Application of MSX1 in anti-HBV

Abstract

The present invention relates to a new medicinal use of myotome homeobox gene 1 (MSX1), which is a new host restriction factor of hepatitis B virus. MSX1 competes with HNF4α for binding to MRE, specifically binding to MRE through the HO domain, resulting in reduced HNF4α enrichment on MRE, thereby inhibiting EnII / Cp activity and viral cccDNA transcription; MSX1 expression is negatively correlated with HBV gene expression and replication in patients; in vivo experiments show that human MSX1 can inhibit Cp activity at the viral subgenome and / or whole genome level, AAV-mediated human MSX1 overexpression reduces HBV gene expression and viral genome replication, and the disappearance of rcccDNA or BPS in the liver reflects nearly 40%-50% of mouse HBV cure. The above-mentioned MSX1 can be used as a drug target for the treatment of hepatitis B virus infection and is used to develop new types of anti-hepatitis B virus drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and biomedicine, and relates to a new use of muscle segment homeobox gene 1 (MSX1), specifically to the use of MSX1 in resisting hepatitis B virus. Background Art

[0002] Chronic hepatitis B virus (HBV) infection (CHB) remains a serious public health problem worldwide and is a risk factor for the development of liver fibrosis, cirrhosis, and hepatocellular carcinoma (HCC), resulting in approximately 900,000 HBV-related deaths each year.

[0003] HBV is an enveloped virus containing partially double-stranded relaxed circular DNA (rcDNA). After entering the hepatocyte, the viral rcDNA is transported to the nucleus and converted into covalently closed circular DNA (cccDNA). cccDNA is the only transcription template for all viral mRNAs, and viral transcription is driven by four viral promoters, namely the enhancer II / core protein (HBc) promoter (EnII / Cp), surface protein promoters 1 and 2 (Sp1 and Sp2), and enhancer I / X protein (HBx) promoter (EnI / Xp), which produce 3.5, 2.4, 2.1, and 0.7 kb of RNA, respectively. The 3.5 kb pregenomic (pg) RNA serves as a translation template for the polymerase (Pol) and HBc, and can also bind to Pol to initiate viral replication within the capsid formed by HBc, while the 3.5 kb preC RNA serves as a translation template for secreted e antigen (HBeAg). The 2.4 / 2.1 and 0.7 kb RNAs encode large / medium / small surface antigens (L / M / SHBsAg) and HBx, respectively. As a template for viral transcription, cccDNA plays a key role in the persistence of HBV. The interaction between transcription factors and cis-elements can affect the activity of the promoter and thus the level of viral RNA production. Therefore, the identification of transcription factors not only provides a new perspective for studying the molecular mechanism of transcription initiation, but also helps to discover new antiviral targets.

[0004] The natural course of HBV infection can be divided into four time stages according to different viral and host immune states: immune tolerance (IT), immune activity (IA), inactive inactivity (IC), and HBeAg-negative hepatitis (ENH). The IT stage is characterized by the presence of HBeAg, very high levels of HBV DNA (>10 7 IU / ml), with mild or no hepatic necroinflammation reflected by normal-low alanine aminotransferase (ALT) levels. Stage IA is characterized by the presence of HBeAg, high levels of HBV DNA (10 4 ~107 IU / ml), moderate or severe inflammation of the liver (hepatitis) with elevated ALT levels. Patients in the IT stage for several years may enter the IA stage, and patients infected in adulthood enter the IA stage more frequently and / or more rapidly. The immune microenvironment of the liver in stage IA has been shown to play an important role in controlling HBV dissemination and replication, such as clearance of HBV-infected hepatocytes by cytotoxic T lymphocyte (CTL) responses. However, whether the intracellular environment of hepatocytes is involved in the regulation of HBV has not been fully elucidated.

[0005] Muscle segment homeobox gene 1 (MSX1) is a member of the MSX transcription family and plays a key role in differentiation and development by interacting with components of the core transcription complex to repress host gene expression. Although the homeobox (HO) domain is a specific DNA sequence that MSX1 recognizes and binds to promoters, it has also been observed that MSX1-mediated transcriptional repression can be independent of the HO domain; it is of great interest to understand the mechanisms by which MSX1 represses gene expression in different modes. In addition, MSX1 has been shown to be essential in regulating the innate immune response against RNA viruses, such as Sendai virus (SeV) and vesicular stomatitis virus (VSV), but its mechanism of action against other RNA viruses and DNA viruses is less well understood. Summary of the invention

[0006] In order to overcome at least one problem existing in the prior art, the present invention innovatively discovered that intrahepatic MSX1 is a new host restriction factor of HBV, and observed that the expression level of intrahepatic MSX1 in patients in the immune active stage was much higher than that in patients in the immune tolerant stage, which may explain the importance of MSX1 in regulating HBV activity at different stages of the natural course of hepatitis B; in two HBV persistent mouse models, the present invention, based on gene therapy, overexpression of MSX1 confirmed the important role of MSX1 in HBV gene expression and genome replication in vivo, and determined that MSX1 can be used as a therapeutic target for the treatment of CHB.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention is to provide a gene for resisting hepatitis B virus infection or a protein encoded thereby, wherein the gene is the intrahepatic MSX1 gene, and the protein is the MSX1 protein encoded by the intrahepatic MSX1 gene.

[0009] The second aspect of the present invention is to provide an application of MSX1, which is selected from at least one of the following applications: application as a host restriction factor of hepatitis B virus, application as a drug target for treating hepatitis B virus infection, application in the preparation of anti-hepatitis B virus drugs, and application in the preparation of drugs for treating hepatitis B virus infection. The above-mentioned hepatitis B virus infection can be specifically chronic hepatitis B virus infection.

[0010] Furthermore, the drug is selected from one of the following: a drug using MSX1 protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; a drug used to overexpress MSX1 in the liver or increase the expression level of MSX1 in the liver.

[0011] Furthermore, the biological material includes a recombinant vector and a recombinant cell line containing the MSX1 gene.

[0012] Furthermore, the recombinant vector includes but is not limited to: a recombinant pCMC plasmid expressing MSX1, a recombinant pCDH plasmid expressing MSX1, a recombinant serum type 8 adeno-associated virus expressing MSX1, and a lentivirus expressing MSX1.

[0013] Furthermore, the MSX1 is human MSX1, and its Gene ID is 4487, and it may also be MSX1 of other mammals, wherein the open reading frame (ORF) sequence similarity between MSX1 of other mammals and human MSX1 is above 85%, such as 88%, 90%, 94%, etc., and other mammals include mice, rabbits, etc.

