Molecular markers for identification and differentiation of elephant trunk orchid and short-stemmed calyx orchid and their application

Abstract

The present invention relates to the technical field of molecular markers, and in particular to molecular markers for identifying and distinguishing elephant orchids and short-stemmed calyx orchids. The molecular markers of the present invention can be obtained by amplifying the primer pairs shown in SEQ ID NO.29 to SEQ ID NO.56. The molecular markers of the present invention can be used to effectively identify and distinguish elephant orchids and short-stemmed calyx orchids.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers for identifying elephant trunk orchids and short-stemmed calyx orchids and applications thereof. background

[0002] Phalaenopsis is a member of the subtribe Aeridinae in the tribe Vandeae of the subfamily Epi dendroi deae of the family Orchidaceae. Although the number of members in the genus is small, its taxonomy has been controversial for nearly two centuries. The subtribe Aeridinae has variable floral characteristics, such as the number of pollinia, the presence or absence of a column foot, the length of the column foot, and the shape of the beak and pollinia. These characteristics are often used to classify the genera under the subtribe Aeridinae, and have also led to a series of artificial divisions, of which the genus Phalaenopsis is a typical example. The most obvious feature to distinguish different species is the flower characteristics, but even in the flowering period, due to the influence of climate, geographical environment and other factors, different species of Phalaenopsis have different flower shapes and colors, and some individuals are often very similar, especially when there are no flowers when collecting in the wild, it is often difficult to distinguish, especially some epiphytic dwarf species, such as short-stemmed calyx orchid (Phalaenopsis subparishii), calyx orchid (Phalaenopsis japonica), elephant trunk orchid (Phalaenopsis zhejiangensis), Banna Phalaenopsis (Phalaenopsis manni), etc. At present, the classification and identification of Phalaenopsis is still mainly based on morphological classification and molecular biology methods. DNA molecular markers used in the classification of Phalaenopsis include restriction fragment length polymorphism (RFLP) markers, random amplified polymorphic DNA (RAPD) markers, amplified fragments length polymorphism (AFLP) markers, short tandem simple sequence repeat (SSR, also known as microsatellite) markers, and inter-simple sequence repeat (ISSR) markers. These molecular markers have their own advantages and disadvantages. RAPD markers are the most widely used due to their low technical difficulty and cost, but they are easily affected by experimental conditions, have poor stability and repeatability, and the reliability of test results is relatively low. RFLP, ISSR, and SSR, which are slightly more difficult and costly, are less used. Some gene fragments commonly used in phylogenetic construction usually require moderate polymorphism, and in many cases, they are differences in SNPs, which are not easy to detect and observe in species identification.Therefore, it is very necessary to develop molecular markers that can quickly, accurately and easily observe and distinguish Phalaenopsis species, especially those that can distinguish short-stemmed calyx orchid (Phalaenopsis subparishii), calyx orchid (Phalaenopsis japonica), elephant trunk orchid (Phalaenopsis zhejiangensis), and Banna Phalaenopsis (Phalaenopsis manni). Summary of the invention

[0003] The present invention mainly aims at the above technical problems, and provides a simple molecular marker method to achieve the identification and distinction of elephant orchids and short-stemmed calyx orchids, and can also distinguish short-stemmed calyx orchids from other Phalaenopsis, especially calyx orchids (Phalaenopsis japonica), elephant orchids (Phalaenopsis zhejiangensis), and Banna Phalaenopsis (Phalaenopsis manni). Specifically, a molecular marker for identifying elephant orchids and short-stemmed calyx orchids and applications thereof are provided. The present invention utilizes a high-throughput sequencing method to assemble genome contigs from the whole genome sequences of elephant orchids and short-stemmed calyx orchids, and compares the genome contigs of elephant orchids and short-stemmed calyx orchids. There are multiple Indels with a length of more than 10 bp in the genomes of elephant orchids and short-stemmed calyx orchids, which are presumably used as molecular markers to identify and distinguish elephant orchids and short-stemmed calyx orchids through conventional PCR and agarose gel electrophoresis, or through first-generation sequencing.

