CoV and SARS-CoV-2 viral genes, and can significantly improve the expression efficiency of this recombinant nucleic acid molecule in the host.
[0091] Thirdly, the present invention provides the use of the recombinant nucleic acid molecule or the biological material described in any of the foregoing embodiments in the following (A) or (B):
[0092] (A) To prepare vaccines for the prevention and / or treatment of SARS-CoV and / or SARS-CoV-2 virus infection;
[0093] (B) To prepare medicines for the prevention and / or treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 viruses, including lung damage, brain damage, liver and kidney damage or heart damage.
[0094] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.
[0095] Fourthly, the present invention provides a DNA vaccine, which includes the recombinant nucleic acid molecule described in any of the foregoing embodiments or the recombinant expression vector described in any of the foregoing embodiments.
[0096] This DNA vaccine not only effectively transcribes and expresses within mammalian cells, but also exhibits good immunogenicity. Regarding humoral immune responses, the DNA vaccine significantly stimulated the production of antigen-specific antibodies in experimental animals on day 14 after primary immunization and day 7 after booster immunization. These antibodies not only produced antibodies against the wild-type SARS-CoV-2 antigen, but also against the Delta mutant, Beta mutant, Omicron mutant, and SARS-CoV antigens, and possessed neutralizing activity. Regarding cellular immune responses, the DNA vaccine induced high levels of antigen-specific IFN-γ responses.
[0097] In some embodiments, the DNA vaccine further includes at least one of a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient to enhance the ability of its active ingredient, the DNA molecule, to generate an immune response in a subject. The adjuvant includes at least one of aluminum adjuvants, TLR ligands, metal ions, cytokines, or chemokine adjuvants; preferably, the metal ion includes Mn. 2+ and / or Zn2+ .
[0098] In other embodiments, the DNA vaccine further includes at least one drug that has therapeutic effects against SARS-CoV and / or SARS-CoV-2 viruses to enhance the therapeutic effect of the vaccine against diseases caused by SARS-CoV and / or SARS-CoV-2 viruses.
[0099] In some embodiments, the DNA vaccine also includes at least one of the pharmaceutically acceptable adjuvants, carriers, diluents or excipients and at least one drug that has therapeutic effects on SARS-CoV and / or SARS-CoV-2 virus.
[0100] In an optional embodiment, the recombinant nucleic acid molecule or the recombinant expression vector described in any of the foregoing embodiments is introduced into a host cell and cultured, and the recombinant nucleic acid molecule or recombinant expression vector is extracted from the host cell to prepare a DNA vaccine.
[0101] Fifthly, the present invention provides a method for preventing and / or treating mammalian infection with SARS-CoV and / or SARS-CoV-2 virus, the method comprising inoculating the mammal with the aforementioned DNA vaccine.
[0102] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.
[0103] In an alternative implementation, the mammal is a human.
[0104] The mechanism of action of the DNA vaccine provided by this invention is as follows: An optimized nucleotide sequence encoding the RBD region of the SARS-CoV S protein is tandemly linked with an optimized nucleotide sequence encoding the RBD region of the SARS-CoV-2 Beta mutant S protein. A highly efficient expression signal peptide is added, and the sequence is inserted into a eukaryotic expression vector. This vector is then introduced into host cells, enabling efficient expression of viral antigens within the host cells. Through antigen presentation, the system activates both antiviral humoral and cellular immune responses. The antibodies produced by the activated humoral immune response can prevent viral invasion, and the activated cellular immune response can further clear virus-infected cells and regulate adverse reactions caused by potential ADE (antibody-dependent enhancement) side effects.
[0105] Based on the above-described mechanism of action, the present invention also provides applications of the aforementioned DNA vaccine, including:
[0106] (i) Regulate the body's immune function;
[0107] (ii) Anti-SARS-CoV-2 virus infection;
[0108] (iii) Anti-SARS-CoV infection;
[0109] (iv) Prevent immunopathological damage.
[0110] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0111] Example 1: Nucleic acid optimization screening encoding the RBD region of the S protein
[0112] In order to increase the expression of target proteins in host cells, the nucleic acid sequence of the target gene needs to be optimized. The general principle of nucleic acid sequence optimization is as follows: (1) Optimize degenerate codons according to the host cell’s preference for nucleic acid codons so that the optimized sequence contains more nucleic acid codons that are easy for the host cell to recognize; (2) Further optimize the GC content in the nucleic acid sequence based on the codon preference optimization so that the GC content optimized sequence can express more target proteins; (3) Optimize the nucleic acid sequence so that it can transcribe more stable mRNA, which is beneficial to the translation of target proteins; (4) Change the frequency of codons that are preferred by the host and increase the CAI index (codon fitness index). This invention optimizes the nucleotide sequences encoding the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Beta mutant S protein by adjusting the GC content in the nucleotide sequences; simultaneously, it alters the frequency of host-preferred codons, increases the CAI (codon fitness index), reduces the free energy for RNA secondary structure formation, decreases the proportion of negative CIS elements, and reduces the proportion of repetitive sequences in the sequence; furthermore, it optimizes the signal peptide and combines it with the inventor's proprietary algorithm developed over many years of experience in this field, thereby further improving its expression level, obtaining optimized nucleotide sequences, and then using them to formulate nucleic acid vaccines.