[0014] Furthermore, the gene sequence of human MSX1 (SEQ ID NO.1) constructed into the above biomaterial is as follows: aggccccggctgctgacatgacttctttgccactcggtgtcaaagtggaggactccgccttcggcaagccggcggggggaggcgcgggccaggcccccagcgccgccgcggccacggcagccgccatgggcgcggacgaggagggggccaagcccaaagtgtccccttcgctcctgcccttcagcgtggaggcgctcatggccgaccacaggaagccgggggccaaggagagcgccctggcgccctccgagggcgtgcaggcggcgggtggctcggcgcagccactgggcgtcccgccggggtcgctgggagccccggacgcgccctcttcgccgcggccgctcggccatttctcggtggggggactcctcaagctgccagaagatgcgctcgtcaaagccgagagccccgagaagcccgagaggaccccgtggatgcagagcccccgcttctccccgccgccggccaggcggctgagccccccagcctgcaccctccgcaaacacaagacgaaccgtaagccgcggacgcccttcaccaccgcgcagctgctggcgctggagcgcaagttccgccagaagcagtacctgtccatcgccgagcgcgcggagttctccagctcgctcagcctcactgagacgcaggtgaagatatggttccagaaccgccgcgccaaggcaaagagactacaagaggcagagctggagaagctgaagatggccgccaagcccatgctgccaccggctgccttcggcctctccttccctctcggcggccccgcagctgtagcggccgcggcgggtgcctcgctctacggtgcctctggccccttccagcgcgccgcgctgcctgtggcgcccgtgggactctacacggcccatgtgggctacagcatgtaccacctgaca。

[0015] Furthermore, the open reading frame of human MSX1 was cloned into pCMC plasmid or pCDH plasmid, respectively, to obtain recombinant pCMC plasmid or recombinant pCDH plasmid expressing MSX1.

[0016] Furthermore, the recombinant cell line contains a recombinant pCDH plasmid expressing MSX1, and the preparation step includes: co-transfecting the recombinant pCDH plasmid and auxiliary plasmids psPAX2 and pMD2 into HEK293T cells using polyethyleneimine (PEI) at a ratio of 4:3:1. Other suitable cell lines in the art can also be used.

[0017] It is understandable that the MSX1 gene can be cloned into other plasmids other than the plasmids listed above, or into other vector viruses other than the vector viruses listed above through genetic engineering methods; the above-mentioned MSX1 expression plasmid or MSX1 expression adeno-associated virus (or MSX1 expression lentivirus) or the purified MSX1 protein prepared after overexpression in the cell line can be used to infect hepatocytes (HepG2, PHH, Huh7, Hepa1-6, AML12, HepAD38, etc.) or be administered by appropriate methods (for example, injection by tail vein high-pressure hydrodynamic method) to HBV animal models (BPS mouse model, rcccDNA mouse model, etc.) as an anti-HBV intervention method.

[0018] Furthermore, in the above application, the drug is a drug that inhibits hepatitis B virus gene expression and genome replication.

[0019] Furthermore, the drug is a drug that inhibits EnII / Cp activity and viral cccDNA transcription.

[0020] Further, in the drug, MSX1 exerts its effects through the following mechanism: MSX1 competes with hepatocyte nuclear factor 4α (HNF4α) for binding to the MSX1 cis-response element (MRE), which binds to the MRE through the HO domain, resulting in a reduction in the enrichment of HNF4α on the MRE, thereby inhibiting the activity of the enhancer II / core protein (HBc) promoter (EnII / Cp) and viral cccDNA transcription. Specifically, MSX1 binds to the MRE through an amino acid fragment of aa 218 to 260 in the HO domain.

[0021] Furthermore, the individual infected with the hepatitis B virus is a mammal, including but not limited to: human, mouse, etc.

[0022] Furthermore, the hepatitis B virus is of genotype B and genotype C.

[0023] In one embodiment, 2×10 11Genome-equivalent recombinant adeno-associated virus type 8 expressing MSX1 (AAV-MSX1-Flag) was injected into the HBV animal model via the tail vein with 200 μl PBS. MSX1 reduced Cp activity, and injection of AAV-MSX1-Flag could reduce serum HBsAg and HBeAg more rapidly. MSX1-induced HBsAg clearance was not associated with the appearance of HBsAb, and reduced the levels of markers such as HBV replication (core-associated DNA), rcccDNA, and viral capsid. Some mice injected with AAV-MSX1-Flag cleared HBsAg and intrahepatic rcccDNA / BPSDNA, which can achieve HBV cure.

[0024] The third aspect of the present invention is to provide a drug inhibitor of hepatitis B virus, the active ingredient of which comprises MSX1 protein, or its encoding gene, or a biological material containing its encoding gene.

[0025] Furthermore, the biomaterial is any biomaterial as described in the second aspect of the present invention.

[0026] Furthermore, the drug inhibitor also includes a pharmaceutically acceptable carrier.

[0027] Furthermore, the dosage form of the drug inhibitor includes any one of tablets, capsules, granules, oral preparations, and injections.

[0028] It is understood that the type and amount of the selected carrier are also adaptively adjusted based on the different dosage forms and administration methods of the drug inhibitor. "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the drug inhibitor of the present invention and with each other without significantly reducing the efficacy of the drug inhibitor.

[0029] Compared with the prior art, the present invention adopts the above technical solution to have the following beneficial effects:

[0030] The present invention first discovered that the intrahepatic myometrial homeobox gene 1 (MSX1) is a new host restriction factor for HBV gene expression and replication. The present invention first revealed that MSX1 inhibits the transcription of hepatitis B virus genes and revealed another hepatocyte nuclear factor 4α (HNF4α)-mediated cccDNA transcription regulation mechanism that is independent of expression levels.

[0031] In HBV-transfected and uninfected systems, MSX1 effectively inhibits HBV gene expression and genome replication. The mechanism of action study found that MSX1 downregulates the activity of enhancer II / core protein promoter (EnII / Cp) by directly binding to the MSX1 cis-response element (MRE). Specifically, the MSX1-mediated inhibition of Cp activity is due to the competition between MSX1 and HNF4α for binding to MRE, resulting in reduced HNF4α enrichment on MRE, thereby inhibiting EnII / Cp activity and viral cccDNA transcription. Clinical data (liver biopsy specimen analysis) showed that compared with the immune tolerance period (IT), the expression level of MSX1 in the liver of CHB patients in the immune active period (IA) was higher, but the levels of serum and intrahepatic HBV markers were relatively low, and MSX1 expression was negatively correlated with HBV gene expression and replication in patients. Finally, the present invention evaluated the antiviral effect mediated by MSX1 in two HBV persistence mouse models, proving that MSX1 is a promising therapeutic target for CHB treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0033] Figure 1 This is a schematic diagram of the results of MSX1 inhibiting HBV gene expression and genome replication in Huh7 cells in one embodiment of the present invention;

[0034] Figure 2 This is a schematic diagram of the effect of MSX1 overexpression or knockdown on cell viability in one embodiment of the present invention;

[0035] Figure 3 This is a schematic diagram of the results of MSX1 inhibiting HBV gene expression and genome replication in HBV-infected HepG2-NTCP cells in one embodiment of the present invention;

[0036] Figure 4 This is a schematic diagram of the results of MSX1 inhibiting HBV gene expression and genome replication in HBV-infected PHH cells in one embodiment of the present invention;