[0004] Specifically, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides a molecular marker for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, wherein the molecular marker comprises any one of the following sequences (SEQ ID NO: 1-SEQ ID NO: 28):

[0006] SEQ ID NO: 1:

[0007] TCTAAAGAATAAAGAATATTAAAAGAATATTCTTAATATTCTTTTAATATTCTTATACTTTTAATATTCTTATATAATATATATAATATATAGTTTATATATAATAGAATATAGATATATATAATATAGAATATAGAATTTCATATAATTTAGAATAGAATCTTATAGAATTTATTATAGAATTTC

[0008] SEQ ID NO:2

[0009] TCTAAAGAATATCTAAGTATAAGAATATTCTTATATACTTAGATTCTTATATAATATATAGTTTATATATTTTATATATTATTTTATATATTCTAATAGATTATATATATTCTAATAGATTATAGAATTTTAGATAATTTAATCTAATTCAGAATAGAATTAATTTAGAATAGAATCTTATAGAATTTATATACTTTACATAGAATTCATTATATAATTGATTTTATTATATAATTTC

[0010] SEQ ID NO:3

[0011] TTTATCTATATCTATATATTATATCTTAGATATATTAGTAGTATTCTATTCTTAGTAATATTCTATTATTCTATTAGTATTAGATTTATCTAATTCTTTAATTTTAATATATGATATGGTCTTTATATGGTATATAGTATATGCCCATACTATTCTTCCTACATTAATTCTTTCGATGGGCCCCGGATCCATATCAATAAGCATAAGAAGAGATATAAAAAATGAGGAATTCAAGGAGTTGGGCTTGCAATTCTTTTGGATTGATCAAAATGCATACAAATGGGTGTAGAGAAAAAATTGAAAATTTGAGGGCTATTTCATTTTGATATACGTCTAATATATATATTATTACTTATATATAGATATCTATTGTCAATTGATCTATATAAGAGAAAGCTTCTTTCTGTATACAATACAACTTTCTGTTTTATGTACTTTTTA

[0012] SEQ ID NO:4

[0013] TTTATCTATATCTATATATTAGATTATTTCTTAGATATAGATATCTATTGTCAATTGATCTATATAAGAGAAAGCTTCTTTCTGTATACAATACAACTTTCTGTTTTA

[0014] SEQ ID NO:5

[0015] ATCACCTATTCTTATACACTTATCCAATCCTTCTTACTTTACTTATCTATAAGATATACATAAAAATTATGAGATATCATATATTCAATATTTACAATATGCAAATACAAAAAATAAACAAAACAATTTGTGTCTGCATTCTCGGTCAAAATATGGGCACTCTATTCCATTTCGTTGATCACGAAAATAACAATCAAAAAGAAAATAAGACGAGTATAGTCACTCTTCAAATACTAAATAGAGTCTGTATTACTCTAGTAATTAGTAAGAAGTAACAATTTTACAAATTTAAATATTTGTCTGA

[0016] SEQ ID NO:6

[0017] ATCACCTATTCTTATACACTTATCCAATCCTTCTTCCTTTACTTATCTATAAGATATACATAAAAATTATGAGATATCATATATTCAATATTATATAGGTCGTACAATATGCAAATACAAAAAAGAAACAGTAATAAAGTAGTAGAAATGAGATGGAAAAAAGAAGAGAACAGATGAAGTATCAAAAAGAGAATATTACAACAGATTCCTTCAAAGGGGCGTTGCTTGGTTGGTATTTTCTTAGTATCCCCTTTCTTTCCTTCTTGGATTGGAACTAAAACACATACATAAAAAATGCAGTATGCAATTTGGATGAGAATATATAGA TTGTTTCCAATTAGTCATTGTGGATGCACAAACAAACAAAGTTTGTTCAGAACTAAAGAAGGTGTATCTGAACCCGAAAAGTACTCTGTCAAGATAATTGTTCATTGTTTTGTTTATTATAAACAAAATAAACAAAACAATTTGTGTCTGCATTCTCGGTAAAAATATGGGCACTCTATTCCATTTCGTTGATCACGAAAATAACAATCGAAAAGAAAATAAGACGAGTATGGTCACTCTTCAAATACTAAATAGAGTCTGTATTACTTTAGTAAGTAGTAAGAAGTAAAAGAAGTAACGATTTTCCAAATTTAAATATTTGTCTGA

[0018] SEQ ID NO:7

[0019] GATCTTAGAACTATATAGAACTCTATATTTAGATTATTCTATTTATATTCTATTTATATATAGAACATAATATAAGTATATACTATATATGTAATGAATATGAATTATGAATATAAATATATAAATAGTATTAAATAGTAAAATAGTATTAAATAGTAAGAGTATTATAGTATATATATATAAGTCAAGTAAGTCAAGTGAATCTTTTTCTGATGGAAAAGTCAACA

