Genetic markers associated with boron efficiency traits in Brassica napus and their application

Abstract

The invention discloses a genetic marker associated with the boron efficiency trait of Brassica napus and its application, wherein the genetic marker includes a T>A base mutation at the 11722450bp position of chromosome 3 of Brassica napus, a G>A base mutation at the 11722650bp position, the reference genome of Brassica napus is Darmor‑bzh, and the mutated Brassica napus has higher boron efficiency. The invention determines a SNP marker associated with boron efficiency in a natural population of Brassica napus, and analyzes the correlation between the SNP marker and low boron tolerance, providing a new basis for rapid identification of high- and low-boron efficiency varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetic marker screening, and particularly relates to a genetic marker associated with the boron efficiency trait of Brassica napus and an application thereof. Background Art

[0002] Rapidly and accurately identifying more high-efficiency and excellent boron alleles and studying the genetic mechanism of crop response to low boron stress have important theoretical and practical significance for breeding high-efficiency boron-utilizing Brassica napus varieties and green and sustainable agricultural production of rapeseed. Throughout the history of agricultural evolution, plants have produced different excellent genotypes to cope with different extreme environments, thereby greatly increasing crop yields. With the development of genetics, molecular marker-assisted breeding can accurately introduce excellent allele loci into crop varieties to obtain excellent new varieties. Summary of the invention

[0003] The purpose of the present invention is to provide genetic markers associated with the boron efficiency trait of Brassica napus and their application. The present invention determines SNP markers associated with boron efficiency in a natural population of Brassica napus, and analyzes the correlation between the SNP markers and low boron tolerance, providing a new basis for the rapid identification of high and low boron efficiency varieties.

[0004] In order to achieve the above object, the present invention adopts the following technical solutions:

[0005] In the first aspect, the present invention provides genetic markers associated with the boron efficiency trait of Brassica napus, wherein the genetic markers include a T>A base mutation at the 11722450bp position of chromosome 3 of Brassica napus, and a G>A base mutation at the 11722650bp position, the reference genome of Brassica napus is Darmor-bzh, and the mutated Brassica napus has higher boron efficiency.

[0006] In a second aspect, the present invention also provides the use of the above genetic marker as a molecular marker for screening boron efficiency of Brassica napus.

[0007] In a third aspect, the present invention also provides the use of the above genetic markers in Brassica napus breeding.

[0008] In a fourth aspect, the present invention further provides a method for selecting a boron efficiency trait of Brassica napus, the selection method specifically comprising:

[0009] (1) Detecting the genotype of chromosome 3 of the Brassica napus to be tested;

[0010] (2) Based on the above genetic markers, the Brassica napus varieties to be tested are selected, wherein the varieties containing haplotype AA have higher boron efficiency than the varieties not containing haplotype AA.

[0011] Preferably, the specific steps of detecting the genotype of chromosome 3 of the Brassica napus to be tested in S1 are:

[0012] The genomic DNA of the Brassica napus to be tested was amplified by PCR using primers with nucleotide sequences as shown in SEQ ID No: 3 and SEQ ID No: 4, and the PCR amplification products were sequenced to obtain the genotypes at positions 11722450 bp and 11722650 bp of chromosome 3 of the Brassica napus to be tested.

[0013] Preferably, the reaction system for PCR amplification is:

[0014] The reaction system for PCR amplification was as follows: add 10-500 ng of genomic DNA, 2.0 μL of upstream and downstream primers, 5.0 μL of 2×Phanta Flash Master Mix, and ddH2O until 50 μL.

[0015] The reaction procedure of PCR amplification was as follows: pre-denaturation at 98°C for 1 min; 95°C for 10 s, 60°C for 5 s, and 72°C for 15 s; the number of cycles was 34; and full extension was at 72°C for 5 min.