[0037] Figure 5 This is a schematic diagram of the results of MSX1 inhibiting the activities of the EnII / Cp promoter and enhancer in one embodiment of the present invention;

[0038] Figure 6 This is a schematic diagram of the result of downregulating the activity of EnII / Cp by binding to the MSX1 cis-response element (MRE) in EnII / Cp in one embodiment of the present invention;

[0039] Figure 7 This is a schematic diagram of the result that MSX1 recruits MRE in EnII / Cp on rcccDNA in one embodiment of the present invention;

[0040] Figure 8 This is a schematic diagram of the result of MSX1 being recruited to cccDNA in an infection system in one embodiment of the present invention;

[0041] Fig. 9 This is a schematic diagram of the results of competition between MSX1 and HNF4α for binding to MRE in one embodiment of the present invention;

[0042] Fig.10 This is a schematic diagram of the results of in vitro detection of the expression of exogenous MSX1 and HNF4α in one embodiment of the present invention;

[0043] Fig.11 This is a schematic diagram of the results of the correlation analysis between the expression of MSX1 in the liver and the activity of hepatitis B virus in immune tolerance (IT) and immune activity (IA) patients in one embodiment of the present invention;

[0044] Fig.12 This is a schematic diagram showing the results of reducing Cp activity in mouse liver cancer cells by overexpression of human MSX1 in one embodiment of the present invention;

[0045] Fig.13 This is a schematic diagram of the results of reducing Cp activity in mice by overexpression of human MSX1 in one embodiment of the present invention;

[0046] Fig.14 This is a schematic diagram of the effect of overexpression of human MSX1 on the rcccDNA-based mouse HBV persistence model in one embodiment of the present invention;

[0047] Fig.15 This is a schematic diagram of the results of the effect of human MSX1 overexpression on the BPS-based HBV persistence mouse model in one embodiment of the present invention. DETAILED DESCRIPTION

[0048] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the scope of protection of the present invention. The experimental methods without specific conditions in the following embodiments are usually measured according to national standards. The experimental materials without the source indicated in the following embodiments are all commercially available raw materials. The equipment used in each step in the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, all parts are weight parts and all percentages are mass percentages. Unless otherwise defined or specified, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of the present invention.

[0049] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention is further described below in conjunction with the drawings and specific embodiments, but is not intended to be a limitation of the present invention.

[0050] In the following examples, the cell cultures used in the experiments include: (1) human hepatocellular carcinoma cell lines (Huh7 and HepG2), mouse hepatocellular carcinoma cell lines (Hepa1-6 and AML12), hepatoma cells (HepAD38) with the whole HBV genome (genotype D) inserted, and human embryonic kidney 293T cells (HEK293T) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 2 mM L-glutamine, 50 U / ml penicillin, and 10% fetal bovine serum (all from Invitrogen, China); (2) 2.5% dimethyl sulfoxide (DMSO) (Sigma, China) and 2 μg / ml puromycin (Invitrogen, China) were added to HepG2 cells stably transfected with HBV receptor NTCP (HepG2-NTCP); (3) primary human hepatocytes (PHH) were cultured according to the prior art (Schulze-Bergkamen H et al. Primary human 596 hepatocytes-avaluable tool for investigation of apoptosis and hepatitis B virus infection. Journal of Hepatology. 2003; 38(6):736-44.).

[0051] In the following examples, the plasmids used in the experiment include: (1) the open reading frames (ORFs) of human MSX1 (Gene ID 4487) and HNF4α (Gene ID 3172) were cloned upstream of the Flag tag of pCMC-C-Flag (pCtrl) (Beyotime, China) to obtain plasmids pMSX1-Flag and pHNF4α-Flag, respectively; (2) the BPS plasmid containing a 1.3-fold overlength HBV genome (GenBank accession number: AF100309.1), a plasmid carrying a recombinant cccDNA precursor (prcccDNA) and a Cre recombinase overexpression plasmid (pCMC-Cre) were prepared with reference to the prior art (Qi ZH et al. Recombinant Covalently Closed Circular Hepatitis B Virus DNA Induces Prolonged Viral Persistence in Immunocompetent Mice. Journal of Virology.2014;88(14):8045-56.); (3) HBV enhancer / promoter luciferase reporter plasmid was prepared according to the prior art (Shen ZL et al. High mobility group AT-hook 1 (HMGA1) is an important positive regulator of hepatitis B virus (HBV) that is reciprocally upregulated by HBV X protein. Nucleic Acids Research.2022;50(4):2157-71.); (4) a Cp reporter plasmid containing the nucleotide sequence of nt-399 to +36 (relative to preC) was constructed, and its sequence deletion mutant plasmid (see Figure 6Part A of: p-399 / +36 contains EnII / Cp (Cp, nt-171 to +36) and upstream negative regulatory element (nt-172 to -399) sequences, numbers indicate nucleotide positions relative to the first nucleotide of PreC, and the eliminated nucleotide sequence is highlighted by a dotted line) was generated by using a site-directed mutagenesis kit (TOYOBO, Japan); the first nucleotide of each ORF was numbered as +1, and its immediate upstream nucleotide was -1; the EnII / Cp fragment was also inserted downstream of the polyA signal of pSp1, pSp2, and pXp in the same direction as the upstream promoter to generate pSp1-Cp, pSp2-Cp, and pXp-Cp, respectively. Transfection was performed using TurboFect transfection reagent (Thermo, China) according to the manufacturer's instructions, and promoter activity was detected using the dual-luciferase reporter assay system (Promega).

[0052] In the following examples, the viruses used in the experiment and the infection steps thereof include: (1) in order to prepare a lentivirus for mediating MSX1 overexpression, the Flag-tagged MSX1 was inserted into pCDH (System Biosciences) to generate a packaging plasmid pCDH-MSX1-Flag; when preparing a lentivirus for mediating MSX1 gene knockdown, a DNA fragment encoding MSX1 short hairpin RNA was inserted into pLKO.1 (pshCtrl, Addgene, USA) to generate a packaging plasmid pLKO.1-shMSX1 (pshMSX1), and the target sequence of RNA interference was 'cccgagaggaccccggggatgcaga'; then the respective packaging plasmids were co-transfected into HEK293T cells with auxiliary plasmids psPAX2 and pMD2 (Addgene, USA) at a ratio of 4:3:1 using polyethyleneimine (PEI, Sigma, China); 6 hours after transfection, the culture medium was replaced with fresh culture medium, and 3 days later, the virus-containing supernatant was collected and cultured through 0.45μ m filter, used to infect HepG2-NTCP and PHH cells; (2) For HBV infection, the supernatant of HepAD38 cells was concentrated to obtain HBV virus particles, and then quantified using a commercial quantification kit (Adicon, China); the HBV infection multiple of HepG2-NTCP and PHH cells was 1000:1 (MOI); 12 h after infection, the cells were washed with 1x phosphate buffered saline (PBS), and fresh culture medium was replaced every 1-2 days; (3) Recombinant serotype 8 adeno-associated virus expressing Flag-tagged human MSX1 (AAV-MSX1-Flag) and its control virus (AAV-Ctrl) were purchased from Han Biotechnology Co., Ltd., China; (4) Recombinant human adenovirus serotype 5 containing recombinant cccDNA precursor (Adv / prcccDNA) was prepared according to the prior art (Li et al., 2014). GY et al. Recombinant covalently closedcircular DNA of hepatitis B virus induces long-term viral persistence withchronic hepatitis in a mouse model.Hepatology.2018;67(1):56-70.)