[0020] SEQ ID NO:8

[0021] GATCTTAGAACTATATAGAACTCTATATTTAGATTCTATATTTATATATAGAACATAATATAAGTCTATACTATGATATGTAATGAATATGAATTATGAATATGATTATGAATATGAAAATCTATTCATATTGAAGTAATTTAAAGGAAGTTCAATTAAGTCAAGTTAAAAAAAAAAAGAAAAATAAAGTAGTATTACTTTTACTACTAGTCAAAGTAAAAGTAGAAAAAGTCTAGTCTATAAATTATAAATATATAAATAGTCTTAAATAGTAAGAGTATATTAAGAGTATATATAGTATATAAATAATAGTATATATAGTATATACTATTATACTATATTAAATATAGTATATCTATATATAAATATAGTATATTTATATAAGTGCAAGTAAGTCAAGTGAATCTTTTTCCGATGGAAAAGTCAACA

[0022] SEQ ID NO:9

[0023]

[0024] SEQ ID NO:10

[0025] CTTTTTCATTTTTTCTCTCTTTTTTTTTTCTCCTTTCAATTCTCTTTCTATATGTGATATGTGATGTTTAATATAGAATGCTCTTATACTTAGTTCTTTTTCTTTTCTATTCTACTTAATTATTATACTTATTATCTTATATATCTTTATATATTTATATATATATATTTTTTTTCTATATTTTTTCTATTTCATATTGATCTTATATCTTAGAAAATATAAAGTGAAAGTAAAGAATTTCCTATCTTATATTAACTTTTCTATTAACTTAGAATAATTATAGATAGTAATTCTAGTAATATACTATAGTAATAAGTAATAGTAATATAGTAAAGAATAGTAAAGAAGAAATTCAATTTAAAAAGAAAAAGAATAAAAAAATGATAAAGA

[0026] SEQ ID NO:11

[0027] CACATATTCTTCTTTATATATAATATCTGTTCCCTTTTCTAGATGAATTATGACTCTTTTCACATCTAGGATTTACATATACAACATATATTACTGTCAAGAGAGGGGACCGGGGTCCTATATTCTTTCTTTTTCTTTCTATATTAGATATTTCTATTTACTATTTATTATCTTTAATATCTTTATTATCTTTACTTTAAG

[0028] SEQ ID NO:12

[0029] CACCTATTCTTCTTTATATATCATAATATATTACTGTCAAGAGAGGGGACCGGGTCCTATATTCTTTCTTTTTCTTTCTATATTAGATATTTCTATTTACTATTTATTATCTTGACTTTAAA

[0030] SEQ ID NO:13

[0031] TAAAAAAGAATTCCTCTTTTTAGGCCTTTGATTGAATCCCTATCCATGCGCTGCGGTTAGACAGTGAATTCTTTCAAATTCGAATGGAAAAAAAAAATTAGAATCCGGTAGGTTCGTCTTTAAATCCAAATTCTATTTGTTAGTTCAAATGGTTTTCGAGTCTGATAGATCATTCATTGAAT TCCTAATTGTGATCTCTGGAATATGGAAATTTTTTACTTTTTTTTCATTCATTCGAAACTTTCGTGTGTTCTATTCTAGATCAAGACTCAATTCTTACAAAAAAAAAGGAAAAGATTCATGGTTTGATACCTTATTCATGTGAGTTAAGCTCTGTCGTATAGATAGATATATCATTACCAC

[0032] SEQ ID NO:14

[0033] TAAAACATAATTCCTCTTTTTCGGCCTTTGAATTGATACCCTATCCCTACCGCTTTCGTACTTCATAGAAATCTCAGATAGAATCGAC

[0034] SEQ ID NO:15

[0035] AAGGAGACAGGTAGTCTGATACAAAATTTTTGCCGTCTTTTTCCTCTTTTTTTTTTTTATTTATTCTAGTATTAAAGTAGAATGATTTTTCTATTTATTCTTATTTATTTATTCTTTTTTTCTATTATTATTATTTATTTATTATTATC TATTTCATATTCATATATATATATTATTATTTATTATTATATATATATAGTCTATATATATATATATATATATAATTAATTATAATTAGTTATATATATATATATAATTATTTAATTAATTATAATTAGTAAATCTCAATTTCTAATTTATTTATTTAATTAATTATATATAGTTAATCTCAATTTCTAATT

[0036] SEQ ID NO:16

[0037] AAGGAGACAGGTAGTCTATACAAAATTCCTTTACCATCTTTTGTCTCTATTTTTTTTTTATTCTTATTTATTTATTTATTTATTTTTTCTTATTTA TTCTTAATTTAATCTATTATCTATTTCATATTCAATAACTTTATTCAATTACTTACTTATATATATATATTCATAGTAAATTAGTAAATCTAAATTATTTATTTTTAGTAAATGATCCGAAATGAATAG