[0016] In the fifth aspect, the present invention also provides a kit for detecting the boron efficiency trait of Brassica napus, the kit comprising reagents for detecting the genotypes at positions 11722450bp and 11722650bp on chromosome 3 of the Brassica napus to be tested. If the bases at both positions are A, it is a boron-efficient Brassica napus variety.

[0017] The beneficial effects of the present invention are as follows: the present invention obtains the excellent boron efficient SNP site of Brassica napus by screening, identifies the excellent boron efficient haplotype by combining haplotype analysis, retains the dominant allele in the breeding process, and is conducive to the screening of boron efficient varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the frequency distribution and correlation analysis of boron high efficiency related traits of natural population varieties under different boron treatments. Among them, (A) frequency distribution histogram, pink represents NB, green represents LB. (B) Correlation analysis results, the number represents the correlation coefficient, the circle size and color intensity are proportional to the correlation coefficient, blue represents positive correlation, and red represents negative correlation.

[0019] Figure 2 It is a haplotype analysis of significant SNP sites in genetic marker sequences.

[0020] The squares are visualizations of linkage disequilibrium (LD) values, and each square is the LD result of two SNPs. The colors range from red to white, representing the degree of linkage from high to low, and dark red represents complete linkage. The black frame represents the LDblock, including two SNPs, and the distance of the LDblock is 0kb.

[0021] Figure 3 The phenotypic differences of boron efficiency-related traits of different SNP variant sites and haplotypes under low boron conditions. Among them, (A) SDW phenotypic differences of varieties with different genotypes. (B) RDW phenotypic differences of varieties with different genotypes. (C) RRL phenotypic differences of varieties with different genotypes. (D) BEC phenotypic differences of varieties with different genotypes.

[0022] Figure 4 The phenotypic differences of boron efficiency-related traits of different SNP variant sites and haplotypes under normal boron conditions. Among them, (A) SDW phenotypic differences of varieties with different genotypes. (B) RDW phenotypic differences of varieties with different genotypes. (C) RRL phenotypic differences of varieties with different genotypes. DETAILED DESCRIPTION

[0023] In order to better illustrate the purpose, technical invention and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that the present disclosure will be thorough and complete, and the concept of the present invention will be fully conveyed to those skilled in the art, and the present invention will only be limited by the claims.

[0024] Example 1: Phenotypic statistics of boron efficiency-related traits of Brassica napus under different boron treatments

[0025] 1. Experimental materials: A total of 505 natural population varieties of Brassica napus were collected and constructed by major breeding centers across the country.

[0026] 2. Nutrient solution culture test: Use the standard Hoagland and Anon nutrient solution culture method, set up two treatments: low boron (LB, 0.25μM) and normal boron (NB, 25μM). When raising seedlings, select rapeseed seeds of the same size, use 75% (v / v) ethanol and 5% (v / v) NaClO to wash for 20 minutes for surface disinfection, then rinse repeatedly with ultrapure water several times and let stand at 4°C overnight. The seeds were placed on gauze on the surface of ultrapure water to germinate for 5 days. The seedlings with consistent growth were transplanted into hydroponic pots, cultured with 50% standard Hoagland solution for 5 days, and then continued to be cultured with 100% standard Hoagland solution for 10 days. The nutrient solution was changed every 5 days. The rapeseed cultured with nutrient solution was placed in a light culture room for culture at a temperature of 22°C, a photoperiod of 16h (light) / 8h (darkness), and a humidity of 75%.

[0027] 3. Characteristic investigation: The boron efficiency-related traits of 505 natural population materials of Brassica napus were investigated, including relative root length (RRL), shoot dry weight (SDW), root dry weight (RDW) and boron efficiency coefficient (BEC). When the seedlings were transferred to nutrient solution culture, the taproot length was measured with a ruler. When the samples were harvested, the taproot length was measured again with a ruler to calculate the relative root length RRL. The harvested seedling samples were dried in a 65°C oven to constant weight, and the shoot dry weight SDW and root dry weight RDW were measured. The boron efficiency coefficient BEC was calculated by the ratio of the shoot biomass under low boron treatment to the shoot biomass under normal boron treatment, which was used to evaluate the boron efficiency of different varieties. The different boron treatment experiments were repeated in 3 batches, and 6 biological replicates were set for each variety in each batch. The mean of 6 biological replicates in each batch and the mean of three batches were used for analysis.