[0053] In the following examples, the analytical methods used in the experiments were all based on the prior art, including: (1) Western blot analysis: total cell lysates were prepared from cultured cells and mouse liver tissue using SDS lysis buffer (Beyotime, China); the nuclear and cytoplasmic fractions were prepared using a nuclear and cytoplasmic protein extraction kit (Beyotime, China); protein expression levels were evaluated using Western blot; (2) HBV antigen and nucleic acid analysis: HBsAg, HBeAg and HBsAg antibody (HBsAb) were detected using an ELISA kit (Kehua, China); total cellular RNA, HBV core-related DNA and nuclear DNA, and extrachromosomal nuclear DNA containing cccDNA were extracted according to conventional methods; in Northern blot, 10 μg of RNA was electrophoresed in 1.5% agarose containing 2.2 mol / L formaldehyde and transferred to a positively charged nylon membrane (Roche, Germany); in Southern In the blot, DNA samples were electrophoresed in 1% agarose and transferred to a nylon membrane; the two membranes were hybridized with a DIG-labeled full-length HBV probe, and the signal was developed using a DIG luminescent detection kit (Roche, Germany); (3) Real-time fluorescence quantitative PCR detection of mRNA and HBV cccDNA: For the quantification of mRNA, total cellular RNA was reverse transcribed to generate cDNA using the PrimeScriptRT kit (TaKaRa, China); cDNA and HBV cccDNA were quantified by real-time PCR using the SYBR Premix Ex Taq II kit (TaKaRa, China); (4) Immunofluorescence (IF) and chromatin immunoprecipitation (ChIP): IF assays performed on cultured cells were based on prior art (Shen ZL et al. Unimpaired immunogenicity of yeast expressed hepatitis B surface antigen stored at elevated temperatures. Acta Bioch Bioph Sin. 2016; 48(12): 1094-100.); according to the manufacturer's instructions, the HBV cccDNA was detected using a PCR amplification kit (Sigma-Aldrich, Germany). ChIP assay was performed using Plus Enzymatic Chromatin IPKit (#9005, Cell Signaling Technology); (5) Cell viability, in vitro protein translation, and chemical composition: Cell counting kit-8 (CCK8, Dojindo, Japan) was used to assess cell viability according to the manufacturer's instructions, and in vitro translated MSX1 was prepared using the TnT7 Quick Coupled Transcription / Translation System (Promega); the compound cycloheximide (CHX) was purchased from Shanghai Topscience, China; (6) DNA in vitro binding (DNA-pulldown) and co-immunoprecipitation assay: For DNA-pulldown experiments, nuclear extracts of Huh7 cells or in vitro translated MSX1 protein were mixed with streptavidin-coupled Dynabeads (Thermo, China) and biotinylated double-stranded DNA probes (Genwiz, China) in binding solution buffer (Beyotime, China); after incubation at 4°C with rotation for 6 h, the cells were washed with PBST (PBS + 0.1% Tween-20) for 5 times, then mixed in SDS lysis buffer, heated at 100°C for 10 minutes, and subjected to Western blot; co-immunoprecipitation assays were performed using conventional methods using the above antibodies for Western blot.

[0054] In the following examples, the antibodies used in the experiments include: anti-Flag (1:10000) and anti-β-actin (1:10000) from Sigma; anti-MSX1 (1:3000, #4787S) and anti-HNF4α (1:3000, C11F12) from Cell Signaling Technology; anti-Lamin A / C (1:3000, A0249) and anti-ANXA1 (1:3000, A1118) from ABclonal; anti-HBc (1:10000, Denmark) from DAKO; and mouse anti-HBx mAb 2A7 (1:1000).

[0055] In the following examples, the primer sequence information used in the qPCR and PCR detection experiments includes:

[0056]

[0057] The technical solution of the present invention is exemplarily described below in conjunction with the embodiments and drawings.

[0058] Example 1 - Mechanism of action of MSX1 against hepatitis B virus

[0059] This example further studies the anti-HBV mechanism of MSX1, which includes the following experimental steps:

[0060] (I) MSX1 inhibits HBV gene expression and genome replication in recombinant cccDNA (rcccDNA) transfection and HBV infection systems

[0061] (1) The effect of MSX1 on HBV gene expression and genome replication was investigated using a previously established recombinant cccDNA (rcccDNA) system. In the rcccDNA system, rcccDNA is produced by transfection of a precursor rcccDNA (prcccDNA) plasmid through Cre-mediated recombination and is highly similar to wild-type cccDNA except for a small foreign intron that is removed by splicing after transcription. Huh7 cells cultured in 6-well plates were transfected with 1 μg of prcccDNA and 1 μg of pCMV-Cre, plus 1 μg of pMSX1-Flag or its control plasmid (pCtrl) (A) or pshMSX1 or pshCtrl (B). On the third day after transfection, Northern blot and Southern blot were used to detect intracellular HBV RNA, core-related DNA and rcccDNA, respectively. Western blot was used to detect exogenous and endogenous MSX1 using Flag and MSX1 antibodies, respectively. Western blotting and ELISA were used to detect intracellular viral proteins (HBc and HBx) and secreted antigens (HBsAg and HBeAg), respectively.

[0062] In hepatoma Huh7 cells transfected with prcccDNA and a Cre-expressing plasmid (pCMV-Cre), co-transfection with a Flag-tagged MSX1-expressing plasmid (pMSX1-Flag) significantly reduced the intracellular HBV transcripts (3.5 kb and 2.4 / 2.1 kb RNA), replication intermediates (core-associated DNA), viral proteins (HBx and HBc), and secreted viral antigens (HBsAg and HBeAg) (e.g. Figure 1 A), but exogenous MSX1 did not affect rcccDNA levels (e.g. Figure 1 Knockdown of endogenous MSX1 expression by co-transfection with a short hairpin RNA expression plasmid targeting MSX1 (pshMSX1) significantly increased HBV gene expression and genome replication without affecting rcccDNA levels (as shown in Figure 5A). Figure 1 (as shown in Part B of FIG.

[0063] In addition, cell viability assays were performed. Huh7 and HepG2 cells cultured in 96-well plates were transfected with a predetermined amount of pMSX1-Flag (AB) or pshMSX1 (CD) or left untreated. Cell viability was measured using CCK-8 on days 1, 2, 3, and 4 after transfection, and the results showed that MSX1-mediated HBV inhibition was not due to cytotoxic effects ( Figure 2 ).