[0038] SEQ ID NO:17

[0039] TAAAATATATATATATATATATATATATATATATATATATA CTTATATAACTAGATAACTAAGCGTGTTTTTTATTATTATTATTCTATATATAAAAAAAAAGAATGCTTCTTTTTTTTATCAAATCTCTAAAGTCTTTTTCTTTACCTCTATTGAATCTTATTGAAT

[0040] SEQ ID NO:18

[0041] TAAAATTATATATATAGAAATGTATTTCTCTCAAAGAAAAAAAAAGAATTACTTCATTTTTTATTTATTTATTATTTGTTATATAGGCAGGCTGTATATA ACTTATATAACTAGATAACTAGGCGTGTTATATATATATATAAATATATAAAAAAAAATAATGTTTCTTTCTTTGTAAAATCTCTAAAGTATTTTTCTTTACCTCTATTGAAT

[0042] SEQ ID NO:19

[0043]

[0044] SEQ ID NO:20

[0045] TATATATCAAAGATGTAAAATCAAACCTCTTTCTCGATTCAAGAGAAGCCCAAAGAAGTGAATAGGGTACCCAAATAACGATAGATATGTCAAGGCGGGTCCGATTACGCCTATTCCTAATCCTAAATAGAATGTAACGA CGTAGGGATCCTTATGTAAACAGAGTATCTATTTACATACGCTCGAATGACCCCTTCTCATAATAAGAATGTAAATAACCCTATTCCGGCCTGGTCCGGTCTGGAATGAACTTAGAATCTGATGATCGAGTCGATTCCATGAT TCTAAGTTCATAACTCCAGCCCATTCCCATTTTGGGCGGAAAAGATCTACTAATTCTTTTATTCCAGTTAGTAAAAGGGATCTTTTTATCATAAATAGATTCGTTGTTCCTGACCCTGCTTCACCTTAATTGTTATTTGAACAAAAGGATAAACTTTTGGTCAAAGTGATGTCTTGGTCCGAGTGGGGATAGCATTTCTCTTCTGCATGTCTATGGAGTTTTGAAAAATCCAAACATCTCAGAGATAGATATAGAGGTAGGAATTTGTCGAACGAACCGCACTCCTT

[0046] SEQ ID NO:21

[0047] TTGGTATGAAATTGGGCTGATAATTATTCCAAAAGAGTAAGAATTATGCAACAAAACCACTCATTCCTGGCAATGCAAGAGAAACCATCGAGAAACTACTAAACATGATAAATATTTTTGACATTGGAATAGGTATCCCCCATCTATTCGAGATAAAAAAAAACGTATTCTATCACAACTTGTTTCTTCTAAGAAA AAAGCGCAGCACCAATCAATCTATGAGAAATCAATCTATGAGATAGTATTTGTAAAATGATTTAATTAAGTCCTATGCCAGTTATTCCTATAATTAGGAAACCCATATACCTAGAATTCCTATTAAGAGAAAAAAAAAAAGAACCTCCGGTAGTGCACAAAAGAAACTTTGTAGTCGAGTATAGACATTTTTTTCCTCC CCACATGGATAAAAGTAAATAAAAAAAGGAATTAATTTGAATTCCTACATGATGAAAAAAAGGAAAAAGTCTCGAGAAGAAAATGATGCTATTTGACCACTATACATTGCTAACATCAAGAAAATAGAAAAATCGCGGATTTTGAGTAATTGGCCAAGCTACTAAAGTAGTTCTAAATCCTGTCAGTAAAAAGGGTCCTATGGAAAGTCCATCGGTTTCCAGTCTCCATTGAAAATCAAAAAGATTGATTCATTTAGAATCCTTCTTGGATTGGGTTACTGGATCGTCCAATTGGGAAATGATAACAAAATAAAAACAAAATAAATAGATCATTAGAAGGAACTCTAGGATACATATATATAGAGTATACCACCTATACACCTTATTTCTCCTATGAG

[0048] SEQ ID NO:22

[0049] TTGGTATGAAAAGATATTTTGGGCTGGTAATTATTCCAAAAAAGAGTAAAAATTCTGCAACAAAACCACTCATTCCTGGCAATGCAAGAGAAACGATCGAGAAACTACTAAACATGATAAAGATTTTTGACAT TGGTATTTGACATTGGAATAGGTATTCCCATCTCTTCGAGATAAAAAAAAAACGTATTCTATCACAACTTGTTTTTGCTAATAAAAAAGCACAGCACCAATCAATCTATGAGATAGTATTTATAAAATGATTTC ATTAAGTCCTATGCCAGTTATTCCTATAATTAGGAAACCCATACCTAGAATTCCTATTAAGAAGAAAAAAAAGATTGATCCATTTAGAATCCTTCTTAGATTGGGTTAATGGATCGTCCAATTGGGAAATG ATAACAAAATAAAAACAAAATAAATAGATCATTAGAAGGAACTCTAGGATATATATAGGATATCTAGGATATACTATATATATATATATAGTATATAGAGTATACCATCTATGACACCTTATTTCTCCTATGAG

