A detection method for insertion / deletion polymorphism of sheep MAST4 gene and its application

Abstract

The invention discloses a detection method for insertion / deletion polymorphism of sheep MAST4 gene and its application. Using the whole genome DNA of Australian white sheep and Guiqian semi-fine wool sheep as templates, partial fragments of MAST4 gene are amplified by PCR, and then agarose gel electrophoresis is performed, and the genotype of 29-bp insertion / deletion polymorphic site on MAST4 gene is identified according to the electrophoresis result. The results of association analysis show that different genotypes of 29-bp insertion / deletion polymorphic site of MAST4 gene are significantly correlated with the difference of lamb number trait of Australian white sheep and Guiqian semi-fine wool sheep, and there is a DNA marker as auxiliary selection of sheep reproductive trait marker, which can be used to quickly establish a population of excellent sheep genetic resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and livestock breeding, and relates to typing detection of a 29-bp insertion / deletion polymorphic site at position NC_056069.1:g.12883964-12883992 of a sheep MAST4 gene and early selection of sheep reproductive traits using corresponding molecular markers. Background Art

[0002] As people's living standards continue to improve, consumers' requirements for the output and quality of livestock and poultry products have also changed accordingly. Improving livestock and poultry production and breeding performance traits will become the focus of animal breeding. However, traditional breeding techniques are time-consuming and costly, so animal breeding still faces the challenge of improving new varieties. With the application of marker-assisted selection (MAS) in animal breeding, the genetic composition of individuals can be quickly and accurately analyzed at the molecular level, thereby achieving direct selection of genotypes. Individuals with trait advantages can be identified through molecular markers at an early stage, significantly improving breeding efficiency. Insertion / deletion polymorphism (InDel) is a change at the DNA level that occurs second only to residue substitutions, and is manifested as the insertion or deletion of DNA fragments of different sizes in the genome. InDels are all derived from single mutation events. Compared with SNP detection, they are simple and convenient, and have higher application value.

[0003] The sheep (Ovis aries) MAST4 gene is located on chromosome 16, has 34 exons, and is expressed in multiple tissues and organs. A large number of previous related studies have shown that MAST4 may be related to mammalian reproductive traits. For example, MAST4 promotes primary ciliary reabsorption by phosphorylating Tctex-1 (inhibiting MAST4 gene expression can block serum-induced ciliary reabsorption, and overexpressing MAST4 gene can accelerate ciliary reabsorption).

[0004] Focusing on the goal of high-yield, high-quality and efficient sheep breeding, the use of MAS to accelerate the establishment of a sheep population with excellent lambing number traits by detecting molecular markers closely related to the lambing number trait screened at the DNA level has always been a hot topic. However, most molecular markers related to the lambing number of sheep are related to the lambing number of the first parity (first birth), and compared with primiparous ewes giving birth to their first birth, multiparous ewes giving birth to second and subsequent parities rarely have the problem of lamb mortality due to lack of production experience. Summary of the invention

[0005] The purpose of the present invention is to provide a method for detecting insertion / deletion polymorphism of sheep MAST4 gene and its application, which can quickly establish a sheep genetic resource group with excellent traits.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for detecting insertion / deletion polymorphism of sheep MAST4 gene comprises the following steps:

[0008] The whole genome DNA of the sheep individual to be tested is used as a template, and the primer pair P3 is used as an amplification primer. PCR is used to amplify a fragment containing the insertion / deletion polymorphic site in the intron region of the MAST4 gene. The PCR amplification product is subjected to electrophoresis, and the genotype of the sheep individual to be tested at the insertion / deletion polymorphic site is identified according to the electrophoresis result; the insertion / deletion polymorphic site is selected from the 29-bp insertion / deletion polymorphic site at position NC_056069.1:g.12883964-12883992 of the sheep MAST4 gene (the deleted sequence is CTAAATGCATCAATGTCCAGGCTCTTCCA).

[0009] Preferably, the amplification primers used in the PCR (i.e., primer pair P3) are:

[0010] Upstream primer: 5′-AGGACAAGAGTCAGGGGCAT-3′ (20 nt);

[0011] Downstream primer: 5'-GGGTGCAGTGAATAACACGG-3' (20 nt).