[0064] (2) To further verify the inhibitory effect of MSX1 on HBV infection, HBV-infected HepG2-NTCP cells were transfected with lentivirus expressing MSX1-flag or shMSX1. HepG2-NTCP cells were infected overnight at an MOI of 1000 geq / cell. The medium was replaced the next day, and on the second day, lentivirus expressing MSX1-Flag or control virus (Lenti-MSX1-Flag or Lenti-Ctrl) were used to transfect HBV-infected HepG2-NTCP cells. Figure 3 Part A) or lentivirus expressing shMSX1 or control virus (Lenti-shMSX1 or Lenti-shCtrl) ( Figure 3 On the 7th day, Northern blot / Southern blot and qRT-PCR were used to detect intracellular HBV RNA, core-related DNA and cccDNA, respectively; Western blot was used to detect exogenous and endogenous MSX1 with Flag and MSX1 antibodies, respectively; Western blotting and ELISA were used to detect intracellular viral proteins (HBc and HBx) and secreted antigens (HBsAg and HBeAg), respectively. The test results are shown in Figure 3 As shown, MSX1 expression levels were significantly negatively correlated with HBV transcription, viral replication, and antigen production.

[0065] The PHH system was also validated in HBV infection. PHH cells were infected overnight at an MOI of 1000 genome equivalents (geq) / cell, and the medium was changed the next day. On day 5, PHH cells were transfected with lentivirus expressing MSX1-Flag or control virus (Lenti-MSX1-Flag or Lenti-Ctrl) ( Figure 4 Part A) or lentivirus expressing shMSX1 or control virus (Lenti-shMSX1 or Lenti-shCtrl) ( Figure 4 On the 4th day after lentiviral infection, qRT-PCR and Southern blot were used to detect intracellular HBV RNA, cccDNA and core-related DNA, and ELISA was used to detect secreted antigens (HBsAg and HBeAg). The test results are shown in Figure 4As shown in the results, MSX1 expression level was significantly negatively correlated with HBV transcription, viral replication and antigen production.

[0066] The above experimental results and data indicate that MSX1 is a new HBV host restriction factor.

[0067] (ii) MSX1 downregulates EnII / Cp activity by directly binding to the MSX1 cis-response element (MRE) in EnII / Cp

[0068] (1) MSX1-induced significant reduction in HBV transcripts (e.g. Figure 1-4 The results show that it is likely to be involved in HBV regulation at the transcriptional level. To verify this hypothesis, the present example used a dual luciferase reporter assay to evaluate the effect of MSX1 on the activity of HBV promoters (Cp, Sp1, Sp2, and Xp).

[0069] Figure 5 Part A of the Figure shows a schematic diagram of the HBV enhancer / promoter firefly luciferase reporter plasmid; the numbers indicate the nucleotide position relative to the first nucleotide of the corresponding ORF. EII / Cp was cloned into Sp1, Sp2, and Xp reporter plasmids downstream of the ployA signal in the same orientation as the upstream promoter to test its enhancer activity. 0.4 μg of Cp, Sp1, Sp2, or Xp reporter plasmids were cotransfected with 0.4 μg of pMSX1-Flag or pCtrl, 0.1 μg of pRL-TK into Huh7 ( Figure 5 Part B) and HepG2( Figure 5 48 hours after transfection, cells were lysed and subjected to dual luciferase reporter assay. Figure 5 D) and HepG2( Figure 5 (Part E) In cells co-transfected with or without pMSX1-Flag, the activities of Sp1, Sp2, and Xp, which are located downstream of EnII / Cp, were similar.

[0070] like Figure 5 As shown in the AC parts of Figure 3, in liver cancer Huh7 and HepG2 cells, overexpression of MSX1 only downregulated Cp activity, but had no effect on the other three promoters. To determine whether the MSX1-induced reduction in Cp activity had any effect on other HBV promoters, the Cp sequence was inserted downstream of the polyA of the Sp1, Sp2, and Xp-driven luciferase reporter plasmids in the same orientation as its upstream promoter ( Figure 5 Part A of the Figure 5 As shown in the DE section, although Cp enhanced the activity of the respective distal HBV promoter in Huh7 and HepG2 cells, the level of enhancement was much lower in the case of MSX1 overexpression.

[0071] (2) To verify the molecular mechanism of MSX1-induced reduction of Cp activity, the EnII / Cp sequence (nt-171 to +36) and the upstream negative regulatory element (NRE, nt-172 to -399) were cloned upstream of the firefly luciferase reporter gene to generate the reporter gene plasmid p-399 / +36. A series of deletion mutants were constructed based on p-399 / +36 (see Figure 6 Huh7 cells cultured in 24-well plates were co-transfected with 0.4 μg p-399 / +36 or its deletion mutants, 0.4 μg pMSX-Flag or pCtrl ( Figure 6 Part B), 0.4 μg pshMSX1 or pshCtrl ( Figure 6 C), 0.1 μg pRL-TK. 48 h after transfection, the relative promoter activity was determined by dual luciferase reporter gene assay. Immunofluorescence analysis of exogenous MSX1-Flag ( Figure 6 D) and endogenous MSX1 ( Figure 6 The intracellular distribution of the protein was investigated by Western blot. Figure 6 The nucleus and cytoplasm were marked by laminin A / C and annexin A1 (ANXA1), respectively. Figure 6 As shown in the H part, biotinylated MRE (Cp -171 to -147) and randomly synthesized control probe (Ctrl probe) were used for DNA binding assay in vitro. Chemically synthesized probes were transfected with pMSX1-Flag ( Figure 6 I) or untreated Huh7 cells (S1 and S2) ( Figure 6 J part) or in vitro translated MSX1 ( Figure 6 Nuclear protein extracts from the K fraction of the 100 μg / ml lysate were incubated with streptavidin-coupled beads. After washing, the beads were heated and subjected to Western blot.

[0072] Dual-luciferase reporter assays performed on Huh7 cells revealed that MSX1-mediated Cp activity was only observed when a nucleotide fragment spanning nt-171 to nt-147 (25 bp, termed the MSX1 cis-responsive element (MRE)) was present under conditions of MSX1 overexpression or knockdown ( Figure 6 Immunofluorescence and nuclear / cytoplasmic fractionation assays showed that exogenously and endogenously expressed MSX1 was localized in the cytoplasm and nucleus ( Figure 6The physical association between MSX1 and MRE was then analyzed using nuclear extracts and a double-stranded DNA probe in vitro binding assay (DNA pull-down) ( Figure 6 H section). Figure 6 As shown in Figure 1J, the biotinylated MRE probe, but not the randomly synthesized control probe (Ctrl probe), can effectively bind to exogenous and endogenous MSX1 and activate the in vitro translated MSX1 ( Figure 6 of the K section).