[0050] SEQ ID NO:23

[0051] CCTTTTTTTATTTCTAAGCTTGCGTAATCTTCTTCAACAGTTTTTTATTCTTTGGTTAGTAGATTCAATACAAGATTTGTTTGGACCTGTTGTTGGTTTTCTTCCTGCTTGTAATTTACTAATTCAAGATCTTTTTTTTTCATAGATGATTTTACGTTAATTTTTTCA

[0052] SEQ ID NO:24

[0053] CCTTTTTTTATTTCTAAGCTTGCGTAATCTTCTTCAACAGCTTTTTTTTTCTTAGATGATTTTACGTTAAAATTTTCA

[0054] SEQ ID NO:25

[0055] GATAGTATGCCTCTTGAAAGTTAAATTCATCCGCCTCTTGAAAGTTAAATTCATCCGCCTCTTGAAAGTTAAATTCATCCTTTGTTTTTTCCTTTCCATTCACTCGGATCTCTTCCATTTCATCTATTTTGTCCAGATCCTCCTTTTCTTCCGAACAAAGGTAAGGTTTTTCTTCGGTGAATTCCT

[0056] SEQ ID NO:26

[0057] GATAGTATGCCTCTTTAAAGTTAAATTCATCCTTTGTTTTTTCCTTTCCATTCACTCGGATCTCTTCCGTTTCATCTATTTTGTCCAGATCCTCCTTTTCTTCCGAACAAAGGAAAGGTTTTTCTTCGGTTGATTCCT

[0058] SEQ ID NO:27

[0059]

[0060] SEQ ID NO:28

[0061] ACGAATCTATTTATGATAAAAAGATCCCTTTTACTAACTGG

[0062] In one embodiment, the odd-numbered sequences in the above molecular markers are present in Brachystemon orchids, and the even-numbered sequences are present in Elephant trunk orchids.

[0063] Primers were further designed for the above Indel sequence so that the above Indel sequence was included in the primer amplification product.

[0064] Samples of elephant trunk orchid and short stem calyx orchid were selected and PCR was performed using the designed primers. The product fragment lengths and the differences between the two types of Phalaenopsis were consistent with expectations (e.g. Figure 2 ), the PCR products can be used as molecular markers for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, and the sequences of the PCR primers are shown in SEQ ID NO.29 to SEQ ID NO.56:

[0065] In another embodiment, any DNA or RNA fragment containing the above PCR product sequence can be used as a molecular marker for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids.

[0066] In a second aspect, the present invention provides primers for amplifying the above-mentioned molecular markers, wherein the amplification product sequence of the primers contains the above-mentioned molecular marker sequence.

[0067] In a preferred embodiment, the primer pairs of the present invention include at least one pair of primer pairs S1 to S14, and preferably include at least one pair of sequences shown in primer pairs S2 to S14.

[0068] In a third aspect, the present invention provides a method for identifying and distinguishing elephant orchids and short-stemmed calyx orchids, characterized by comprising the following steps:

[0069] 1) Extracting total DNA from samples to be tested;

[0070] 2) sequencing the total DNA to obtain a sequencing sequence;

[0071] 3) aligning the above sequencing sequence to a DNA barcode, wherein the DNA barcode is any one of SEQ ID NO.1 to SEQ ID NO:28;

[0072] 4) Determine the species of the sample based on the coverage of the sequencing reads on the DNA barcode.

[0073] In one embodiment, if the sequencing reads can completely cover any sequence from SEQ ID NO.1 to SEQ ID NO:28, the sample to be detected is determined to be the species corresponding to the barcode that can be completely covered by the sequencing reads.

[0074] In another embodiment, the DNA barcode is any one of the aforementioned molecular markers.

[0075] In a fourth aspect, the present invention provides a method for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, characterized by comprising the following steps:

[0076] 1) Extracting total DNA from samples to be tested;

[0077] 2) performing PCR on the total DNA of the above samples using primers, wherein the primers include at least one pair as shown in primer pairs S1 to S14;

[0078] 3) Performing electrophoresis detection or sequencing on the PCR product and the standard substance, and determining the species information of the sample to be detected according to the electrophoresis or sequencing results, wherein the standard substance is the aforementioned molecular marker.

