A method for detecting circular RNA based on microfluidics technology

Abstract

The present invention relates to the field of nano-biosensor technology, and specifically discloses a method for detecting circular RNA based on microfluidic technology, wherein a DNA tetrahedron is covalently modified on the surface of a microfluidic chip, and a capture probe for circular RNA is provided at the top of the DNA tetrahedron, and a liquid to be tested containing circular RNA is passed into the microfluidic chip, and the circular RNA is captured by the DNA tetrahedron on the surface of the microfluidic chip; a DNA hairpin structure modified with fluorescein at the end is passed into the microfluidic chip, and the circular RNA captured on the microfluidic chip triggers a hybridization chain reaction, and then the fluorescent labeling of the circular RNA is realized, and then the fluorescence intensity is quantified, and a circular RNA concentration-fluorescence intensity standard curve is constructed, and the concentration of circRNA in the liquid to be tested can be read using the standard curve. The method provided by the present invention is to capture and detect circRNA by designing a capture probe that can specifically bind to the reverse splicing fragment of circRNA at the top of the tetrahedron, with high sensitivity, high specificity and low cost.

Description

Technical Field

[0001] The present invention relates to the field of nano-biosensing technology, and in particular to a method for detecting circular RNA based on microfluidics technology. Background Art

[0002] Circular RNA (circRNA) is a unique class of non-coding RNA molecules with a closed ring structure. circRNA plays an important role in various biological processes, including regulating gene expression and maintaining genome stability. In recent years, more and more studies have found that circRNA plays an important role in the occurrence and development of diseases. For example, abnormal expression of circRNA is closely related to cancer, neurodegenerative diseases, cardiovascular diseases and many other diseases. It is worth mentioning that some circRNAs are highly expressed in the plasma of patients and are considered to be able to be used as disease markers for in vitro detection.

[0003] However, the detection of circRNA is limited by the following factors. First, the abundance of circRNA in biological samples is low, so only highly sensitive detection methods can detect circRNA. Second, there are linear RNAs with the same base sequence as circRNA in biological samples, which poses a challenge to the specific detection of circRNA. The reason is that circRNA is generated in organisms by "backsplicing", while linear RNA in the body can generate products with the same sequence as circRNA through classical splicing (for detailed discussion, see the paper Nat. Rev. Genet. 2016, 17, 679-692). Third, the current method for detecting circular RNA is mainly RT-qPCR (reverse transcription-quantitative polymerase chain reaction), but this method is unreliable for the quantitative detection results of circRNA. Specifically, in the RT-qPCR method, reverse transcription using circRNA as a template will undergo rolling amplification. Studies have found that rolling amplification products account for 34-55% of the reverse transcription products, which destroys the linear relationship between circRNA and cDNA, and ultimately causes the RT-qPCR technology to overestimate the content of circRNA, that is, false positives.

[0004] Therefore, it is of great significance to develop an in vitro detection method for circular RNA with high sensitivity, high specificity and the ability to achieve quantitative detection. Summary of the invention

[0005] In order to solve the problems of low sensitivity, poor specificity, and false positives in the prior art, the present invention provides a method for detecting circular RNA based on microfluidics. The present invention first couples a DNA tetrahedron on the inner surface of a polydimethylsiloxane (PDMS) chip, and a capture probe that can specifically bind to the reverse splicing fragment of circRNA is provided at the top of the tetrahedron. The reverse splicing fragment is the most specific sequence on circRNA. When the test liquid is passed into the chip, the circRNA contained therein is captured by the capture probe. Afterwards, two DNA hairpin structures modified with fluorescein at the ends are passed into the chip to trigger a hybridization chain reaction (HCR) to achieve fluorescent labeling of circRNA. Afterwards, the fluorescence intensity of the chip is quantified using a fluorescence microscope.

[0006] The present invention provides a method for detecting circular RNA based on microfluidics technology, comprising the following steps:

[0007] A DNA tetrahedron is covalently modified on the surface of a microfluidic chip, wherein the top of the DNA tetrahedron carries a capture probe for circular RNA, and a test solution containing circular RNA is introduced into the microfluidic chip, and the circular RNA is captured by the DNA tetrahedron on the surface of the microfluidic chip;

[0008] A DNA hairpin structure with a fluorescein-modified end is introduced into the microfluidic chip, and the circular RNA captured on the microfluidic chip triggers a hybridization chain reaction, at which time the circular RNA is fluorescently labeled. The fluorescence intensity is then quantified, and a circular RNA concentration-fluorescence intensity standard curve is constructed. The concentration of circRNA in the test solution can be read using the standard curve.