[0073] At the same time, verification at the whole genome level of HBV was carried out. Huh7 cells cultured in 6-well plates were transfected with 1μg of prcccDNA or MRE-deficient prcccDNA (prcccDNA (delMRE)), 1μg of Pcmv-Cre, 1μg of pMSX1-Flag or pCtrl. On the third day after transfection, cells were subjected to ChIP detection, and rcccDNA and rcccDNA (delMRE) were immunoprecipitated with Flag antibody, MSX1 antibody or normal control IgG for Southern blot. Western blot was used to detect exogenous MSX1 antibody immunoprecipitated with Flag antibody. The immunoprecipitated rcccDNA and rcccDNA (delMRE) signals were scanned using Image J software, and the rcccDNA signal was normalized to 100%. The detection results are shown in the figure. Figure 7 As shown, chromatin immunoprecipitation (ChIP) and Southern blot confirmed that both exogenous and endogenous MSX1 were recruited to rcccDNA ( Figure 7 Furthermore, the occupancy of MSX1 on wild-type rcccDNA was much higher than that on rcccDNA with MRE deletion (rcccDNA(delMRE)), indicating that MRE is required for MSX1 to bind to rcccDNA ( Figure 7 Part B of the

[0074] In addition, ChIP assays were also performed in HBV-infected HepG2-NTCP and PHH cells, and cccDNA immunoprecipitated with MSX1 antibody or normal control IgG was quantified in qRT-PCR, and the results also showed that MSX1 had a certain occupancy on cccDNA ( Figure 8 ). The above experimental results show that the direct binding of MSX1 to MRE in EnII / Cp leads to a significant decrease in the activity of the EnII / Cp promoter and enhancer.

[0075] (III) MSX1 competes with hepatocyte nuclear factor 4α (HNF4α) for binding to MRE

[0076] Although the above research results show that MSX1 binding to MRE (MSX1-MRE) is closely related to the significant decrease in Cp activity (e.g. Figures 6 to 8 However, the molecular mechanism of the association between MSX1-MRE and Cp activity needs further investigation.

[0077] (1) Based on nucleotide sequence alignment, the inventors found that the MRE (nt-171 to -147) almost overlaps with the previously reported Boxα sequence (nt-168 to -146), which contains C / EBP and HNF4α binding sites ( Fig. 9 Figure 1. Part A, the binding sites of CEB / P and HNF4 are also shown in Box α, and the numbers indicate the nucleotide positions relative to the first nucleotide of PreC).

[0078] Huh7 cells were transfected with pMSX1-Flag or pCtrl. Fig. 9 Part B) and HEK293T ( Fig. 9 C) cells; On the second day after transfection, the expression of MSX1-Flag and HNF4α were detected by Western blot using Flag antibody and HNF4α antibody, respectively. Huh7 ( Fig.10 Part A) and HEK293T ( Fig.10 On the second day after transfection, exogenous MSX1 and HNF4α were detected by Western blot using Flag antibody. Huh7 ( Fig. 9 D and F) and HEK293T ( Fig. 9 E and G of the cells were co-transfected with 0.4 μg of Cp reporter plasmid p-399 / +36 (relative to PreC -399 to +36) or pdel-171 / -47 (deletion of -171 to -47 in p-399 / +36), 0.4 μg of pMSX-Flag or pCtrl, 0.4 μg of Flag-tagged plasmid expressing HNF4α (pHNF4α-Flag) or pCtrl, and 0.1 μg of pRL-TK. 48 hours after transfection, the promoter activity was measured by the dual luciferase reporter gene method. Fig. 9 As shown in the H section of Figure 2, Huh7 cells were transfected with pMSX1-Flag or pCtrl. The physiological interaction between MSX1-Flag and HNF4α was analyzed by Co-IP, followed by Western blot. Fig. 9 I part) or pMSX1(del218-260) ( Fig. 9Nuclear proteins were extracted from Huh7 cells (L fraction) and then incubated with MRE probe and streptavidin-coupled beads. After washing, the beads were heated and subjected to Western blot. Laminin A / C and annexin A1 (ANXA1) were used as markers for the nuclear and cytoplasmic fractions, respectively. Fig. 9 The J part is a schematic diagram of pMSX1-Flag and its sequence deletion mutants. The deleted regions in MSX1 are highlighted with dotted lines, and the numbers indicate the positions of amino acids. Western blot and dual luciferase reporter gene assays were used to analyze the expression of wild-type and mutant MSX1 ( Fig. 9 J part) in Huh7 cells and its activity against Cp(p-399 / +36) Fig. 9 The impact of the K part).

[0079] HNF4α is an important nuclear transcription factor involved in upregulating Cp activity. HNF4α is expressed in Huh7 cells but not in HEK293T cells, and its expression level does not change when MSX1 is overexpressed ( Fig. 9 BC section). Next, the effect of MSX1 on Cp activity in the presence or absence of HNF4α was compared in the two cell lines mentioned above. Transfection of MSX1 alone reduced Cp activity in Huh7 cells but not in HEK293T cells, whereas transfection of HNF4α alone upregulated Cp activity in both cell lines. Interestingly, HNF4α-mediated Cp activation was significantly impaired by co-transfection of MSX1 ( Fig. 9 The DE part, Fig.10 However, MRE-deficient Cp(pdel-171 / -147) was unresponsive to MSX1 and / or HNF4α (co)transfection in both cell lines ( Fig. 9 The above experimental data indicate that the reduction of Cp activity induced by MSX1-MRE is likely due to the functional impairment of HNF4α in hepatocytes.

[0080] (2) To clarify the association between MSX1-MRE and HNF4α, co-immunoprecipitation experiments showed no interaction between MSX1 and HNF4α ( Fig. 9 H part), which raises another possibility that the MSX1-MRE interaction reduces the enrichment level of HNF4α at MRE because MRE contains the binding site of HNF4α. To prove this, nuclear proteins were first extracted from Huh7 cells pre-transfected with increasing amounts of pMSX1-Flag, and then DNA probe binding assays were performed in vitro. Fig. 9As shown in Part I, exogenous MSX1 reduced the occupancy of HNF4α on the MRE probe in a dose-dependent manner. Next, we constructed a MSX1 sequence deletion mutant based on pMSX1-Flag and verified it by Western blot ( Fig. 9 Dual-luciferase reporter assays revealed that the amino acid segment spanning aa 218 to 260 is part of the internal HO domain of MSX1 and is essential for MSX1-mediated inhibition of Cp activity ( Fig. 9 Finally, MSX1 with aa 218-260 deleted (del218-260) did not occupy the MRE and did not affect the enrichment of HNF4α ( Fig. 9 In summary, MSX1 binds to MRE via its HO domain, resulting in reduced HNF4α enrichment at MRE, thereby inhibiting Cp activity and cccDNA transcription.

[0081] Example 2- Correlation analysis between MSX1 expression in the liver and HBV activity in patients in the immune tolerance phase (IT) and immune active phase (IA)

[0082] This example analyzes the correlation between the expression of MSX1 in the liver of IT and IA patients and the activity of HBV, and includes the following steps:

[0083] (1) Patient samples

[0084] A total of 58 CHB patients were recruited, of which 22 were in IT stage and 36 were in IA stage. The clinical and virological characteristics of the patients are shown in the table below. The above study was approved by the Ethics Committee of Huashan Hospital, and written informed consent was obtained from all subjects.