[0012] Preferably, the reaction program used in the PCR is: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 68°C for 30 s, extension at 72°C for 12 s, 18 cycles, with the annealing temperature decreasing by 1°C after each cycle; annealing at 50°C for 30 s, extension at 72°C for 12 s, 32 cycles; extension at 72°C for 10 min.

[0013] Preferably, the electrophoresis uses agarose gel with a mass concentration of 3.5%.

[0014] Preferably, according to the electrophoresis results, the insertion / insertion genotype (II) of the insertion / deletion polymorphic site is expressed as a band of 401 bp, the insertion / deletion genotype (ID) is expressed as a band comprising 401 bp and 372 bp, and the deletion / deletion genotype (DD) is expressed as a band of 372 bp.

[0015] The application of the above-mentioned sheep MAST4 gene insertion / deletion polymorphism detection method in sheep molecular marker-assisted selection breeding.

[0016] Application of the 29-bp insertion / deletion polymorphic site NC_056069.1:g.12883964-12883992 of the sheep MAST4 gene (deletion sequence: CTAAATGCATCAATGTCCAGGCTCTTCCA) in sheep molecular marker-assisted selection breeding.

[0017] Preferably, the sheep are Australian white sheep; for this breed of sheep, the deletion / deletion genotype (DD) of the insertion / deletion polymorphic site can be used as a DNA marker for improving the sheep lambing number trait, wherein the lambing number is specifically the lambing number of the second parity.

[0018] Preferably, the sheep are Guiqian semi-fine wool sheep; for this breed of sheep, the insertion / deletion genotype (ID) of the insertion / deletion polymorphic site can be used as a DNA marker for improving the sheep lambing number trait, wherein the lambing number is specifically the first-born lambs number.

[0019] A kit for detecting insertion / deletion polymorphism of sheep MAST4 gene, comprising a primer pair (for example, the primer pair P3) for PCR amplification of the insertion / deletion polymorphism site of the intron region of the MAST4 gene.

[0020] The beneficial effects of the present invention are embodied in:

[0021] The invention designs primers according to the insertion / deletion polymorphic site of sheep MAST4 gene (reference sequence NC_056069.1:g.12883964-12883992), takes sheep genomic DNA as a template, and detects the genotype of the insertion / deletion polymorphic site simply, quickly, at low cost and accurately through sequence amplification and electrophoresis identification.

[0022] The present invention performs genotype detection and analysis on the insertion / deletion polymorphic site (reference sequence NC_056069.1: g.12883964-12883992) of the MAST4 gene of sheep (for example, Australian white sheep, Guiqian semi-fine wool sheep), and performs association analysis on the insertion / deletion polymorphic site and the production traits of sheep (for example, Australian white sheep, Guiqian semi-fine wool sheep). The results show that the insertion / deletion polymorphic site detected by the present invention exists and can be used as a molecular marker for increasing the number of lambs born in sheep, and can be used to quickly establish a sheep population with excellent lamb number traits, thereby facilitating the improvement of the breeding speed of fine breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the agarose gel electrophoresis diagram of the amplified product of the MAST4 gene of sheep individuals (primer pair P3); M represents marker.

[0024] Figure 2This is the sequencing diagram of the PCR amplification product of the MAST4 gene of a sheep individual, in which the part marked by the dotted box represents the 29-bp deletion sequence NC_056069.1:g.12883964-12883992delCTAAATGCATCAATGTCCAGGCTCTTCCA. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the scope of protection of the present invention.

[0026] The present invention uses PCR method to detect the insertion / deletion polymorphism that may be caused by mutation in the intron of the sheep MAST4 gene (reference sequence: NC_056069.1), and conducts association analysis with the sheep lambing trait to identify the existence of molecular markers that can be used as auxiliary selection in sheep molecular breeding.