[0009] Furthermore, the DNA tetrahedron is prepared from five DNA sequences shown by SEQ ID NO.2 to SEQ ID NO.6.

[0010] Furthermore, the DNA tetrahedron preparation process is: the five DNA sequences shown by SEQ ID NO.2 to SEQ ID NO.6 are mixed in 1×TM buffer in an equal molar ratio and annealed to obtain DNA tetrahedron.

[0011] Furthermore, the microfluidic chip is a PDMS microfluidic chip;

[0012] The mold of the PDMS microfluidic chip is provided with a "snake-shaped" channel and a "fishbone-shaped" recess.

[0013] Furthermore, the process of covalently modifying the DNA tetrahedron on the surface of the microfluidic chip is as follows: modifying the thiol group on the surface of the PDMS channel to obtain a PDMS microfluidic chip with the surface modified with thiol groups;

[0014] Incubating the DNA tetrahedron with a single-stranded DNA whose terminal is modified with a maleimide group for hybridization to obtain a DNA tetrahedron 2;

[0015] The single-stranded DNA sequence with maleimide group modified at the end is: CACAGTCTGACTAGCTTTTTTTTTT-Mal;

[0016] Then, the DNA tetrahedron 2 is introduced into a PDMS microfluidic chip whose surface is modified with thiol groups for incubation, and the thiol-maleimide reaction couples the DNA tetrahedron to the surface of the PDMS chip.

[0017] Furthermore, the fluorescein-modified DNA hairpin structure includes H1 with a nucleotide sequence as shown in SEQ ID NO.8 and H2 with a nucleotide sequence as shown in SEQ ID NO.9.

[0018] Furthermore, the process of establishing the circular RNA concentration-fluorescence intensity standard curve is as follows:

[0019] The target circular RNA is prepared into solutions of different concentrations, and then the solutions of different concentrations are respectively introduced into the PDMS microfluidic chip coupled with the DNA tetrahedron for incubation;

[0020] A fluorescein-modified DNA hairpin structure was prepared and introduced into a PDMS microfluidic chip for incubation to achieve fluorescent labeling of circular RNA. The average fluorescence intensity of regions containing the same number of fishbone structures was calculated, and the concentration of the circular RNA solution used and the total fluorescence intensity of the FITC channel were used as the horizontal and vertical axes to plot a circular RNA concentration-fluorescence intensity standard curve.

[0021] Furthermore, the circular RNA is circRNA circ_0061276 whose nucleotide sequence is shown in SEQ ID NO.1.

[0022] Furthermore, the circular RNA is prepared by phosphorylating the 5' end of the linear RNA shown in SEQ ID NO.1 and then subjecting it to a cyclization reaction under the action of 1×T4 RNA ligase.

[0023] Further, the fluorescence intensity was quantified using fluorescence microscopy.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. High sensitivity: The combination of microfluidics and HCR amplification technology can achieve high-sensitivity detection of circular RNA. The modified DNA tetrahedron on the microfluidics chip can capture circRNA during the flow of the sample to be tested, which is equivalent to concentrating the concentration of circRNA; the HCR signal amplification reaction stimulated by the circRNA captured on the chip surface can achieve the accumulation of fluorescent signals, ensuring the sensitivity of the detection;

[0026] 2. High specificity: By rationally designing the sequence of the capture probe on the DNA tetrahedron, that is, using the complementary sequence of the reverse spliced ​​fragment of circRNA as the capture probe, high-specificity capture of circRNA can be achieved, that is, only circRNA can form a stable base pairing with the capture probe, while its linear RNA analogue cannot. Therefore, only in the presence of circRNA can the hybridization chain reaction on the chip surface be triggered, and then a fluorescent signal is emitted; linear RNA analogues with the same base sequence as circRNA often exist in organisms. Through the above design, specific detection of circRNA can be achieved;

[0027] 3. No expensive equipment is involved: the manufacturing process of microfluidic chips is mature and the manufacturing cost is low. The cost of DNA synthesis is also low. The average manufacturing cost of a chip in the present invention is less than 0.5 yuan. The fluorescence microscope used in the present invention is a conventional biological laboratory instrument and is easily available.