[0113] Optimization process: The nucleotide sequence of the wild-type SARS-CoV S protein RBD region before optimization (AY278488, GenBank) was selected and optimized according to the optimization strategy of the present invention to obtain the nucleotide sequence shown in Seq_3. The nucleotide sequence of the wild-type SARS-CoV-2 Beta mutant S protein RBD region before optimization (EPI_ISL_860630, GISAID) was selected and optimized according to the optimization strategy of the present invention to obtain the nucleotide sequence shown in Seq_4. Seq_3 and Seq_4 were directly concatenated, and the nucleotide sequence encoding the signal peptide as shown in Seq_7 was added to the N-terminus of the front end of Seq_3, and the TGATAA stop codon was added to the C-terminus of the end of Seq_4 to finally obtain the nucleotide sequence shown in Seq_5. The nucleotide sequence shown in Seq_9 was finally obtained by using the optimization strategy of the conventional commercial database (Integrated DNA Technologies, IDT). The nucleotide sequences of the wild-type sequence before optimization, the optimized Seq_5, and the Seq_9 obtained through conventional commercial optimization were scored. Regarding the increase in expression through DNA sequence optimization, the optimization effect was positively correlated with key DNA optimization indicators such as codon optimization index, GC content, and the number of negative regulatory elements. Figures 1-3 As shown, the optimization strategy adopted in this invention has a significant improvement in key indicators compared with conventional commercial optimization strategies, which indicates that the optimization strategy adopted in this invention can increase the expression efficiency of optimized genes.
[0114] The three nucleotide sequences of the unoptimized wild-type sequence, the optimized Seq_5 sequence of this invention, and the Seq_9 sequence obtained from a conventional commercial database were transformed and constructed into the pVAX1 vector (ThermoFisher, catalog number: V26020), respectively, to obtain three plasmid DNAs: pSARS-Beta Dimer-wild-type, pSARS-Beta Dimer, and pSARS-Beta Dimer-conventionally optimized. After transfecting the three plasmids into HEK293T cells for 48 hours, RNA was extracted, and the transcription level of the plasmid DNA obtained by different optimization methods was identified using qPCR. The results are as follows: Figure 4As shown, the optimized DNA sequence of this invention can increase RNA transcription by more than 100 times compared to the wild-type sequence before optimization, and more than 2 times compared to molecules conventionally optimized from commercial databases. This further demonstrates that the nucleic acid molecules optimized by this invention are superior to those obtained from conventional commercial databases. Increased transcription levels in DNA vaccines can lead to increased protein expression, thereby improving the immunogenicity of DNA vaccines. The sequence designed and obtained by this invention achieves a very significant increase in transcription levels, and its protein expression is also significantly improved, resulting in a significantly better immunogenicity.
[0115] When designing and optimizing nucleotide sequences, the first consideration was to use coronaviruses of the β genus for tandem design of nucleic acid sequences. β genus coronaviruses include Severe Respiratory Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and SARS-CoV-2. Since MERS-CoV binds to CD26 (DPP4) when infecting the host, while SARS-CoV and SARS-CoV-2 bind to ACE2, and based on virological and immunological predictions, significant differences in receptor structure were expected to result in weaker immune responses against SARS-CoV-2, a tandem design of the RBD regions of the S proteins of SARS-CoV and SARS-CoV-2 was adopted. Furthermore, it was considered that different protein domain tandem strategies would affect the exposure level of antigen domains; the more sufficient the exposure of antigen domains, the more complete the corresponding antibody response spectrum would be, and the better the immune effect would be. Therefore, we analyzed the tandem sequence of the SARS-CoV S protein RBD region (SARS RBD) and the SARS-CoV-2 Beta mutant S protein RBD region (Beta RBD) using bioinformatics methods such as artificial intelligence combined with protein structure analysis; for example... Figure 5 As shown, the analysis results indicate that the tandem sequence of SARS-Beta RBD (Figure A) is more effective than that of Beta-SARS RBD (Figure B) in that the two antigenic domains of SARS RBD and Beta RBD are further apart and the corresponding domains are fully exposed. Therefore, this also shows that the tandem sequence strategy of SARS-Beta RBD in this invention has a better immune effect.
[0116] Example 2: The construction process of a DNA vaccine
[0117] 1. Preparation method of broad-spectrum candidate DNA vaccines for coronaviruses
[0118] 1.1 Construction of recombinant expression plasmids
[0119] The nucleotide sequence encoding the RBD region of the SARS-CoV S protein (from AY278488, GenBank) is shown in Seq_3, and the nucleotide sequence encoding the RBD region of the S protein of the SARS-CoV-2 Beta mutant strain (from EPI_ISL_860630, GISAID) is shown in Seq_4. Seq_3 and Seq_4 are directly concatenated, and a nucleotide sequence encoding the signal peptide (as shown in Seq_7) is added to the N-terminus of Seq_3, and a TGATAA stop codon is added to the C-terminus of Seq_4, resulting in the nucleotide sequence shown in Seq_5. Seq_5 is then inserted between the BamHI and XhoI sites in the pVAX1 vector to obtain the recombinant expression plasmid pSARS-Beta Dimer.