[0028] 4. Trait data statistics. The mean, standard deviation, maximum value, minimum value, coefficient of variation, etc. of each trait phenotype under different boron level treatments were calculated using Microsoft Excel 2019. The frequency distribution histogram was drawn using the R language package ggplot2. Correlation analysis and visualization were performed using the R language package Corrplot. In the correlation analysis, Pearson correlation analysis was used.

[0029] 5. The results showed that the phenotypes under low-boron and normal-boron level treatments showed that the phenotypes of natural population materials under low-boron level treatments were quite different and had rich genetic variation, laying the foundation for genome-wide association study (GWAS). The phenotypic statistical results of the relevant traits are shown in Table 1. The average relative root length (RRL) under boron deficiency was 6.78 cm, with a coefficient of variation of 36.4%, while the RRL under normal boron was 13.41 cm, with a coefficient of variation of 21.7%. The average aboveground dry weight (SDW) under boron deficiency was 0.0839 g, with a coefficient of variation of 37.9%, while the SDW under normal boron was 0.1238 g, with a coefficient of variation of 33.60%. The average root dry weight (RDW) under boron deficiency was 0.0083 g, with a coefficient of variation of 48.5%, while the RDW under normal boron was 0.0111 g, with a coefficient of variation of 43.2%. The average boron efficiency coefficient (BEC) was 0.75, with a coefficient of variation of 45.2%. The normality test and frequency distribution diagram showed that the RRL, SDW, RDW and BEC traits had the characteristics of quantitative traits, and the frequency distribution was normal distribution and approximately normal distribution ( Figure 1 A). The above results show that the target traits related to high boron efficiency currently counted in this study have the characteristics of quantitative traits and can be used for GWAS analysis. The correlation analysis of the mean statistical results of the high boron efficiency-related traits of three batches under different boron treatments in the hydroponic experiment showed that the correlation between the aboveground dry weight (SDW) and the root dry weight (RDW) under low boron conditions was 0.85, which was significantly higher than the correlation between other traits ( Figure 1 B).

[0030] Table 1 Statistics of boron efficiency-related traits under different boron treatments

[0031]

[0032]

[0033] Example 2: Obtaining target nucleotide sequences and detecting variant sites

[0034] 1. DNA extraction of high- and low-efficiency varieties of Brassica napus

[0035] The experimental varieties of the present invention are the high-efficiency boron variety "Zhongshuang 11" and the low-efficiency boron variety "Campina". The CTAB method is used to extract the genomic DNA of Brassica napus, and the specific steps are as follows:

[0036] (1) Prepare DNA extraction buffer

[0037]

[0038] (2) Take 0.5 g of rapeseed young leaves and put them into a 2 mL centrifuge tube, put it in an ice box for later use, add 300 μL of DNA extraction solution, grind it with a sample grinder, and then add 400 μL of DNA extraction solution.

[0039] (3) Place the centrifuge tube in a 65°C metal bath or water bath for 45-60 minutes, carefully shaking the tube from time to time. (Prepare pre-cooled anhydrous ethanol).

[0040] (4) Remove the centrifuge tube and wait for it to cool to room temperature (about 25°C). Then add an equal volume of chloroform:isoamyl alcohol (24:1) and carefully shake the centrifuge tube for 10 minutes (in this step, wrap the operating plate completely with plastic wrap and place it vertically on a shaker) until the organic and inorganic phases are fully mixed.

[0041] (5) Centrifuge at 8000 rpm / min for 10 min at room temperature and transfer the supernatant to a new 1.5 mL centrifuge tube. If the supernatant is still turbid, repeat the previous step until the supernatant is almost colorless.