[0085]

[0086] *Expressed as X±SD

[0087] (2) Results Analysis

[0088] like Fig.11 In part A of the study, liver biopsy samples were collected from patients with IT and IA stages in a previous study. Liver biopsy was performed on all patients, and the samples were subjected to microarray analysis using Affymetrix Human Genome U133 Plus 2.0Array for RNA extraction and chip analysis. The level of MSX1 mRNA in the liver is presented as a scatter plot. Anti-MSX1 antibody (1:1000, Cat.NO: A18295, ABclonal) ( Fig.11 Part B) and HBc (1:500) ( Fig.11(C) Immunohistochemical analysis of paraffin-fixed liver biopsy specimens was performed to detect the expression of MSX1 and HBc in the liver, and representative images are given ( Fig.11 Caseviewer 2.0 was used to calculate H-SCORE from images collected by Pannoramic P250 (3DHISTECH, Hungary) to show relative protein expression levels.

[0089] The results showed that when CHB patients entered the IA stage from the IT stage, both the intrahepatic inflammatory response and serum HBV DNA decreased. Although the inflammatory response has been shown to help control HBV, the role of host genes in hepatocytes in viral regulation has not been widely explored. Previous studies collected liver biopsies from patients in the IT and IA stages, extracted RNA, and then performed microarray analysis. Compared with patients in the IT stage, patients in the IA stage had lower serum HBV DNA loads and significantly increased ALT levels; Fig.11 As shown in Part A of Figure 2, microarray analysis showed that the intrahepatic MSX1 mRNA level was significantly increased in stage IA. Immunohistochemistry (IHC) staining was used to analyze the intrahepatic MSX1 and HBc protein expression levels; compared with stage IT, patients in stage IA had higher MSX1 expression and relatively lower HBc expression ( Fig.11 The BD part of the cell nucleus), the distribution and expression of HBc in the cell nucleus are related to the level of HBV replication in the cell. The above experimental data show that MSX1 expression is negatively correlated with HBV gene expression and replication in patients.

[0090] Example 3 - Therapeutic Effects of Overexpressed Human MSX1 Delivered by Adeno-Associated Virus in a Mouse Model of HBV Persistence

[0091] This example validates the therapeutic effect of Flag-tagged overexpressed human MSX1 delivered by adeno-associated virus (AAV-MSX1-Flag) in a mouse model of HBV persistence. Comparison of the open reading frame (ORF) sequences of human MSX1 (Gene ID 4487) and mouse MSX1 (Gene ID 17701) identified only 19 amino acid differences, with a similarity of nearly 94% (284 / 303) (see the table below).

[0092] Location 6 22 29 34 41 45 55 56 79 81 82 86 93 95 98 99 140 141 273 Human MSX1 D G A S A A S P A A P V A P V P P E G Mouse MSX1 A A V G T T P A V V A A V H T R L D S

[0093] Based on this, it is necessary to further verify whether human MSX1 can also inhibit HBV at the viral subgenome and / or whole genome level in mouse hepatocytes, which includes the following experimental steps:

[0094] (1) Construction of experimental animal models

[0095] Male BALB / c and C57BL / 6 mice aged 6-8 weeks were purchased from Shanghai Slac Laboratory Animal Co., Ltd. Male C57BL / 6 mice transgenic for liver-specific Cre recombinase (Cre Tg C57BL / 6) aged 6-8 weeks were referred to (Li GY et al. Recombinant covalently closed 621circular DNA of hepatitis B virus induces long-term viral persistence with chronic hepatitis in a mouse 622model. Hepatology. 2018; 67(1): 56-70.). Mouse experiments were approved by the Animal Ethics Committee of the School of Basic Medicine, School of Medicine, Fudan University.

[0096] To construct rcccDNA-based persistent mice, Cre Tg C57BL / 6 mice were injected via the tail vein with 1.5 × 10 9 geq Adv / prcccDNA. To construct BPS-based persister mice, BALB / c mice were injected with 10 μg of BPS replicon plasmid by the HDI method. Mice whose serum HBV antigen remained positive 4 weeks after injection of Adv / prcccDNA or BPS were considered to have rcccDNA or BPS persistence.

[0097] (2) Experimental methods

[0098] To determine the effect of human MSX1 on Cp activity in liver cancer cells, Hepa1-6 and AML12 cells cultured in 24-well plates were co-transfected with 0.4 μg pCp, 0.4 μg pMSX1-Flag or pCtrl, and 0.1 μg pRL-TK Renilla luciferase plasmids. 48 h after transfection, Cp activity was determined by dual luciferase reporter assay and Western blot. To determine the effect of human MSX1 virus on Cp activity in vivo, 2×10 AAV-MSX1-Flag or its control virus (AAV-Ctrl) were added. 11 The genome equivalent (geq) was injected into C57BL / 6 mice via the tail vein in 200 μl PBS. On the 7th day after AAV injection, mice were injected with 2 μg pCp and 0.5 μg pRL-TK via tail vein hydrodynamic injection (HDI). On the 2nd day after plasmid injection, mice were killed by carbon dioxide and liver tissues were collected. The dual luciferase reporter assay and Western blot were used to measure liver Cp activity, respectively.

[0099] To investigate whether human MSX1 has therapeutic effects on chronic hepatitis B, rcccDNA-persistent mice were injected with 2×10 11 Geq-conjugated AAV-MSX1-Flag or AAV-Ctrl, and serum and liver tissues were collected from mice by retro-orbital sinus bleeding and carbon dioxide treatment at the indicated time points. Fig.14 As shown in Part A, C57BL / 6 transgenic mice were injected with adenovirus carrying the precursor plasmid (Adv / prcccDNA) via the tail vein. Mice that were serum HBV antigen positive 4 weeks after injection were used as rcccDNA persistent mice, and then injected with 2×10 AAV-MSX1-Flag (n=6) or control virus AAV-Ctrl (n=6). 11 Genome equal amount (gep), serum was collected at the indicated time points. 10 weeks after AAV injection (wpi), mice were killed and liver tissues were obtained. Serum HBsAg, HBsAb, and HBeAg were detected by ELISA. Southern blot and PCR were used to analyze HBV core-related DNA and rcccDNA in liver tissue at 10w.pi, respectively, and native agarose gel electrophoresis and Western blot were used to analyze capsid levels, and serum HBsAg was shown. Agarose electrophoresis was used to check the amplicon size of the PCR reaction mixture.