[0028] 4. Small sample requirements: Since microfluidic chips only involve the use of tiny volumes of liquid (tens to hundreds of microliters), precious samples can be saved and experimental costs can be reduced;

[0029] 5. Quantitative analysis: Microfluidics combined with HCR technology can also realize quantitative analysis of circRNA; by using circRNA standards to establish a standard curve of circRNA concentration and fluorescence intensity, the abundance of circular RNA in real samples can be quantitatively measured, providing more accurate data for research. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 Schematic diagram of the method steps for detecting circular RNA using microfluidic technology of the present invention;

[0032] Figure 2A schematic diagram of the specific design of the capture probe on the DNA tetrahedron of the present invention;

[0033] Only circRNA can form stable base pairing with the capture probe, while linear RNA analogs cannot. Therefore, only in the presence of circRNA can the hybridization chain reaction on the chip surface be triggered, followed by the emission of fluorescent signals.

[0034] Only the sequence of the reverse splicing part of hsa_circ_0061276 is given in the figure to illustrate the specificity issue, because the reverse splicing part is the most specific part of each circRNA.

[0035] Figure 3 Simulated secondary structure diagram for hsa_circ_0061276;

[0036] Figure 4 Changes in the mobility of linear RNA and circular RNA (circRNA) and their reaction with RNase R;

[0037] In the figure, a is the mobility change before and after the linear RNA generates circular RNA through circularization reaction;

[0038] b shows the changes of linear RNA and circular RNA before and after reaction with RNase R.

[0039] Figure 5 Characterization of the synthesis of DNA tetrahedron;

[0040] In the figure, a, b, and c respectively demonstrate the successful synthesis of DNA tetrahedron using polyacrylamide gel electrophoresis, a particle size analyzer, and an atomic force scanning electron microscope.

[0041] Figure 6 Schematic diagram of the PDMS microfluidic chip mold;

[0042] In the figure, a is the overall appearance of the PDMS microfluidic chip mold;

[0043] b is a schematic diagram of the “snake-shaped” channel of the PDMS microfluidic chip mold;

[0044] c is a schematic diagram of the “fishbone-shaped” concave shape.

[0045] Figure 7 Schematic diagram of the process of modifying the surface of PDMS chip with DNA tetrahedron;

[0046] In the figure, a is a schematic diagram of DNA tetrahedron modification on the surface of PDMS chip;

[0047] The synthesized DNA tetrahedron is first incubated with a single-stranded DNA modified with a maleimide group (-Mal) at the end to hybridize, and then incubated in a PDMS chip modified with a thiol group (-SH) on the surface. The thiol-maleimide reaction couples the DNA tetrahedron to the surface of the PDMS chip.

[0048] b is a schematic diagram showing that the chip emits obvious fluorescence after the tetrahedron modified with Cy3 fluorescent dye at the end undergoes thiol-maleimide reaction and is observed under a confocal microscope;

[0049] c is a schematic diagram showing that as a control experiment, the DNA tetrahedron without thiol-maleimide reaction cannot be covalently modified on the PDMS surface, and confocal microscopy observation of the chip revealed that the Cy3 channel did not emit obvious fluorescence.

[0050] Figure 8 Design of two DNA hairpin structure sequences for HCR reaction; the underlined part is the complementary sequence.

[0051] Fig. 9 The effect of different concentrations of circRNA on fluorescence intensity after passing into the PDMS microfluidic chip;

[0052] In the figure, a is Figure 1 Typical confocal images after different concentrations of circRNA were introduced into the chip in the detection process shown;

[0053] b is the relationship between the total fluorescence intensity of the FITC channel and the concentration of circRNA;

[0054] c: In the concentration range of 0-200 nM, the total fluorescence intensity of the FITC channel is linearly related to the circRNA concentration. The fluorescence intensity was normalized.

[0055] Fig.10 The results of the specificity study of the target circular RNA (SEQ ID NO.1) detected by the method of the present invention are as follows;

[0056] In the figure, a is a schematic diagram of the principle of detecting circRNA;

[0057] b is a schematic diagram showing the principle that the introduction of linear RNA into the chip does not cause the chip to emit fluorescence;

[0058] c is the normalized fluorescence intensity after circRNA or linear RNA was introduced into the chip; the Blank group (i.e., control group) was only introduced with PBS. DETAILED DESCRIPTION

[0059] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0060] The present invention provides a method for detecting circular RNA based on microfluidics technology, the operation process is as follows Figure 1 As shown, the specific steps include:

[0061] (1) Synthesis of target circular RNA;

[0062] (2) Preparation of DNA tetrahedrons;

[0063] (3) Characterization of DNA tetrahedron;

[0064] (4) Design of PDMS microfluidic chip;

[0065] (5) Preparation of PDMS microfluidic chips;

[0066] (6) Surface modification of PDMS microfluidic chips;

[0067] (7) establishing a standard curve for detecting the fluorescence intensity-concentration of circular RNA;

[0068] (8) Verify the specificity of this detection method.