[0120] Based on the wild-type SARS-CoV-2 sequence (MN908947.3, NCBI), the nucleotide sequence shown in Seq_8 was optimized and inserted between the BamHI and XhoI sites of the pVAX1 vector to obtain the wild-type SARS-CoV-2 plasmid (pWT). The pWT wild-type vaccine is a product developed by our company targeting the wild-type strain and is about to enter Phase III clinical trials, demonstrating excellent immunogenicity.
[0121] 1.2 DNA vaccine sequence transformation
[0122] Take 100 μl of DH10B competent cell suspension from a -80°C freezer and thaw on ice. Add recombinant expression plasmid DNA solution (volume not exceeding 10 μl), gently mix, and incubate on ice for 30 min. Heat shock in a 42°C water bath for 70 seconds, then quickly cool on ice for 5 min. Add 0.9 ml of LB liquid medium (antibiotic-free) to the tube, mix well, and incubate at 37°C with shaking for 45 min to allow the bacteria to return to normal growth. After mixing the above bacterial suspension, take 100 μl and spread it on a selection plate containing appropriate antibiotics, placing it face up. After the bacterial suspension is completely absorbed by the medium, invert the plate and incubate at 37°C for 12-16 h. Select uniformly shaped single clones, use a sterile pipette tip to detach the clones, and place them in 5 ml of LB selection medium containing 50 mg / mL kanamycin. Incubate overnight at 37°C.
[0123] 1.3 DNA vaccine plasmid extraction
[0124] Add the above bacterial culture to 200–400 ml of LB selective medium containing kanamycin (50 mg / mL stock solution, 1:1000 dilution) at a ratio of 1:1000, and incubate at 37°C and 200 rpm for 12–16 h. Perform plasmid extraction using the EndoFreen Plasmid Maxi kit (QIAGEN, Germany): Centrifuge the bacterial culture (12–16 h) at 8000 rpm for 10 min at 4°C, discard the supernatant, collect the bacterial cells, resuspend the culture in 10 ml of P1 Buffer, then add 10 ml of P2 Buffer and gently invert 4–6 times to mix thoroughly. Incubate at room temperature for 5 min to achieve complete lysis. Add 10 ml of P3 Buffer to the mixture, gently invert 4–6 times to stop lysis, then transfer the entire mixture to a QIA filter cartridge and incubate at room temperature for 10 min. Add the supernatant to the filter cartridge. Transfer the filtrate to a clean, endotoxin-free 50ml centrifuge tube, add 2.5ml ER Buffer, gently invert 10 times to mix, and incubate on ice for 30min. Remove a QIAGEN-tip 500 and add 10ml QBT Buffer to equilibrate the column. Transfer the above liquid to the column and adsorb the plasmid using gravity flow. Wash twice with 30ml QC Buffer, then elute with 15ml QN Buffer. Precipitate each sample with 10.5ml isopropanol and centrifuge at 4000g for 30min at 4℃. Discard the supernatant, wash once with 70% ethanol, and centrifuge at 4000g for 10min at 4℃. Discard the supernatant, air-dry the precipitate, and resuspend the plasmid in 500μl of endotoxin-free water for each sample to obtain the recombinant expression plasmid for DNA vaccine preparation.
[0125] Example 3: Mammalian cell transcription identification of a broad-spectrum candidate DNA vaccine for coronavirus
[0126] To verify whether the recombinant expression plasmid constructed in Example 2 can be effectively transcribed in mammalian cells, it was identified by in vitro DNA transfection, RNA extraction, and qPCR.
[0127] 1. In vitro transfection of DNA vaccines
[0128] The frozen HEK293T cell line was removed from liquid nitrogen, incubated at 37°C, and centrifuged at 1000 rpm for 5 minutes to remove DMSO. The cells were washed once with serum-free DMEM medium and cultured in 5 ml of DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2 for 2-3 passages. Cells were then digested with trypsin (containing 0.25% EDTA) at 37°C for 1 minute, and the digestion was terminated with complete culture medium. Cells were then sputtered at 2-4 × 10⁻⁴ cm⁻¹. 6Cells / wells were spread evenly in 60mm culture dishes, and 5ml of growth medium (without 1% antibiotics) was added. The dishes were then incubated at 37℃ in a 5% CO2 incubator for 24h.
[0129] Two sterile recombinant expression plasmids, 4 μg pSARS-Beta Dimer and 4 μg pWT, were added to 500 μl of serum-reduced OPTI-MEM medium and gently mixed. At the same time, 24 μl of cationic liposomes (Shanghai Yisheng, 40802ES03) were added to 500 μl of serum-reduced OPTI-MEM medium and gently mixed. The mixture was incubated at room temperature for 5 min. The two plasmids were then mixed with the liposomes at a 1:1 ratio and incubated at room temperature for 20 min to obtain the recombinant expression plasmid DNA / liposome complex.