[0027] 1. Experimental drugs and reagents

[0028] 1.1 Biochemical and biological reagents: ① Taq DNA polymerase (purchased from Fermantas, i.e., MBI); ② Proteinase K (purchased from Huamei Bioengineering Company); ③ Marker I (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0029] 1.2 Common reagents: citric acid, sodium citrate, glucose, Tris, EDTA, NaCl, NaOH, KCl, Na2HPO4, KH2PO4, Tris-saturated phenol, chloroform, isoamyl alcohol, anhydrous ethanol, sodium acetate, sodium dodecyl sulfate (SDS), ethidium bromide (EB), bromophenol blue, xylene cyanol FF, acetic acid, sucrose, boric acid, agarose, etc., purchased from Huamei Bioengineering Company, which are imported packaged products.

[0030] 1.3 Solutions and buffers: All solutions and buffers are prepared with deionized ultrapure water. The high pressure sterilization condition is 15 bf / in (1.034×10 5 Pa), 25 min. The reagent preparation methods were all based on the Molecular Cloning Experiment Guide compiled by Sambrook et al.

[0031] 1) Solution used for extracting tissue sample DNA

[0032] ①2mol / L NaCl: Dissolve 11.688g NaCl in water, make up to 100mL, and sterilize by high pressure;

[0033] ②Tissue DNA extraction solution (100 mL): 1 mL of 1 mol / L Tris-HCl (pH 8.0), 20 mL of 0.5 mol / L EDTA (pH 8.0), and 5 mL of 2 mol / L NaCl, and make up to 100 mL;

[0034] 2) Solution used for agarose gel electrophoresis analysis

[0035] ①0.5×TBE buffer: take 50mL of 10×TBE and make up to 1000mL;

[0036] ② Loading buffer: contains 0.25% bromophenol blue and 0.25% xylene cyanol FF, and the solvent is 40.0% (w / v) sucrose aqueous solution.

[0037] 2. Design of primers for amplification of candidate InDel sites of sheep MAST4 gene

[0038] The sequence of the sheep MAST4 gene (NC_056069.1) was retrieved from NCBI, and primers capable of amplifying DNA fragments of multiple candidate InDel sites of the MAST4 gene were designed using Primer 5.0, wherein P3 is a PCR primer pair for amplifying insertion / deletion mutation sites in the intron (specifically the 24th intron) region of the sheep MAST4 gene. The sequence of primer pair P3 is shown in Table 1.

[0039] Table 1. Primers for amplifying candidate InDel sites of sheep MAST4 gene

[0040]

[0041] Note: The missing sequence is CTAAATGCATCAATGTCCAGGCTCTTCCA, i.e. SEQ.ID.NO.3

[0042] The above primer pair P3 is used to amplify the sheep genome, and a fragment containing the insertion / deletion mutation site (NC_056069.1: g.12883964-12883992) of the sheep MAST4 gene on the intron can be amplified. Theoretically, when the sequence CTAAATGCATCAATGTCCAGGCTCTTCCA between g.12883964-12883992 of the MAST4 gene exists (inserted), the PCR amplification using primer pair P3 results in a band of 401 bp in size; when the sequence CTAAATGCATCAATGTCCAGGCTCTTCCA is missing, the PCR amplification using primer pair P3 results in a band of 372 bp in size; when the sequence CTAAATGCATCAATGTCCAGGCTCTTCCA is inserted in one allele and missing in the other allele, the PCR amplification using primer pair P3 results in bands of 401 bp and 372 bp in size, respectively.

[0043] 3. PCR amplification of the sheep MAST4 gene fragment to be tested using primer pair P3

[0044] 3.1 Collection of sheep ear tissue samples and reproductive trait data collection

[0045] A total of 1,511 samples of animals were used in the experiment, including 566 samples of Australian white sheep and 945 samples of Guiqian semi-fine wool sheep. Adult sheep with consistent feeding environment and management conditions were randomly selected, and individual ear tissue samples were taken, stored in 70% ethanol, collected at low temperature in an ice box, and frozen at -80°C. Among them, ear tissue samples of Australian white sheep were collected by group random sampling at Tianjin Aoqun Animal Husbandry Co., Ltd. in August 2019, and a total of 566 individual ear tissue samples of Australian white sheep were collected; ear tissue samples of Guiqian semi-fine wool sheep were collected by group random sampling at Guizhou Xinwumeng Ecological Animal Husbandry Development Co., Ltd. in Hezhang County, Guizhou Province in September 2021, and a total of 945 individual ear tissue samples of Guiqian semi-fine wool sheep were collected. The sheep lambing trait data are measured by breeding farm or farm staff.