[0069] Working principle of the present invention: The present invention first covalently modifies DNA tetrahedrons on the surface of a microfluidic chip. The top of the DNA tetrahedron carries a capture probe for circRNA. Compared with directly modifying a single-stranded capture probe on the chip surface, using DNA tetrahedrons as a supporting skeleton to modify the capture probe on the chip surface can prevent the probe from falling over, which is more conducive to the probe capturing the target circRNA.

[0070] The test solution containing circRNA is introduced into the microfluidic chip, and the circRNA is captured by the DNA tetrahedron on the surface of the microfluidic chip.

[0071] Then, two DNA hairpin structures formed by annealing in advance and modified with fluorescein at the ends were introduced into the microfluidic chip, and the circRNA captured on the microfluidic chip triggered a hybridization chain reaction, at which time the fluorescent labeling of circRNA was achieved. Finally, the fluorescence intensity of the microfluidic chip was quantified using a fluorescence microscope, and a circRNA concentration-fluorescence intensity standard curve was constructed. The concentration of circRNA in the test solution can be read using the standard curve.

[0072] Example 1: A method for detecting circular RNA after modifying DNA tetrahedrons on the surface of a microfluidic chip.

[0073] 1. Experimental Methods

[0074] 1. Synthesis of target circular RNA

[0075] circRNA circ_0061276 in the blood can be used as a biomarker for gastric cancer. In this example, circRNA circ_0061276 was selected as a model for detection experiments.

[0076] The specific synthesis method of circRNA circ_0061276 in this embodiment is as follows:

[0077] First, the sequence of hsa_circ_0061276 was obtained from the circRNA database. The secondary structure was simulated by “RNA Folding Form (version 2.3energies)” in Mfold Web Server. The results are as follows Figure 3 According to the method in patent CN111321143A, we determined the truncation (Cut) site on this secondary structure, that is, we determined the linear RNA (L-RNA) (synthesized by Shanghai Shenggong Biological Co., Ltd.) whose nucleotide sequence needs to be synthesized as shown in SEQ ID NO.1. The 5' end of the L-RNA contains phosphorylation modification (to facilitate reaction with the hydroxyl group at the 3' end).

[0078] The 5' end contains phosphorylated L-RNA (SEQ ID NO. 1): 5'-phosphorylated-AGCUAUUUCAGAACUGUUCUCAGGACUCAUUAUUUUAACAUUUGGGAGAAACACAGCCAGAAGGAAGUGUUUGGAUUGUG-3'.

[0079] Then, L-RNA was circularized to obtain circRNA circ_0061276. The specific steps are as follows: L-RNA was dissolved in a buffer containing 1×T4 RNA ligase 2, and then annealed to fold the RNA. The annealing conditions were: placed at 80°C for 3 minutes, and then cooled to 25°C at a rate of 6°C / min. Then Rnl2 enzyme and RiboLock RNase inhibitor were added to the RNA solution to obtain a reaction mixture to start the reaction. A 100μL reaction mixture consists of 2μM L-RNA, 0.2U / μL Rnl2 enzyme, 2U / μL RiboLock RNase inhibitor, and 1×T4 RNA ligase 2 buffer. The reaction was carried out at 25°C for 2 hours and terminated by heating at 75°C for 10 minutes.

[0080] The reaction product was then electrophoresed in a 15% 1×TBE denaturing gel for 40 minutes (300 V). It was then stained with 1×SYBR Gold for 20 minutes and photographed using ChemiDoc (Bio-Rad). Figure 4 As shown in a. Compared with the reactants before the reaction, the mobility of the reaction product is significantly reduced, indicating that a ring structure is formed.

[0081] Then, the gel containing the circRNA product was cut out under ultraviolet light, and the circRNA product, namely the target circular RNA (circRNA circ_0061276), was recovered using a column PAGE gel DNA recovery kit.