[0130] The recombinant expression plasmid DNA / liposome complex was added at a rate of 1 ml / plate to a 60 mm culture dish that had been cultured for 24 h. The dishes were then incubated at 37 °C in a 5% CO2 incubator for 48 h for subsequent experiments.
[0131] 2. RNA extraction after transfection
[0132] Cells transfected for 48 hours were digested and collected. After resuspending in 1 ml of complete culture medium, 100 μl of the resuspended solution was used for RNA extraction. The remaining resuspended solution was used for subsequent Western blot sample preparation.
[0133] Centrifuge 100 μl of cell suspension at 4000 rpm for 5 minutes, discard the supernatant, and add 350 μl of TRK Lysis Solution (containing 20% β-mercaptoethanol) to each sample for lysis. Then add 350 μl of 70% ethanol (prepared with DEPC water) to each sample to terminate lysis, and mix thoroughly by pipetting.
[0134] Transfer the above mixture to a HiBind RNA column, centrifuge at 10000g for 1 min, and discard the filtrate. Add 500 μl of Wash Buffer I to each sample column, centrifuge at 10000g for 1 min, and discard the filtrate. Add 500 μl of Wash Buffer II to each sample column and wash twice, centrifuging at 10000g for 1 min each time, and discard the filtrate. Adjust the centrifuge speed to the highest speed (17000g) and centrifuge for 2 min to allow the ethanol in the column to evaporate. Transfer the column to a clean 1.5 ml centrifuge tube free of DNA and RNase, incubate at room temperature for 3-5 min to completely evaporate the ethanol, then add 50 μl of RNase-free water to each sample, incubate at room temperature for 5 min, and centrifuge at 17000g for 1 min. Aspirate the filtrate and add it back to the column, incubate at room temperature for 5 min, centrifuge at 17000g for 1 min to collect RNA, and store at -80℃.
[0135] 3. RNA reverse transcription and qPCR reaction
[0136] RNA concentration was quantified using a microplate reader (OD260 / 280 readings were used). The required PCR number was n (n = number of samples + 1 negative control + 1 positive control). For each sample, a 10 μl reaction mixture was prepared (2 μl 5×g DNA digester buffer, 1 μl g DNA digester, 100 ng RNA, adjusted to 10 μl with RNase-free ddH2O). The mixture was gently pipetted and incubated at 42°C for 2 min. Then, 10 μl 2×Hifair II SuperMix plus was added to each sample, gently pipetted and mixed, and incubated at 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. The collected cDNA was stored at -20°C for later use.
[0137] The cDNA product obtained from reverse transcription was reacted using a qPCR kit. The reaction system is as follows: 10 μl of qPCRSYBR Green Master Mix (No Rox), 0.4 μl each of the target forward and reverse primers (forward primer: 5'AAGCTGAACGACCTGTGCTTCA3'Seq_10, reverse primer: 5'GGCAGCTTGTAGTTGTAG3'Seq_11), 1 μl of cDNA template, and sterile ultrapure water to a total volume of 20 μl. PCR reaction conditions: 95℃ for 5 min, 95℃ for 10 s, 56℃ for 30 s, and 72℃ for 30 s for a total of 40 cycles. The expression level of the target gene was compared with the internal control using a 2:1 ratio. -△△C Method calculation.
[0138] Conclusion: Figure 6 As shown, both the wild-type COVID-19 candidate DNA vaccine pWT and the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer induced high levels of antigen RNA transcription compared to the empty vector (pVAX1) 48 hours after in vitro transfection, and the RNA transcription level in the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer group was significantly higher than that in the pWT group.
[0139] Example 4: Identification of mammalian cell antigen protein expression in a broad-spectrum candidate DNA vaccine for coronavirus
[0140] To further verify whether the recombinant expression plasmid constructed in Example 2 can be effectively expressed in mammalian cells, the antigen protein was extracted and identified by Western blotting.
[0141] 1. Protein extraction
[0142] Plasmids pSARS-Beta Dimer and pWT were transfected into HEK293T cell lines. After 48 hours of transfection, the transfected culture medium was removed, and the cells were washed once with pre-cooled PBS. The PBS was discarded, and 150 μl of lysis buffer (with EDTA and protease inhibitor added at a 1:100 ratio before use) was added. The mixture was then pipetted 10 times. The cells were centrifuged at 12,000 rpm for 5 minutes at 4 degrees Celsius. The supernatant was transferred to 1.5 mL centrifuge tubes. 50 μl of the supernatant from each sample was added, and 12.5 μl of 5× protein loading buffer was added. The tubes were boiled in boiling water for 10 minutes and then briefly centrifuged for later use.
[0143] 2. Sample loading and SDS-PAGE electrophoresis
[0144] Add 62.5 μl of the supernatant sample after boiling and centrifugation to each well of the SDS-PAGE gel. Turn on the power, adjust to a constant voltage of 200V, and set the time to 45 min for electrophoresis. After electrophoresis, remove the SDS-PAGE gel for membrane transfer. Activate the PVDF membrane by soaking it in methanol for 30 s, and then place the PVDF membrane in 1× transfer equilibration buffer for 1 min.