[0046] 3.2 Extraction and separation of genomic DNA from tissue samples

[0047] Refer to Sambrook et al., Molecular Cloning Experiment Guide (2002) and the following references: Lan Xianyong. Genetic variation of important functional genes in goats and its relationship with economic traits [D.] Doctoral dissertation, Northwest Agriculture and Forestry University, 2007, Yangling, Shaanxi.

[0048] 3.3 DNA detection by agarose gel electrophoresis

[0049] Refer to "Molecular Cloning Laboratory Manual" edited by Sambrook et al. (2002).

[0050] 3.4 DNA purification

[0051] Refer to "Molecular Cloning Laboratory Manual" edited by Sambrook et al. (2002).

[0052] 3.5 Spectrophotometric DNA detection

[0053] Use a UV photometer to measure the OD value of the DNA sample at 260nm and 280nm. Calculate the DNA content and OD 260 / OD 280 The ratio of OD 260 / OD 280 If the ratio is less than 1.6, it means that the sample contains more protein or phenol, and purification should be performed; if the ratio is greater than 1.8, RNA purification should be considered.

[0054] DNA concentration (ng / μL) = 50 × OD 260 value × dilution factor.

[0055] After the DNA test is completed, a certain amount is taken out and diluted to 50 ng / μL, and stored at -20°C for future use, and the rest is stored at -80°C.

[0056] 3.6 PCR amplification

[0057] The PCR reaction system adopts the mixed addition method, that is, according to the quantity of various components required for each reaction system and the number of PCR reactions required for one reaction, the total amount of various reaction components is calculated, added to a 1.5mL centrifuge tube, fully mixed and centrifuged instantly, and then dispensed into each 0.2mL Eppendorf PCR tube, and then template DNA was added, and PCR amplification was performed after instant centrifugation;

[0058] The PCR reaction system is as follows: 6.5 μL of 2×Taq PCR SuperMix (including Taq DNA polymerase, dNTPs and reaction buffer at a concentration of 2×), 0.5 μL of upstream primer (F), 0.5 μL of downstream primer (R) (the concentrations of the upstream and downstream primers are 10 pmol / μL), 0.6 μL of genomic DNA (concentration is 50 ng / μL sheep genomic DNA), and 4.9 μL of deionized water; a total of 13 μL.

[0059] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 68°C for 30 s, extension at 72°C for 12 s, for 18 cycles, with the annealing temperature decreasing by 1°C after each cycle; annealing at 50°C for 30 s, extension at 72°C for 12 s, for 32 cycles; extension at 72°C for 10 min.

[0060] 4. Agarose gel electrophoresis analysis of PCR amplification products

[0061] Agarose gel electrophoresis detection is divided into three steps: (1) prepare 3.5% agarose gel, stain with nucleic acid dye, apply 4.5 μL sample, and electrophoresed at 120 V for 1.0 to 1.2 h; (2) when DNA fragments of different molecular weights are clearly separated, image them using the BIO-RAD Gel Doc 2000 gel imaging system; (3) analyze site polymorphisms based on the agarose gel electrophoresis results;

[0062] For the polymorphism analysis results of the 29-bp insertion / deletion mutation site (NC_056069.1:g.12883964-12883992) in the intron of the MAST4 gene in sheep individuals of different breeds, see Figure 1 : After the PCR amplification products were detected by agarose gel electrophoresis, the insertion / insertion genotype (II) of the corresponding insertion / deletion mutation site amplified was shown as a band of 401bp, the insertion / deletion genotype (ID) was shown as a total of three bands including two bands of 401bp and 372bp (the reason why the number of bands was more than the expected two was due to heteroduplex; but the three bands did not affect the identification of the ID genotype), and the deletion / deletion genotype (DD) was shown as a band of 372bp. The electrophoresis analysis results were verified by sequencing (see Figure 2 ).

[0063] 5. Statistical analysis of the frequency of candidate InDel sites in the sheep MAST4 gene

[0064] 1) Gene and genotype frequencies

[0065] Genotype frequency refers to the ratio of the number of individuals with a certain genotype to the total number of individuals in a population:

[0066] P YY =N YY / N

[0067] Among them, P YY represents the frequency of the YY genotype at a certain locus; N YY represents the number of individuals with YY genotype in the population; N is the total number of the test population.