[0082] In order to further prove that the synthesized target circular RNA has a circular structure, we reacted the target circular RNA with ribonuclease R (RNase R). As a control, we also reacted the linear RNA with RNase R. RNase R is a ribonuclease exonuclease that can digest all linear RNAs but is not easy to digest circRNA. The typical reaction mixture (50μL) includes 1μM RNA, 0.25U / μL RNase R, and 1× reaction buffer. The reaction mixture was then incubated at 37°C for 30 minutes, followed by 15% 1×TBE denaturing gel electrophoresis. The results are shown in Figure 2. Figure 4 As shown in b. Linear RNA was degraded after reaction with RNase R, while the circRNA product did not undergo significant changes after reaction with RNase R, proving that the product of the cyclization reaction has a circular structure, that is, the cyclization reaction is successful.

[0083] 2. Preparation of DNA Tetrahedron

[0084] First, each DNA single strand of the five DNA sequences (shown in SEQ ID NO.2-SEQ ID NO.6) constituting the DNA tetrahedron was dissolved in ultrapure water, and then the UV absorbance of the DNA single strand solution at 260 nm was measured by UV-visible spectrophotometer to calculate the actual concentration of each DNA single strand solution, and then the concentration of each DNA single strand constituting the tetrahedron was accurately quantified to 100 μmol / L, and then each DNA single strand solution was mixed in 1×TM buffer (10 mM Tris-HCl, pH 8.0, 50 mM MgCl2) in an equimolar ratio, and the final concentration of each DNA single strand was 1 μmol / L. After mixing evenly, it was placed in a PCR instrument and kept at 95°C for 10 minutes according to the set program, and then quickly cooled and kept at 4°C for 25 minutes to obtain a DNA tetrahedron nanostructure (referred to as DNA tetrahedron) with a concentration of 1 μmol / L, and characterized by polyacrylamide gel electrophoresis, a particle size analyzer and an atomic force microscope (AFM) ( Figure 5 ), and the remaining DNA tetrahedrons were stored at 4°C for future use.

[0085] SEQ ID NO.2:

[0086] GCTAGTCAGACTGTGGCCTGGAGATACATGCACATTACGGCTTTCCCTATTAGAAGGTCTCAGGTGCGCGTTTCGGTAAGTAGACGGGACCAGTTCGCC;

[0087] SEQ ID NO.3:

[0088] GCTAGTCAGACTGTGCGCGCACCTGAGACCTTCTAATAGGGTTTGCGACAGTCGTTCAACTAGAATGCCCTTTGGGCTGTTCCGGGTGTGGCTCGTCGG;

[0089] SEQ ID NO.4:

[0090] GCTAGTCAGACTGTGGGCCGAGGACTCCGTCTCCGCTGCGGTTTGGCGAACTGGTCCCGTCTACTTACCGTTTCCGACGAGCCACACCCGGAACAGCCC;

[0091] SEQ ID NO.5:

[0092] ACACTTCCTTCTGGTTTGCCGTAATGTGCATGTATCTCCAGGCTTTCCGCAGCGGAGAC; (the underlined part is the capture probe for circRNA)

[0093] SEQ ID NO.6:

[0094] GGAGTCCTCGGCCTTTGGGCATTCTAGTTGAACGACTGTCGC.

[0095] 3. Design of PDMS microfluidic chip mold

[0096] (1) This embodiment designs a PDMS microfluidic chip mold containing a "snake-shaped" channel and a "fishbone-shaped" concave (see Figure 6 ), the channel depth is 80μm, the width is 500μm, and the "fishbone shape" is concave 50μm. This design allows the fluid in it to fully contact the inner wall of the channel. The mold is made using SU-8 negative photolithography.

[0097] (2) Preparation of PDMS microfluidic chip

[0098] The PDMS microfluidic chip mold was placed in a culture dish, and the PDMS monomer and curing agent in the SYLGARD 184 Silicone Elastomer Kit (Article No. H047M67030) purchased from DOW EUROPE GMBH, Germany, were mixed in a mass ratio of 9:1, poured on the mold, and then the culture dish was placed horizontally in a vacuum dryer to remove all bubbles by vacuuming, and then cured at 70°C for 1 hour. Then the cured PDMS was peeled off from the mold, holes were punched at the inlet and outlet positions marked on the mold, cut neatly, and scotch tape was used to remove impurities on the PDMS surface several times to obtain a single-layer PDMS. The single-layer PDMS was bonded to another single-layer PDMS with a flat surface after being treated with an oxygen plasma cleaner (Diener electronic, Germany) for permanent sealing to form a complete PDMS chip with a sealed channel, completing the preparation of the microfluidic chip.