[0145] 3. Transfer membrane
[0146] With the positive electrode at the bottom, the following order was used for layering: eBlot L1 transfer pad, PVDF membrane, gel, eBlot L1 transfer pad. Air bubbles were removed between layers using a tube after each layer. Blocking: The PVDF membrane was removed and placed in a glass container containing 1×TBST + 5% skim milk powder. It was incubated at room temperature for 1 hour at 90 rpm on a shaker. Washing: The PVDF membrane was washed three times with 1×TBST for 10 minutes each time, with shaking at 90 rpm. Primary antibody incubation: The PVDF membrane was placed in the primary antibody solution (S-ECD / RBD Monoclonal antibody (1), 1:2000 diluted with 1 μg / ml XG014 antibody) and incubated at room temperature for 1 hour at 90 rpm on a shaker. Washing: The PVDF membrane was washed five times with 1×TBST for 10 minutes each time, with shaking at 90 rpm on a shaker. Secondary antibody incubation: Place the PVDF membrane in the secondary antibody solution (HRP conjugated Anti-human IgG, 1:5000 dilution) and incubate at room temperature for 1 hour at 90 rpm on a shaker. Washing: Wash the PVDF membrane 5 times in 1×TBST solution for 10 minutes each time, shaking at 90 rpm on a shaker. Color development: Mix 3 ml of chemiluminescence solution A and 3 ml of solution B in a 1:1 ratio and add the mixture to the PVDF membrane. Incubate for 1–2 minutes and take a photograph.
[0147] Conclusion: Figure 7As shown in the figure, the wild-type SARS-CoV-2 candidate DNA vaccine pWT and the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer were able to express antigen proteins intracellularly compared with the empty vector (pVAX1) 48 hours after in vitro transfection. It can be seen from the figure that the signal detected by the pSARS-Beta Dimer group was weaker in this experiment. Based on previous experimental experience, we believe that the antigen protein expressed by the wild-type pWT strain 48 hours after transfection is located intracellularly and is therefore easier to detect, while the antigen expressed by the pSARS-Beta Dimer 48 hours after transfection is weaker because most of it has been secreted extracellularly. Therefore, the cell supernatant after transfection was collected and the experiment of Example 4 was carried out for verification.
[0148] Example 5: Validation of in vitro antigen protein expression for a broad-spectrum candidate DNA vaccine against coronavirus
[0149] Plasmids pSARS-Beta Dimer and pWT were transfected into HEK293T cell line. After 48 hours of transfection, the supernatant was collected, and the secreted antigen protein in the supernatant was detected by ELISA.
[0150] MonoRab TMSARS-CoV-2 Neutralizing Antibody (BS-R2B2), mAb, and Rabbit were diluted to 0.5 μg / ml with coating buffer and added to ELISA plates at 100 μl / well. After covering with sealing film, the plates were incubated overnight at 2–8 °C. The plates were washed three times with 1×PBST. Using 5% BSA (dissolved in PBST) as blocking buffer, 100 μl was added to each well. After adding samples, the plates were covered with sealing film and incubated at 37 °C for 1 h. The plates were washed three times with 1×PBST. The standard curve antigen RBD (N501Y) protein was diluted to 100 ng / ml with 3% BSA and then serially diluted 3-fold, resulting in 7 dilution gradients, plus one "0" well. Four gradients were prepared for the sample antigen (culture medium supernatant): stock solution, 10-fold dilution, 100-fold dilution, and 1000-fold dilution. All antigens were added to the plates at 100 μl / well, covered with sealing film, and incubated at 37 °C for 1 h. Wash 5 times with 1×PBST. Dilute S-ECD / RBD Monoclonal Antibody (2) with 3% BSA at a ratio of 1:80000, add 100 μL / well to the plate, cover with sealing film, and incubate at 37°C for 1 h. Wash 5 times with 1×PBST, add 250 μL / well, and pat dry any remaining liquid in the wells. Dilute HRP Anti-Human IgG with 3% BSA at a ratio of 1:5000, add 100 μL / well to the plate, cover with sealing film, and incubate at 37°C for 1 h. Wash 5 times with 1×PBST. Mix the two TMB components at a 1:1 ratio, add 100 μL / well, and incubate at room temperature in the dark for 10 min. Terminate with 2M H2SO4, adding 50 μL / well. Place the ELISA in a microplate reader as specified and detect the absorbance values at OD450 and OD620.
[0151] Conclusion: The results are as follows Figure 8 As shown, both the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer and the wild-type SARS-CoV-2 candidate DNA vaccine pWT can express antigen proteins, with the pSARS-Beta Dimer group showing significantly higher expression than the pWT group. This further verifies our conclusion in Example 3 that most of the antigen proteins expressed in the pSARS-Beta Dimer group were secreted extracellularly 48 hours after transfection, and their high-level expression could be detected by the ELISA method in Example 4. The above experiments further demonstrate that both the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer group and the wild-type SARS-CoV-2 candidate DNA vaccine pWT can express antigen proteins at high levels.