[0068] Gene frequency refers to the relative ratio of the number of a gene in a population to the total number of its alleles. The calculation formula can be written as:

[0069] P Y =(2N YY +N Ya1 +N Ya2 +NYa3 +N Ya4 +……+N Yan ) / 2N

[0070] Among them, P Y represents the frequency of allele Y, N YY represents the number of individuals with YY genotype in the population, N Yai represents the number of individuals with the Yai genotype in the population (i=1,2…,n), and a1~an are n different multiple alleles of the allele Y.

[0071] 2) Results

[0072] The genotype frequency, allele frequency and genetic polymorphism index of the 29-bp insertion / deletion mutation site of the MAST4 gene in Australian White sheep and Guiqian semi-fine wool sheep samples are shown in Table 2 .

[0073] Table 2. Gene frequency distribution of 29-bp insertion / deletion mutation sites in sheep MAST4 gene

[0074]

[0075] 6. Association analysis of the gene effect of the InDel site of the sheep MAST4 gene

[0076] Genotype data: Genotype of the 29-bp InDel site (NC_056069.1:g.12883964-12883992) of the MAST4 gene identified by agarose gel electrophoresis after PCR amplification;

[0077] Production data: number of lambs born in the first parity (first litter), the second parity, the third parity and the fourth parity of Australian White sheep and Guiqian semi-fine wool sheep.

[0078] SPSS (23.0) software was used for analysis. First, the descriptive statistical analysis of the obtained data was performed to determine whether there were outliers. Then, according to the characteristics of the data, variance analysis, multivariate linear model or t analysis were used to analyze the effect of genotype. In the process of data processing, considering the individual effect, the interaction between genes and the effect of genotype, a fixed model was used for correlation analysis. In addition, trade-offs were made according to actual conditions. The complete model is as follows:

[0079] Y ijlm =μ+S i +HYS j +G l +e ijlm

[0080] Among them, Y ijlm: individual phenotypic record; μ: overall mean; S i :Farrowing year effect; HYS j : sheep population mean; G l : Fixed effect of genotype; e ijlm : Random error.

[0081] The results of association analysis are shown in Tables 3 and 4.

[0082] Table 3. Association analysis between the 29-bp InDel locus of the MAST4 gene and the litter size trait in Australian White sheep

[0083]

[0084] Note: Different letters on the shoulders of the mean values ​​indicate significant differences; II means second parity

[0085] As can be seen from Table 3, the polymorphism of the 29-bp InDel site (NC_056069.1: g.12883964-12883992) of the sheep MAST4 gene has a significant effect on the lamb number trait (specifically, the second parity lamb number) of Australian white sheep (P<0.05), among which the lamb number trait of the DD genotype individuals is significantly better than that of the II and ID genotype individuals, and the lamb number trait of the ID genotype individuals is better than that of the II genotype individuals. Therefore, the DD genotype of the 29-bp insertion / deletion polymorphism site (NC_056069.1: g.12883964-12883992) of the sheep MAST4 gene can be used as a DNA marker (specifically, an InDel marker) for the high lamb number trait of sheep (e.g., Australian white sheep).

[0086] Table 4. Association analysis between the 29-bp InDel locus of MAST4 gene and litter size in Guiqian semi-fine wool sheep

[0087]

[0088] Note: Different letters on the shoulders of the mean values ​​indicate extremely significant differences; I stands for first parity

[0089] As can be seen from Table 4, the polymorphism of the 29-bp InDel site (NC_056069.1: g.12883964-12883992) of the sheep MAST4 gene has a very significant effect on the lamb number trait (specifically, the number of first-born lambs) of Guiqian semi-fine wool sheep (P<0.01), among which the lamb number trait of ID genotype individuals is significantly better than that of II and DD genotype individuals, and the lamb number trait of II genotype individuals is better than that of DD genotype individuals. Therefore, the ID genotype of the 29-bp insertion / deletion polymorphism site (NC_056069.1: g.12883964-12883992) of the sheep MAST4 gene can be used as a DNA marker for the high lamb number trait of sheep (e.g., Guiqian semi-fine wool sheep).