[0099] (3) Surface modification of PDMS microfluidic chips

[0100] 20 μL of 2% (V / V) 3-methoxymercaptopropylsilane (McLean) solution prepared in anhydrous ethanol was quickly introduced into the prepared PDMS chip, and the reaction was carried out at room temperature for 0.5 h. After that, the chip was washed with anhydrous ethanol and phosphate buffered saline (PBS) for 3 times respectively, and the thiol group was successfully modified on the surface of the PDMS channel, and a PDMS chip with thiol (-SH) surface modification was obtained.

[0101] The previously synthesized DNA tetrahedron was incubated in advance with a single-stranded DNA (sequence shown in SEQ ID NO. 7) whose terminal was modified with a maleimide group (-Mal) to allow them to hybridize, thereby obtaining a DNA tetrahedron 2.

[0102] SEQ ID NO. 7: CACAGTCTGACTAGCTTTTTTTTT.

[0103] The sequence of the single-stranded DNA containing a maleimide group (-Mal) is: CACAGTCTGACTAGCTTTTTTTTTT-Mal.

[0104] Then, the DNA tetrahedron 2 solution (0.1 μmol / L, 20 μL) was passed into the PDMS microfluidic chip with thiol (-SH) surface modified and incubated for 1 h. The thiol-maleimide reaction allowed the DNA tetrahedron to couple to the PDMS chip surface (see Figure 7 ). To this end, we conducted a control experiment and found that DNA tetrahedrons without maleimide group modification could not be modified on the PDMS chip ( Figure 7 c). In order to reduce non-specific adsorption sites on the surface of the PDMS chip, 1% BSA solution was added and incubated at 37°C for 2 h for blocking, and then rinsed with PBS.

[0105] (4) Establishing a standard curve for detecting circular RNA concentration-fluorescence intensity

[0106] First, two DNA hairpin structures were prepared in advance. The two DNA hairpin structures were prepared using H1 and H2 with fluorescein 6-FAM terminal modification.

[0107] The specific preparation process of the DNA hairpin structure is as follows:

[0108] Select a segment from the target circular RNA sequence ( Figure 8 ) was used as the initiator of HCR, and the DNA sequences of two hairpin structures H1 and H2 were designed. Then, the DNAs of H1 and H2 with fluorescein 6-FAM modified at the ends were ordered from Shanghai Sangon Biotechnology Co., Ltd., and then the DNAs of H1 and H2 were dissolved in PBS respectively to prepare a 1μM H1 DNA solution (100μL) and a 1μM H2 DNA solution (100μL). Annealing was then performed, that is, the two solutions were heated to 95°C respectively, and then slowly cooled to room temperature, thus forming two hairpin structures. Before annealing, H1 and H2 were disordered structures, and after annealing, H1 and H2 were hairpin structures. The design process of the sequences of the two DNA hairpin structures can be found in. Figure 8 .

[0109] The sequence of H1 is shown in SEQ ID NO.8, and the sequence of H2 is shown in SEQ ID NO.9;

[0110] SEQ ID NO.8:

[0111] 5'

[0112] 6-FAM-TGTTCTCAGGACTCATTATGAATCTAATGAGTCCTGAGAACAGTTCTG;

[0113] SEQ ID NO.9:

[0114] 5'

[0115] 6-FAM-GATTCATAATGAGTCCTGAGAACACAGAACTGTTCCAGGACTCA TTA.

[0116] Then, the target circular RNA (CircRNA) prepared in advance was dissolved in PBS to obtain solutions of different concentrations (0, 50, 100, 150, 200, 500, 1000, 2000 pM). 0.2 mL of the solutions of different concentrations were respectively introduced into the PDMS microfluidic chip coupled with the DNA tetrahedron and reacted at room temperature for half an hour.

[0117] 100 μL of the 1 μM H1 hairpin solution and 100 μL of the 1 μM H2 hairpin solution prepared above were mixed and passed into the PDMS microfluidic chip. The HCR reaction was allowed to occur at room temperature for 1 hour, and then the chip was washed with PBS (200 μL). This achieved the fluorescent labeling of circular RNA. The chip was then observed using a confocal fluorescence microscope (Nikon Ti2-E). The average fluorescence intensity of the area containing the same number of fishbone structures was then calculated using ImageJ software.