[0042] (6) Add an equal volume of pre-cooled anhydrous ethanol, mix carefully, freeze at -20°C for 20 min, precipitate DNA, centrifuge at 8000 rpm / min for 5-10 min, discard the supernatant, add 1 mL of 75% ethanol to wash, dry with a pipette, and then blow dry for about 1 h.

[0043] (7) Place the flocculent DNA precipitate at the bottom of the tube and allow it to air dry naturally. Then add an appropriate amount of ddH2O, about 50 μL, and gently tap to dissolve the DNA. Test the DNA quality and concentration and store at -20°C.

[0044] 2. Amplification of target nucleotide sequence

[0045] (1) Design the following amplification primers based on the genomic sequence of the target nucleotide fragment:

[0046] Primer-F:AGCTCGAGCATTAACCAAACC(SEQ ID No:3)

[0047] Primer-R:CTCCGGCGGAGACATCCTAAT(SEQ ID No:4)

[0048] (2) The amplification system is:

[0049] Components volume Genomic DNA 10-500ng Forward-Primer (10 μM) 2.0μL Reverse-Primer (10 μM) 2.0μL 2×Phanta Flash Master Mix 5.0μL <![CDATA[ddH2O]]> Up to 50μL Total 50.0μL

[0050] (3) The PCR amplification program was as follows: initial denaturation at 98°C for 1 min; 95°C for 10 s, 60°C for 5 s, and 72°C for 15 s; the number of cycles was 34; and full extension was performed at 72°C for 5 min.

[0051] (4) Separate the target fragment by 1% (w / v) agarose gel electrophoresis and purify and recover it using a DNA gel recovery kit.

[0052] 3. Sequencing of target nucleotide sequences

[0053] The recovered target fragments were sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. SEQ ID No: 1 is the amplified nucleotide sequence of the boron-efficient Brassica napus "Zhongshuang 10", with a sequence length of 463 bp. SEQ ID No: 2 is the amplified nucleotide sequence of the boron-inefficient Brassica napus "Campina", with a sequence length of 463 bp.

[0054] Four single-base mutations were found, namely, T>A mutation at 343bp, G>A mutation at 143bp, A>T mutation at 107bp, and C>A mutation at 55bp.

[0055] Example 3: Association analysis and haplotype analysis of genetic markers and candidate genes for traits related to high boron efficiency

[0056] 1. Use VCFtools to extract SNP variations within the genetic marker sequence.

[0057] 2. Based on the GLM model, the boron high efficiency related traits were analyzed with the SNP markers in the gene extraction interval for candidate gene association analysis. The significance screening threshold was set to 1 / n, where n was the number of SNP markers in the extraction interval.

[0058] The results showed that there were four SNPs significantly associated with traits related to boron high efficiency: chrA03__11722450T>A, chrA03__11722650G>A, chrA03__11722686A>T, chrA03__11722738C>A; the physical location of the genetic markers was: ChrA03:11722792..11722330.

[0059] 3. Use Haploview.4.2 to perform haplotype analysis on significant SNP sites.

[0060] The results showed that the base variation of chrA03__11722450 was T:A, and the base variation of chrA03__11722650 was G:A, which constituted three haplotypes: TG, AA and AG ( Figure 2 ).

[0061] 4. GraphPad Prism 8 (USA) was used to statistically analyze the phenotypic differences of varieties containing different haplotypes and visualize the results.

[0062] 5. Trait data statistics: GraphPad Prism 8 (USA) was used for data statistical analysis, and independent sample t-test (Student t-test) was used for data significance analysis.

[0063] The results show:

[0064] 1. Under low boron conditions, the SDW, RDW and BEC of the genotype varieties with T base at chrA03__11722450 were significantly lower than those with A base at the same site; the SDW, RDW and EBC of the genotype varieties with A base at chrA03__11722650 were significantly higher than those with G base at the same site; and the SDW, RDW and BEC of the varieties with haplotypes AA and AG were significantly higher than those with haplotypes TG ( Figure 3 AB).