[0090] In summary, the present invention uses the PCR method to detect the genotype of the 29-bp insertion / deletion polymorphic site (NC_056069.1:g.12883964-12883992) of the sheep MAST4 gene, and performs association analysis with the number of lambs born at different parities in Australian white sheep and Guiqian semi-fine wool sheep, and finds a molecular marker that can be used as an auxiliary selection in sheep molecular breeding. The detection method of the sheep MAST4 gene insertion / deletion polymorphism established by the present invention provides a theoretical and practical basis for the application of marker-assisted selection (MAS) for the sheep lamb number trait using InDel markers, thereby facilitating the speed of breeding of improved breeds.

Claims

1. A kind of sheep MAST4 The application of a gene insertion / deletion polymorphism detection method in molecular marker-assisted selection breeding for improving lambing number in sheep is characterized by: The sheep MAST4 The method for detecting gene insertion / deletion polymorphism comprises the following steps: Using the sheep genomic DNA to be tested as a template, PCR was used to amplify MAST4 The fragment of the gene insertion / deletion polymorphic site is subjected to electrophoresis on the PCR amplification product, and the genotype of the insertion / deletion polymorphic site is identified according to the electrophoresis result; the insertion / deletion polymorphic site is selected from sheep MAST4 The site where the insertion mutation occurred in positions 28 to 29 in the following sequence region in the gene reference sequence NC_056069.1: TTACATCTGTCCAAAGGAGAACAATTAGCTCTGACTTCATGTGGCATCTTGACACTTTTTTCCTGGCTACC, where the insertion sequence is CTAAATGCATCAATGTCCAGGCTCTTCCA; The sheep is an Australian white sheep, and the trait of lamb number is the number of lambs born in the second litter; or, the sheep is a Guigan semi-fine wool sheep, and the trait of lamb number is the number of lambs born in the first litter.

2. The use according to claim 1, characterized in that: The amplification primers of the PCR are: Upstream primer: 5′- AGGACAAGAGTCAGGGGCAT -3′; Downstream primer: 5′- GGGTGCAGTGAATAACACGG -3′.

3. The use according to claim 1, characterized in that: The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 12 s, for 18 cycles, with the annealing temperature decreasing by 1°C after each cycle; annealing at 50°C for 30 s, and extension at 72°C for 12 s, for 32 cycles; and extension at 72°C for 10 min.

4. The use according to claim 1, characterized in that: The electrophoresis uses agarose gel with a mass concentration of 3.5%.

5. The use according to claim 1, characterized in that: According to the electrophoresis results, the insertion / insertion genotype of the insertion / deletion polymorphic site is expressed as a band of 401 bp, the insertion / deletion genotype is expressed as a band including 401 bp and 372 bp, and the deletion / deletion genotype is expressed as a band of 372 bp.

6. Sheep MAST4 The application of gene insertion / deletion polymorphic sites in molecular marker-assisted selection breeding for improving lambing number in sheep is characterized by: The sheep is an Australian white sheep, and the lambing number trait is the number of lambs born in the second parity; or, the sheep is a Guiqian semi-fine wool sheep, and the lambing number trait is the number of lambs born in the first parity, wherein the insertion / deletion polymorphic site is selected from sheep MAST4 The site where the insertion mutation occurred at positions 28 to 29 in the following sequence region in the gene reference sequence NC_056069.1: TTACATCTGTCCAAAGGAGAACAATTAGCTCTGACTTCATGTGGCATCTTGACACTTTTTTCCTGGCTACC, where the insertion sequence is CTAAATGCATCAATGTCCAGGCTCTTCCA.

7. The use according to claim 1 or 6, characterized in that: For Australian White sheep, the deletion / deletion genotype of the insertion / deletion polymorphic site can be used as a DNA marker for improving the lambing number trait of sheep.

8. The use according to claim 1 or 6, characterized in that: For Guiqian semi-fine wool sheep, the insertion / deletion genotype of the insertion / deletion polymorphic site can be used as a DNA marker for improving the lambing number trait of sheep.

Images