[0118] (5) Verification of the specificity of this detection method

[0119] According to our design, only circRNA can be captured by the DNA tetrahedron on the chip, and then trigger HCR and emit fluorescence, while linear RNA cannot be captured, and thus cannot trigger HCR or emit fluorescence signals, thus ensuring the specificity of the detection. Therefore, linear RNA (sequence shown in SEQ ID NO.1) was used as the control group to verify the specificity of the method of the present invention.

[0120] 2. Experimental Results

[0121] 1. Synthesis of target circular RNA

[0122] A linear RNA with a nucleotide sequence as shown in SEQ ID NO.1 and phosphorylated at its 5' end was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and then cyclized by Rnl2 enzyme reaction to obtain the target circular RNA (circRNA).

[0123] 2. Characterization of DNA Tetrahedron

[0124] Polyacrylamide gel electrophoresis characterization: Similar to the method for preparing DNA tetrahedrons, equimolar amounts of different sequences were mixed and annealed to prepare three DNA self-assemblies (1μM, 50μL) as a control group. The first is to mix SEQ ID NO.2 with SEQID NO.3. The second is to mix SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4. The third is to mix SEQID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5. The synthesized DNA tetrahedral nanostructure was characterized by polyacrylamide gel electrophoresis. Use 1×TBE buffer to prepare 8% polyacrylamide gel, absorb 5μL of DNA tetrahedral nanostructure and its control group DNA self-assembly, add 1μL 6×DNA loading buffer respectively, mix well and then load. The electrophoresis analysis was carried out in 1×TBE buffer at room temperature, electrophoresed at a constant voltage of 85V for 150min, and then photographed using a gel imaging system. The results are shown in the following figure. Figure 5 As shown in a, as the number of DNA chains in the assembly increases, the mobility of the bands on gel electrophoresis decreases continuously, that is, the distance the bands run becomes shorter and shorter, indicating that the structural molecular weight of the assembly becomes larger and larger, which proves the successful assembly of the DNA tetrahedron.

[0125] Particle sizer characterization: The prepared 1 μM DNA tetrahedron solution was diluted to 300 nM with PBS and detected by a particle sizer (Nano ZS, Malvern). It was found that the hydrated diameter of the DNA tetrahedron was about 13 nm (see Figure 5 b).

[0126] Atomic force microscopy characterization: 10 μL of 10 nM DNA tetrahedron solution prepared with TM buffer and DNA tetrahedron was added to the surface of a freshly uncovered clean mica sheet. After adsorption for 10 min, the surface of the mica sheet was rinsed three times with TM buffer and gently blown dry under nitrogen (N2). Then 50 μL of TM buffer was added to the surface of the mica sheet, and the TDN sample was scanned and imaged using an atomic force microscope (Dimension Icon, Bruker) in tapping mode (see Figure 5 c).

[0127] 3. Detect whether the DNA tetrahedron is successfully coupled to the chip surface

[0128] In order to verify that the DNA tetrahedrons can be successfully coupled to the chip surface, a group of DNA tetrahedrons modified with Cy3 fluorescent dye at the end were introduced into the PDMS chip channel after thiol-maleimide reaction. The chip was observed under a confocal microscope and emitted obvious fluorescence (see Figure 7 b); At the same time, a control experiment was conducted by passing a DNA tetrahedron without a maleimide group into the channel of the PDMS chip and observing the chip under a confocal microscope. It was found that the Cy3 channel emitted almost no fluorescence (see Figure 7 c), indicating that the DNA tetrahedron can only be firmly coupled to the chip surface through the thiol-maleimide reaction.

[0129] 4. Establish a standard curve of fluorescence intensity-concentration for detecting circular RNA

[0130] Confocal microscopy revealed that as the concentration of the introduced circRNA increased, the fluorescence intensity of the FITC channel of the chip continued to increase (see Fig. 9 a); the concentration of the circRNA solution used and the total fluorescence intensity of the FITC channel were used as the horizontal and vertical axes to plot the standard curve (see Fig. 9 The results of b) showed that in the concentration range of 0-200 nM, the total fluorescence intensity of the FITC channel was linearly related to the circRNA concentration, which was consistent with the formula Normalized FI = 0.0037*[circRNA] + 0.008 (R2 = 0.99872) (see Fig. 9 c). The detection limit was found to be 10 pM.

[0131] 5. Verify the specificity of this detection method

[0132] Experiments have shown that when linear RNA is introduced into the chip and then the DNA hairpin structure is introduced, there is no obvious fluorescence signal. In contrast, the circRNA group can give a clear fluorescence signal ( Fig.10 c). This indicates that the detection method of the present invention exhibits good specificity for circRNA detection.