[0100] To investigate whether human MSX1 has therapeutic effects on chronic hepatitis B, HBV-persistent mice were injected with 2×10 11 Geq-conjugated AAV-MSX1-Flag or AAV-Ctrl, and serum and liver tissues were collected from mice by retro-orbital sinus bleeding and carbon dioxide treatment at the indicated time points. Fig.15 As shown in part A of the present invention, 10 μg of BPS replicon plasmid was injected into the tail vein by HDI method, and 4 weeks later, the mice with positive serum HBV antigen were injected with AAV-MSX1-Flag or AAV-Ctrl. Mice with positive serum HBV antigen were injected with 2×10 AAV-MSX1-Flag (n=6) or AAV-Ctrl (n=6). 11 Genome equivalent (geq), serum was collected at the indicated time points; 10 weeks after AAV injection (wpi), mice were killed and liver tissues were obtained. Serum HBsAg, HBsAb, and HBeAg were detected by ELISA; HBV core-related DNA and BPS replicon plasmid in liver tissue were analyzed by Southern blot, capsid levels were analyzed by native agarose gel electrophoresis, and serum HBsAg was analyzed by Western blot.

[0101] (3) Results analysis

[0102] Dual luciferase reporter assay and Western blot were performed on mouse hepatoma cells (Hepa1-6 and AML12) to determine the effect of human MSX1 on Cp activity. Fig.12 As shown, exogenously expressed human MSX1 significantly reduced Cp activity. Based on the in vitro experiments, C57BL / 6 mice pre-injected with AAV-MSX1-Flag or control virus (AAV-Ctrl) were injected with Cp reporter plasmid via tail vein; on the second day after plasmid injection, mice were killed and liver tissues were collected ( Fig.13 The results are as follows Fig.13 As shown in Part B, Cp activity in the liver of mice injected with AAV-MSX1-Flag was much lower than that of mice injected with AAV-Ctrl. The above experimental data indicate that human MSX1 can inhibit HBV at the viral subgenomic level in mouse hepatocytes.

[0103] To investigate whether human MSX1 can regulate HBV gene expression and genome replication in vivo, a previously established rcccDNA-based mouse HBV persistence model was used for validation ( Fig.14 Part A of the Fig.14 As shown in parts B and D of Figure 3, injection of AAV-MSX1-Flag resulted in a more rapid reduction in serum HBsAg and HBeAg compared with AAV-Ctrl injection, and HBsAg and HBeAg were undetectable in 2 of 6 mice injected with AAV-MSX1-Flag at 10 weeks post-injection (wpi), whereas both viral markers remained high in all mice injected with AAV-Ctrl (n=6). In addition, MSX1-induced HBsAg clearance was not associated with the appearance of HBsAb ( Fig.14 At 10 w.pi, mice were sacrificed and liver tissues were collected for analysis of HBV replication (core-associated DNA), rcccDNA, and viral capsid. In mice injected with AAV-MSX1-Flag, the levels of all viral markers tested were generally lower than those in mice injected with AAV-Ctrl ( Fig.14 Notably, 2 of 6 mice injected with AAV-MSX1-Flag cleared HBsAg and rcccDNA in the liver ( Fig.14 E part of the study), demonstrating HBV cure.

[0104] In parallel, the effect of MSX1 on HBV replication was evaluated in another mouse model of HBV persistence based on a single injection of an HBV replicative plasmid (termed BPS). Mice with serum HBV antigen positive after 4 weeks were injected with AAV-MSX1-Flag or AAV-Ctrl ( Fig.15 Part A of the Fig.15 As shown in the BD part of Figure 2, the serum HBsAg and HBeAg levels of mice injected with AAV-MSX1-Flag (n=6) were lower than those of mice injected with AAV-Ctrl (n=6). At 10 w.pi, 3 of 6 mice injected with AAV-MSX1-Flag cleared serum and intrahepatic HBV markers, especially BPSDNA in the liver ( Fig.15 E), but none of the mice injected with AAV-Ctrl cleared serum and hepatic HBV markers ( Fig.15 E part of the study), demonstrating HBV cure.

[0105] The experimental results of this example confirm the important role of MSX1 in HBV gene expression and genome replication in vivo, and determine that MSX1 can be used as a therapeutic target for the treatment of CHB.

[0106] As can be seen from the above examples, the present invention reports for the first time that MSX1 inhibits the transcription of viral genes, and verifies that MSX1 inhibits the expression and replication of HBV genes mainly by reducing the level of viral RNA transcripts in the replicon transfection and viral infection systems. Specifically, MSX1 downregulates the promoter and enhancer activity of EnII / Cp by directly binding to the MSX1 cis-response element (MRE). It competes with HNF4α for binding to MRE through the HO domain, resulting in a reduction in the enrichment of HNF4α on MRE in Cp, thereby reducing the activity of Cp and cccDNA transcription, which reveals a new HNF4α-mediated cccDNA transcription regulation mechanism that is independent of expression levels. The study found that the expression level of MSX1 (mRNA and protein) in the liver was negatively correlated with the expression level of HBV genes and genome replication between the IT stage and the IA stage. The increase in MSX1 expression is likely to be involved in the inhibition of HBV and is associated with HBV-related pathogenesis. In vivo efficacy studies have shown that human MSX1 can inhibit Cp activity at the viral subgenomic and / or whole genome levels, AAV-mediated human MSX1 overexpression reduces HBV gene expression and viral genome replication, and more importantly, the disappearance of rcccDNA or BPS in the liver reflects nearly 40%-50% of mouse HBV cure. In summary, the intrahepatic host gene MSX1 is a new HBV restriction factor and is associated with the progression of the natural history of HBV, which can provide a theoretical basis and guidance for the future clinical treatment of chronic hepatitis B.

[0107] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Use of MSX1 in the preparation of an anti-hepatitis B virus drug, characterized in that: The MSX1 is human MSX1, its Gene ID number is 4487, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug is a drug that uses MSX1 protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; wherein the biological material is selected from one of the following: a recombinant pCMC plasmid expressing MSX1, a recombinant pCDH plasmid expressing MSX1, a recombinant serum type 8 adeno-associated virus expressing MSX1, and a lentivirus expressing MSX1.

3. The use according to claim 2, characterized in that: The drug contains a recombinant serotype 8 adeno-associated virus expressing human MSX1.

4. A drug inhibitor of hepatitis B virus, characterized in that: The active ingredient of the drug inhibitor comprises MSX1 protein, or its encoding gene, or a biological material containing its encoding gene; wherein the biological material is selected from one of the following: a recombinant pCMC plasmid expressing MSX1, a recombinant pCDH plasmid expressing MSX1, a recombinant serum type 8 adeno-associated virus expressing MSX1, and a lentivirus expressing MSX1; the MSX1 is human MSX1, whose Gene ID number is 4487, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.

1.

5. The drug inhibitor according to claim 4, characterized in that The drug inhibitor also includes a pharmaceutically acceptable carrier.

6. The drug inhibitor according to claim 4, characterized in that The dosage form of the drug inhibitor includes any one of tablets, capsules and granules.

7. The drug inhibitor according to claim 4, characterized in that The dosage form of the drug inhibitor includes any one of an oral preparation and an injection.

Images