[0152] Example 6: Immunogenicity Validation of Broad-Spectrum Coronavirus Candidate DNA Vaccine
[0153] To evaluate the immunogenicity of the vaccine prepared in Example 2 and the impact of the immunization strategy on humoral and cellular immune responses, specific pathogen-free 6-week-old female C57BL / 6 mice were purchased from Shanghai Slack Pharmaceutical Co., Ltd. and stored in the Advaccine Laboratory (Suzhou) animal facility. DNA vaccine immunization: The DNA vaccine described in Example 1 was injected sequentially into the anterior femoral muscle according to different grouping doses, followed by an electrical pulse (EP). The EP device consisted of two sets of pulses with a constant current of 0.2 Amp. The second pulse set was delayed by 3 seconds. In each set, there were two 52 ms pulses with a delay of 198 ms between pulses. The first primary immunization was counted as day 0, and a second immunization (booster immunization) was performed on day 14. Experimental groups: (1) Control group vector plasmid pVAX1-10μg; (2) Experimental group wild-type strain DNA vaccine pWT-10μg; (3) Experimental group broad-spectrum coronavirus DNA vaccine pSARS-Beta Dimer-10μg; Blood samples were collected from mice on days 14 and 21, and the specific antibody titers in the serum were determined by ELISA. On day 10 after booster immunization, the immunized mice were sacrificed to analyze the cellular immune response.
[0154] 1. Assess the antigen-specific humoral immune response induced by DNA vaccines.
[0155] 1.1. ELISA detection of antibody concentration
[0156] Fourteen days after primary immunization and seven days after booster immunization, antibodies against SARS-CoV-2 wild-type (WT) RBD protein, SARS-CoV-2 Delta mutant RBD protein, SARS-CoV-2 Beta mutant RBD protein, SARS-CoV-2 Omicron mutant RBD protein, and SARS-CoV RBD protein were evaluated using an ELISA-based method. Nunc 96-well ELISA plates were coated overnight at 4°C with 1 μg / mL SARS-CoV-2 wild-type RBD protein, 1 μg / mL SARS-CoV-2 Delta mutant RBD protein, 1 μg / mL SARS-CoV-2 Beta mutant RBD protein, SARS-CoV-2 Omicron mutant RBD protein, and 1 μg / mL SARS-CoV RBD protein (Acro Biosystems, DE, USA). The plate was washed three times and then blocked with PBS containing 5% bovine serum albumin (BSA) (containing 0.05% Tween 20, i.e., PBST buffer) at 37°C for 1 hour. Three-fold serially diluted mouse serum was added to each well and incubated at 37°C for 1 hour. The plate was washed five more times and then incubated at 37°C for 1 hour with a 1:8000 diluted goat anti-mouse IgG-HRP (GenScript, NJ, CN) solution. Binding antibodies were then detected. After a final wash, the plate was developed using TMB substrate, and the reaction was terminated with 50 μl / well of 2M H2SO4. Readings were taken at 450 nm and 620 nm. The endpoint of the serum antibody titer was determined as the reciprocal of the highest dilution. The highest dilution of the sample was 2.1 times higher than the absorbance of the negative control (judgment criterion: experimental group: control group (negative) OD450-620 value ≥ 2.1, the highest dilution corresponding to this OD value was determined as the serum antibody titer).
[0157] Conclusion: Antibody test results 14 days after primary immunization are as follows: Figure 9As shown, both the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer and the wild-type SARS-CoV-2 candidate DNA vaccine pWT significantly induced antigen-specific antibodies in experimental animals on day 14 after primary immunization. Furthermore, in the aforementioned ELISA experiments, the SARS-CoV-2 wild-type RBD protein and the SARS-CoV-2 Delta mutant RBD protein were used as in vitro coating antigens, respectively. The results show that the wild-type SARS-CoV-2 candidate DNA vaccine pWT not only produced antibodies against the wild-type antigen but also against the Delta mutant antigen. However, the pSARS-Beta Dimer DNA vaccine provided by this invention also achieved significant technical effects and is superior to the wild-type SARS-CoV-2 candidate DNA vaccine pWT. As mentioned earlier, pWT is a preliminary product with excellent immunogenicity against the wild-type SARS-CoV-2 strain, further demonstrating that the pSARS-Beta Dimer DNA vaccine of this invention has superior immunogenicity and broad-spectrum activity.
[0158] Antibody test results 7 days after booster immunization Figure 10 As shown, both the broad-spectrum candidate DNA vaccine pSARS-BetaDimer and the wild-type candidate DNA vaccine pWT significantly induced antigen-specific antibodies in experimental animals 7 days after booster immunization. Furthermore, in the aforementioned ELISA experiments, SARS-CoV-2 wild-type (WT) RBD protein, SARS-CoV-2 Delta mutant RBD protein, SARS-CoV-2 Beta mutant RBD protein, SARS-CoV-2 Omicron mutant RBD protein, and SARS-CoV RBD protein were used as in vitro coating antigens, respectively. As can be seen from the results, the SARS-CoV-2 wild-type candidate DNA vaccine pWT can produce antibodies not only against the wild-type antigen, but also against the Delta mutant antigen, Beta mutant antigen, Omicron mutant antigen, and SARS-CoV antigen. However, the pSARS-Beta Dimer DNA vaccine provided by this invention also achieved considerable technical effectiveness. Moreover, against the SARS-CoV-2 Beta mutant antigen, SARS-CoV-2 Omicron mutant antigen, and SARS-CoV antigen, the pSARS-Beta Dimer DNA vaccine provided by this invention is superior to the SARS-CoV-2 wild-type candidate DNA vaccine pWT. As mentioned earlier, pWT is a preliminary product with excellent immunogenicity against the wild-type SARS-CoV-2 strain, further illustrating the efficacy of the pSARS-Beta Dimer of this invention. DNA vaccines have superior immunogenicity and broad-spectrum activity.