[0133] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0134] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for detecting circular RNA based on microfluidics technology, characterized in that: The steps include: A DNA tetrahedron is covalently modified on the surface of a microfluidic chip, wherein the top of the DNA tetrahedron carries a capture probe that specifically binds to the reverse spliced ​​fragment of the circular RNA, and a test solution containing the circular RNA is introduced into the microfluidic chip, and the circular RNA is captured by the DNA tetrahedron on the surface of the microfluidic chip; Two DNA hairpin structures H1 and H2 with fluorescein modified at the ends are introduced into the microfluidic chip. The captured circular RNA on the microfluidic chip triggers a hybridization chain reaction, at which point the circular RNA is fluorescently labeled. The fluorescence intensity is then quantified, and a circular RNA concentration-fluorescence intensity standard curve is constructed. The concentration of circRNA in the test solution can be read using the standard curve. The method for detecting circular RNA based on microfluidics technology is used in the field of non-disease diagnosis.

2. The method for detecting circular RNA based on microfluidic technology according to claim 1, characterized in that: The DNA tetrahedron is prepared from five DNA sequences shown by SEQ ID NO.2 to SEQ ID NO.

6.

3. The method for detecting circular RNA based on microfluidic technology according to claim 2, characterized in that: The DNA tetrahedron preparation process is as follows: the five DNA sequences shown in SEQ ID NO.2 to SEQ ID NO.6 are mixed in 1×TM buffer at an equal molar ratio and PCR is performed to obtain the DNA tetrahedron.

4. The method for detecting circular RNA based on microfluidic technology according to claim 3, characterized in that: The microfluidic chip is a PDMS microfluidic chip; The mold of the PDMS microfluidic chip is provided with a serpentine channel and a fishbone-shaped recess.

5. The method for detecting circular RNA based on microfluidics technology according to claim 4, characterized in that: The process of covalently modifying the DNA tetrahedron on the surface of the microfluidic chip is as follows: modifying the thiol group on the surface of the PDMS channel to obtain a PDMS microfluidic chip with the surface modified with thiol groups; Incubating the DNA tetrahedron with a single-stranded DNA whose terminal is modified with a maleimide group for hybridization to obtain a DNA tetrahedron 2; The single-stranded DNA sequence with maleimide group modified at the end is: CACAGTCTGACTAGCTTTTTTTTTT-Mal; Then, the DNA tetrahedron 2 is introduced into a PDMS microfluidic chip whose surface is modified with thiol groups for incubation, and the thiol-maleimide reaction couples the DNA tetrahedron to the surface of the PDMS chip.

6. The method for detecting circular RNA based on microfluidics technology according to claim 5, characterized in that: The fluorescein-modified DNA hairpin structure is H1 with a nucleotide sequence as shown in SEQ ID NO.8 and H2 with a nucleotide sequence as shown in SEQ ID NO.

9.

7. The method for detecting circular RNA based on microfluidics technology according to claim 6, characterized in that: The process of establishing the circular RNA concentration-fluorescence intensity standard curve is as follows: The target circular RNA is prepared into solutions of different concentrations, and then the solutions of different concentrations are respectively introduced into the PDMS microfluidic chip coupled with the DNA tetrahedron for incubation; A fluorescein-modified DNA hairpin structure was prepared and introduced into a PDMS microfluidic chip for incubation to achieve fluorescent labeling of circular RNA. The average fluorescence intensity of regions containing the same number of fishbone structures was calculated, and the concentration of the circular RNA solution used and the total fluorescence intensity of the FITC channel were used as the horizontal and vertical axes to plot a circular RNA concentration-fluorescence intensity standard curve.

8. The method for detecting circular RNA based on microfluidics according to claim 7, characterized in that: The circular RNA is circRNA circ_0061276 with a nucleotide sequence as shown in SEQ ID NO.

1.

9. The method for detecting circular RNA based on microfluidics technology according to claim 8, characterized in that: The circular RNA is prepared by phosphorylating the 5' end of the linear RNA shown in SEQ ID NO.1 and then performing a circularization reaction in a buffer of 1×T4 RNA ligase 2.

10. The method for detecting circular RNA based on microfluidics technology according to claim 7, characterized in that: Fluorescence intensity was quantified using fluorescence microscopy.

Images