[0079] In one embodiment, if the length of the PCR product is consistent with the length of the standard, the sample to be tested is determined to be the species corresponding to the corresponding standard.

[0080] In another embodiment, if the sequence of the PCR product is consistent with the sequence of the standard, the sample to be tested is determined to be the species corresponding to the corresponding standard.

[0081] In a fifth aspect, the present invention provides molecular markers for identifying and distinguishing Paphiopedilum brachyphyllum and other Paphiopedilum plants, wherein the molecular markers comprise any of the odd-numbered sequences in SEQ ID NO:1 to SEQ ID NO:28.

[0082] In one embodiment, the molecular marker is preferably any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, and SEQ ID NO:25.

[0083] In another embodiment, the molecular marker is preferably SEQ ID NO:1.

[0084] In another embodiment, the Paphiopedilum plant is Phalaenopsis japonica, Phalaenopsis zhejiangensis, or Phalaenopsis manni.

[0085] In a sixth aspect, the present invention provides primers for amplifying the above-mentioned molecular markers, wherein the amplification product sequence of the primers contains the above-mentioned molecular marker sequence.

[0086] In a preferred embodiment, the primers of the present invention include at least one pair of primers as shown in Primer1 to Primer14, and preferably include at least one pair of primer sequences as shown in Primer2 to Primer14.

[0087] In one embodiment, the primer pair is preferably any one of S1, S7, and S25.

[0088] In another embodiment, the primer pair is preferably S1.

[0089] In another embodiment, the Paphiopedilum plant is Phalaenopsis japonica, Phalaenopsis zhejiangensis, or Phalaenopsis manni.

[0090] In a seventh aspect, the present invention provides a method for identifying and distinguishing Paphiopedilum brachyphyllum and other Paphiopedilum plants, characterized in that it comprises the following steps:

[0091] 1) Extracting total DNA from samples to be tested;

[0092] 2) sequencing the total DNA to obtain a sequencing sequence;

[0093] 3) Aligning the above sequencing sequence to a DNA barcode, wherein the DNA barcode is any odd-numbered sequence in SEQ ID NO: 1 to SEQ ID NO: 28.

[0094] 4) Determine the species of the sample based on the coverage of the sequencing reads on the DNA barcode.

[0095] In one embodiment, if the sequencing reads can completely cover any of the odd-numbered sequences in SEQ ID NO: 1 to SEQ ID NO: 28, the sample to be detected is determined to be Brachyphyllum breviscapum.

[0096] In one embodiment, the DNA barcode is preferably any one of SEQ ID NO:1, SEQ ID NO:7, and SEQ ID NO:25.

[0097] In another embodiment, the DNA barcode is preferably SEQ ID NO:1.

[0098] In another embodiment, the Paphiopedilum plant is Phalaenopsis japonica, Phalaenopsis zhejiangensis, or Phalaenopsis manni.

[0099] In an eighth aspect, the present invention provides a reagent or a kit containing the above-mentioned primers.

[0100] In a ninth aspect, the present invention provides any of the following applications of the above-mentioned molecular markers, primers, reagents or kits:

[0101] (1) Application in identifying elephant orchids and / or short-stemmed calyx orchids;

[0102] (2) Application in identification, improvement or molecular marker-assisted breeding of elephant orchid and / or short-stemmed calyx orchid germplasm resources;

[0103] (3) Application in screening and / or creating different varieties of elephant trunk orchids and short-stemmed calyx orchids;

[0104] (4) Application in constructing a DNA fingerprint database of elephant trunk orchid and / or short-stemmed calyx orchid;

[0105] (5) Application in identifying and differentiating Paphiopedilum brachyphyllum and / or other Paphiopedilum plants.

[0106] The single molecular marker of the present invention can simply and effectively distinguish whether the tested variety is short-stemmed calyx orchid or elephant orchid, providing a guarantee for the identification, planting, resource utilization and breeding of short-stemmed calyx orchid or elephant orchid. Short-stemmed calyx orchid can also be identified from other Paphiopedilum plants. It is also of great significance for the classification, phylogeny, and phylogenetic research of orchidaceae species, as well as the protection and utilization of orchidaceae resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 Morphological photos of elephant trunk orchid and short-stemmed calyx orchid; A is elephant trunk orchid and B is short-stemmed calyx orchid.

[0108] Figure 2 It is an electrophoresis picture of PCR products amplified using SEQ ID NO: 29-56 of Elephant Trunk Orchid and Short Stem Calyx Orchid, wherein M is a marker, S1-S14F are primer pairs 1-14, Pz represents Elephant Trunk Orchid, Ps represents Short Stem Calyx Orchid, and there are 3 individuals of each species.