[0159] 1.2. Detection of pseudovirus neutralizing antibodies
[0160] Huh-7 cells were seeded and cultured in 96-well plates containing 10% FBS in DMEM. To detect neutralizing antibody titers, mouse serum was serially diluted 1:2 in DMEM medium. The diluted serum samples were then incubated with various variants of SARS-CoV-2 pseudoviruses at 37°C for 30 minutes before being added to Huh-7 cells for infection. After a further 4-hour incubation, the supernatant was replaced with fresh DMEM medium (containing 10% FBS). After another 48 hours of culture, the cell supernatant was removed, and the absolute luciferase levels in lysed cells were measured using a Promega luciferase assay kit and a microplate reader. Relative values were calculated by normalizing to the virus control wells in the same plate. Neutralizing antibody titers were calculated using GraphPad Prism 9 and defined as the reciprocal of the serum dilution (after subtracting the background RLU in the cell control wells, the RLU was reduced by 50% compared to the RLU in the virus control wells).
[0161] Conclusion: The results are as follows Figure 11 As shown, on day 7 after booster immunization with the broad-spectrum candidate DNA vaccine pSARS-Beta Dimer, all of them exhibited good neutralizing activity against wild-type (WT), Beta mutant, Delta mutant, and Omicron mutant viruses, demonstrating that the pSARS-Beta Dimer DNA vaccine of this invention has good immunogenicity and broad-spectrum activity.
[0162] 2. Further evaluate the antigen-specific cellular response induced by the DNA vaccine.
[0163] 2.1 IFN-γELISpot Experiment
[0164] The study investigated whether DNA vaccines could promote cellular immunity using ELISpot analysis. Spleen cells were isolated 10 days after booster immunization for IFN-γ-positive cell ELISpot assays.
[0165] On day 10 post-immunization, under sterile conditions, mice were euthanized, spleens were removed, and cells were ground into a single-cell suspension. Cells were harvested by centrifugation, resuspended in erythrocyte lysis buffer, and lysed. Lysis was terminated with PBS containing FBS. The cells were filtered, and the prepared single-cell suspension was counted. The single cells were then resuspended in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin / streptomycin. IFN-γ was measured using a mouse IFN-γ ELISpot kit (Dakow, CN). Spleen cell suspensions isolated from each mouse were seeded at a density of 250,000 into each well coated with anti-IFN-γ antibody and stimulated with a SARS-CoV-2 RBD peptide library at 37°C for 20 hours in a CO2 incubator. The final concentration of the peptide library in each well was 10 μg / mL (dissolved in RPMI + 10% FBS). The procedure was performed according to the product instructions. The culture medium and PMA / IoNo served as negative and positive controls, respectively. Positive spots were quantitatively detected using an iSpot Reader (AID, Strabeberg, Germany). Spot-forming units (SFU) per million cells were calculated by subtracting the negative control wells.
[0166] Conclusion: IFN-γELISpot results are as follows Figure 12 and Figure 13 As shown, both the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer and the wild-type SARS-CoV-2 candidate DNA vaccine pWT effectively induced high levels of antigen-specific IFN-γ responses on day 10 after booster immunization. In the aforementioned ELIspot trial, the wild-type SARS-CoV-2 RBD protein was used as the in vitro stimulating peptide. While the above conditions were favorable for the wild-type SARS-CoV-2 nucleic acid vaccine pWT, the broad-spectrum coronavirus candidate DNA vaccine pSARS-Beta Dimer provided by this invention also achieved significant technical effects and was superior to the wild-type SARS-CoV-2 candidate DNA vaccine pWT. As mentioned earlier, pWT is a pre-product with excellent immunogenicity against the wild-type SARS-CoV-2 strain, further demonstrating that the pSARS-Beta Dimer DNA vaccine of this invention has superior immunogenicity and broad-spectrum activity.
[0167] In summary, the results of Examples 1-5 demonstrate that, due to the effective codon optimization system and reasonable sequence design, the pSARS-Beta Dimer broad-spectrum candidate DNA vaccine of the present invention can not only be effectively transcribed in mammalian cells, but also effectively express and secrete the corresponding antigen proteins; and it possesses immunogenicity, manifested in humoral and cellular immune responses. For humoral immune responses, the pSARS-Beta Dimer candidate DNA vaccine significantly stimulated the production of antigen-specific antibodies in experimental animals on day 14 after primary immunization and day 7 after booster immunization. These antibodies not only produced antibodies against the wild-type SARS-CoV antigen, but also against the Delta mutant strain antigen, Beta mutant strain antigen, Omicron mutant strain antigen, and SARS-CoV antigen, and exhibited neutralizing activity, demonstrating the good immunogenicity and broad-spectrum nature of the pSARS-Beta Dimer DNA vaccine of the present invention. For cellular immune responses, the pSARS-Beta Dimer DNA vaccine induced a high level of antigen-specific IFN-γ response.