[0109] Figure 3 This is the alignment result of SEQ ID NO:7 and SEQ ID NO:25 on Gebank, Figure A is SEQ ID NO:7, and Figure B is SEQ ID NO:25.

[0110] Figure 4 The figure shows the alignment results of the second-generation sequencing reads of Selenicereus chinensis on SEQ ID NO: 1 and SEQ ID NO: 7. Figure 4 A, B, and C are the alignment results on SEQ ID NO: 1; Figure 4 D, E, and F are the alignment results based on SEQ ID NO:7.

[0111] Figure 5 The middle is the alignment result of the second-generation sequencing read of Banna Phalaenopsis on SEQ ID NO: 25. DETAILED DESCRIPTION

[0112] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not used to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following embodiments are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial sources.The plant samples used in the following embodiments can be obtained by field collection or commercial purchase.

[0113] Example 1 Development of specific molecular markers for elephant trunk orchids and short-stemmed calyx orchids

[0114] Photos of four types of orchids without flower organs Figure 1 As shown, it is difficult to identify from the leaves alone.

[0115] The specific molecular markers for distinguishing elephant trunk orchid and short stem calyx orchid, i.e. molecular markers, were obtained by the following steps:

[0116] 1) Collect leaves of elephant trunk orchid and short-stemmed calyx orchid;

[0117] 2) Extracting total DNA from leaves of elephant orchid and short-stemmed calyx orchid;

[0118] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0119] 4) Assemble the genomes of Orchidina truncatula and Orchidina brevis and obtain genome contigs sequences.

[0120] 5) Compare the genomic contigs of Orchidina truncatula and Orchidina brevis to obtain species-specific fragments, i.e., molecular markers.

[0121] The results are shown in Table 1 and Figure 2There are multiple Indels longer than 10 bp in the genomes of Elephant Orchid and Brachystem Calyx Orchid, which are speculated to be used as molecular markers to identify and distinguish Elephant Orchid and Brachystem Calyx Orchid through conventional PCR and agarose gel electrophoresis.

[0122]

[0123]

[0124]

[0125]

[0126] Example 3 Primer design of specific molecular markers for elephant trunk orchid and short stem calyx orchid

[0127] According to the comparison results in Example 1, combined with the corresponding contigs sequences, multiple pairs of PCR primers for identifying elephant trunk orchids and short-stemmed calyx orchids were designed using Geneious software. The primer sequences are as follows:

[0128]

[0129]

[0130] Example 3 Identification of elephant trunk orchid and short-stemmed calyx orchid

[0131] 1) Collecting leaves of elephant trunk orchid and short-stemmed calyx orchid plants respectively as samples to be tested;

[0132] 2) extracting total DNA from the sample to be tested;

[0133] 3) using the primer pairs designed in Example 3, PCR was performed on the total DNA of the above samples respectively;

[0134] The PCR amplification reaction system is 25 μL, 2×Phanta Max Master Mix 12.5 μL, upstream primer (10 μM) / downstream primer (10 μM) 1 μL each, DNA template 200-300 ng, ddH2O supplemented to 25 μL. 2×Phanta Max Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, protective agent and buffer system;

[0135] The PCR amplification procedure was as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and annealing at 72°C for 15 s.

[0136] Extension for 75 seconds, 35 cycles; ③ Extension at 72°C for 5 minutes;

[0137] 4) Electrophoresis detection of PCR amplification products:

[0138] The PCR products were detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under a gel imaging system, and the main bands were clear.

[0139] From the electropherogram ( Figure 2 ) It can be seen that the length of the PCR product fragments of primer pairs 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, and 14 and the difference between the two Phalaenopsis orchids are consistent with expectations. Primer pair 12 has two bright bands in the elephant trunk orchid, but only one bright band in the short-stemmed calyx orchid, which can also distinguish the two Phalaenopsis orchids.

[0140] Example 4 Differentiation and Identification of Short-stemmed Calyx Orchid and Other Phalaenopsis

[0141] In order to further verify the specific fragments of short-stemmed calyx orchid, all the specific fragments of short-stemmed calyx orchid in Example 2 were sequenced in the genbank database of NCBI. The results showed that all the specific fragments did not have a consistency and coverage of 100% in the comparison results of Phalaenopsis. Among them, SEQ ID NO:1 could not be compared with any result. The sequence comparison results of SEQ ID NO:7 and SEQ ID NO:25 are shown in Figure 3 , the coverage of Paphiopedilum and Brachystemon calyx-ridged Orchid does not exceed 70%, and the consistency is also less than 99%. It can be seen that the above SEQ ID NO: 1, SEQ ID NO: 7, and SEQ ID NO: 25 are highly specific and can distinguish Brachystemon calyx-ridged Orchid from all known Paphiopedilum plants.

[0142] Further 10G second-generation sequencing was performed on Phalaenopsis japonica and Phalaenopsis manni, which have similar phenotypes to Phalaenopsis japonica and have high sequence homology on NCBI, and three individuals were tested for each sample. The sequencing reads were aligned to SEQ ID NO: 1, SEQ ID NO: 7, and SEQ ID NO: 25 using Geneious software, and the maximum mismatch base and maximum gap ratio were set to 3%. The results are shown in Figure 4 and Figure 5 As shown, Figure 4 In the case of Semen Cynae, only the 5' end of Semen Cynae was slightly covered in Semen IN NO:1 ( Figure 4 A, B, C), there is read coverage only at both ends of SEQ IN NO:7, with an obvious gap in the middle ( Figure 4 D, E, F), no reads coverage on SEQ ID NO:25. Figure 5 In the case of Banna Phalaenopsis, only reads were covered at both ends of SEQIN NO:25, with an obvious gap in the middle ( Figure 4 A, B, C), there is no read coverage on SEQ IN NO:1 and SEQ ID NO:7.

[0143] It can be seen that the above three sequences can distinguish short-stemmed calyx orchid from calyx orchid and calyx orchid from Banna Phalaenopsis.

[0144] It can be seen that the aforementioned molecular markers and corresponding primers can be used for conventional PCR gel electrophoresis or first-generation sequencing to achieve simple and effective identification and differentiation of Orchidaceae and Paphiopedilum brevis. Among them, SEQ ID NO: 1, SEQ ID NO: 7, and SEQ ID NO: 25 can also distinguish Orchidaceae from all Paphiopedilum plants.

[0145] In summary, first of all, the present invention is a powerful supplement to traditional species identification, and the sample identification process is effective, can be automated and standardized, breaks through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a short time. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogenetic research of orchid species, as well as the protection and utilization of Phalaenopsis resources.

[0146] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A molecular marker for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, characterized in that: The sequences of the molecular markers are shown in SEQ ID NO.3 and SEQ ID NO.4, wherein SEQ ID NO.3 is derived from the genome of Brachystemon calyx, and SEQ ID NO.4 is derived from the genome of Elephanthus serratus.

2. Primers used to identify and distinguish between elephant orchids and short-stemmed calyx orchids, wherein the primers are capable of amplifying the molecular markers described in claim 1 in the genome of elephant orchids or short-stemmed calyx orchids.

3. The primer according to claim 2, characterized in that The sequences of the primers are shown in SEQ ID NO:30 and SEQ ID NO:

44.

4. A kit comprising the primer according to claim 2.

5. A method for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) sequencing the total DNA to obtain a sequencing sequence; 3) aligning the above sequencing sequence to the DNA barcode, the sequence of the DNA barcode is shown in SEQ ID NO.3 and SEQ ID NO.4; 4) Determine the species of the sample based on the coverage of the sequencing reads on the DNA barcode; 5) If the sequencing reads can completely cover SEQ ID NO: 3, the sample to be tested is judged to be Brachyphyllum calyx orchid; if the sequencing reads can completely cover SEQ ID NO: 4, the sample to be tested is judged to be Elephant Trunk Orchid.

6. A method for identifying and distinguishing elephant trunk orchids and short-stemmed calyx orchids, characterized in that The following steps are involved: 1) Extracting total DNA from samples to be tested; 2) performing PCR on the total DNA of the above samples using primers, wherein the sequences of the primers are shown in SEQ ID NO: 30 and SEQ ID NO: 44; 3) Performing electrophoresis detection or sequencing on the PCR product, and determining the species information of the sample to be detected according to the electrophoresis or sequencing results, wherein the standard substance is the molecular marker according to claim 1; 4) If the length of the PCR product is consistent with the length of SEQ ID NO.3, the sample to be tested is judged to be a stem-calyx-ridge orchid; if the length of the PCR product is consistent with the length of SEQ ID NO.4, the sample to be tested is judged to be an elephant trunk orchid.

7. Any of the following uses of the molecular marker according to claim 1, the primer according to claim 2, or the kit according to claim 4: (1) Application in identifying elephant orchids and / or short-stemmed calyx orchids; (2) Application in identification, improvement or molecular marker-assisted breeding of elephant orchid and / or short-stemmed calyx orchid germplasm resources; (3) Application in screening or creating different varieties of elephant trunk orchids and / or short-stemmed calyx orchids; (4) Application in constructing a DNA fingerprint database of elephant trunk orchids and / or short-stemmed calyx orchids.

Images