[0168] It is worth noting that the pWT wild-type vaccine is our company's earlier product targeting the wild-type SARS-CoV-2 strain, and it has now entered Phase III clinical trials, demonstrating excellent immunogenicity. In the aforementioned trials, such as ELISA, pseudovirus neutralization, and ELIspot assays, the wild-type SARS-CoV-2 RBD protein was used as the in vitro coating antigen or stimulating peptide. Furthermore, in the ELISA and pseudovirus neutralization experiments, not only was the wild-type SARS-CoV-2 RBD protein or virus used as the in vitro coating antigen, but also the SARS-CoV-2 Beta mutant RBD protein or virus, the SARS-CoV-2 Delta mutant RBD protein or virus, the SARS-CoV-2 Omicron mutant RBD protein or virus, and the SARS-CoV RBD protein were used as in vitro coating antigens to detect the generated antigen-specific antibodies. When using the wild-type SARS-CoV-2 RBD protein as an in vitro coating antigen or stimulating peptide, the conditions are favorable for the wild-type SARS-CoV-2 nucleic acid vaccine pWT. However, the pSARS-Beta Dimer DNA vaccine provided by this invention has also achieved significant technical results, even surpassing the wild-type SARS-CoV-2 nucleic acid vaccine pWT. Figures 8-9 , Figures 12-13When using SARS-CoV-2 Beta mutant RBD protein or virus, SARS-CoV-2 Delta mutant RBD protein or virus, SARS-CoV-2 Omicron mutant RBD protein or virus, and SARS-CoV RBD protein as in vitro coating antigens to detect the generated antigen-specific antibodies, the pSARS-Beta Dimer DNA vaccine of the present invention achieved better results than pWT. This further demonstrates that the pSARS-Beta Dimer DNA vaccine of the present invention has superior immunogenicity and broad-spectrum activity.
[0169] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A recombinant nucleic acid molecule, characterized in that, The recombinant nucleic acid molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Beta mutant strain. The nucleotide sequence of the first DNA molecule is shown in SEQ ID NO.3; the nucleotide sequence of the second DNA molecule is shown in SEQ ID NO.4; The nucleotide sequence of the recombinant nucleic acid molecule is as shown in SEQ ID NO.5, and it encodes the nucleotide sequence of the SARS-CoV S protein RBD region and the SARS-CoV-2 Beta mutant S protein RBD region.
2. A biomaterial, characterized in that, Including any of the following biomaterials: (I) A construct comprising the recombinant nucleic acid molecule of claim 1; (II) A recombinant expression vector, comprising an original expression vector; and, inserting a coding nucleic acid fragment into the original expression vector, said coding nucleic acid fragment being selected from the recombinant nucleic acid molecule of claim 1 or the construct of (I); (III) A transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from insect cells, yeast, avian cells or mammalian cells; (IV) A polypeptide, including a polypeptide encoded by the recombinant nucleic acid molecule of claim 1, a polypeptide encoded by the construct of claim (I), or a polypeptide obtained by expression of the transformant of claim (III); (V) An antibody that specifically binds to the polypeptide described in (IV).
3. The biomaterial according to claim 2, characterized in that, The original expression vector is a eukaryotic expression vector.
4. The biomaterial according to claim 3, characterized in that, The original expression vector was the pVAX1 plasmid.
5. The biomaterial according to claim 2, characterized in that, The host cells are HEK293, CHO, or COS-7.
6. The use of the recombinant nucleic acid molecule of claim 1 or the biological material of any one of claims 2 to 5 in the following (A) or (B): (A) To prepare vaccines to prevent infection with SARS-CoV and / or SARS-CoV-2 viruses; (B) To prepare drugs for the prevention of diseases caused by SARS-CoV and / or SARS-CoV-2 viruses.
7. A DNA vaccine, characterized in that, The DNA vaccine comprises the recombinant nucleic acid molecule of claim 1 or the recombinant expression vector of any one of claims 2 to 5.
8. The DNA vaccine according to claim 7, characterized in that, The DNA vaccine also includes at least one of pharmaceutically acceptable adjuvants, carriers, diluents or excipients; And / or, at least one drug that has therapeutic effects against SARS-CoV and / or SARS-CoV-2 virus.
9. The DNA vaccine according to claim 8, characterized in that, The adjuvant includes at least one of aluminum adjuvant, TLR ligand, metal ion, cytokine or chemokine adjuvant.
10. The DNA vaccine according to claim 9, characterized in that, The metal ions include Mn 2+ and / or Zn 2+ .
11. A method for preparing the DNA vaccine according to any one of claims 7 to 10, characterized in that, The method involves introducing the recombinant nucleic acid molecule of claim 1 or the recombinant expression vector of any one of claims 2 to 5 into a host cell and culturing it, then extracting the recombinant nucleic acid molecule or recombinant expression vector from the host cell to prepare a DNA vaccine.