[0065] 2. Under low boron conditions, there was no significant difference in RRL between the genotypes of chrA03__11722450 with T and A bases; there was no significant difference in RRL between the genotypes of chrA03__11722650 with A and G bases; and there was no significant difference in RRL between the genotypes of TG, AA and AG ( Figure 3 C).

[0066] 3. Under normal boron conditions, the SDW and RDW of the varieties with the genotype of T at chrA03__11722450 were significantly lower than those with the genotype of A at the same site; the SDW and RDW of the varieties with the genotype of A at chrA03__11722650 were significantly higher than those with the genotype of G at the same site; and the SDW and RDWC of the varieties with haplotype AA were significantly higher than those with haplotypes TG and AG ( Figure 3 AB), there was no significant difference in SDW and RDW between varieties containing haplotypes TG and AG ( Figure 4 AB).

[0067] 4. Under normal boron conditions, there was no significant difference in RRL between the genotype varieties with T and A at chrA03__11722450; the RRL of the genotype varieties with A at chrA03__11722650 was significantly higher than that of the genotype varieties with G at the same site; and the RRL of the varieties containing haplotype TG was significantly higher than that of the varieties containing haplotype AA, and there was no significant difference in RRL between the varieties containing haplotype AG ( Figure 4 C), and there was no significant difference in RRL between varieties containing haplotypes AA and AG ( Figure 4 C).

[0068] 5. The above results show that the detected genetic marker sequences are significantly correlated with boron efficiency-related traits, and the A base at the chrA03__11722450 site is a boron efficiency-excellent SNP, and the A base at the chrA03__11722650 site is a boron efficiency-excellent SNP. Therefore, varieties containing the excellent haplotype AA have higher boron efficiency than varieties without the excellent haplotype. And under low-boron conditions, the boron efficiency of varieties containing the boron efficiency-excellent SNP is significantly higher than that of varieties without the boron efficiency-excellent SNP.

[0069] In summary, the A allele at the 159th bp and the A allele at the 359th bp in the target fragment are dominant alleles, which can be retained in the breeding process, which is conducive to the screening of high-efficiency boron varieties.

[0070] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. Use of a reagent for detecting a genetic marker associated with the boron efficiency trait of Brassica napus in screening for boron efficiency of Brassica napus, characterized in that: SEQ ID No: 1 shows the amplified nucleotide sequence of the boron-efficient Brassica napus "Zhongshuang10", SEQ ID No: 2 shows the amplified nucleotide sequence of the boron-inefficient Brassica napus "Campina", wherein the genetic markers are T mutated to A at the 343 bp position and G mutated to A at the 143 bp position; The mutant Brassica napus has higher boron efficiency.

2. Use of a reagent for detecting a genetic marker associated with the boron efficiency trait of Brassica napus in the breeding of boron efficiency of Brassica napus, characterized in that: SEQ ID No: 1 shows the amplified nucleotide sequence of the boron-efficient Brassica napus "Zhongshuang10", SEQ ID No: 2 shows the amplified nucleotide sequence of the boron-inefficient Brassica napus "Campina", wherein the genetic markers are T mutated to A at the 343 bp position and G mutated to A at the 143 bp position; The mutant Brassica napus has higher boron efficiency.

3. A method for selecting the boron efficiency trait of Brassica napus, characterized in that: The selection method specifically includes: (1) Performing PCR amplification to detect the genotype of chromosome 3 of the Brassica napus to be tested; (2) Selection of B. napus varieties based on genetic markers associated with B. napus bovis ... As shown in SEQ ID No: 1, the nucleotide sequence of the amplified boron-efficient Brassica napus "Zhongshuang 10" is shown, and as shown in SEQ ID No: 2, the nucleotide sequence of the amplified boron-inefficient Brassica napus "Campina" is shown. The genetic markers are T mutation to A at the 343rd bp and G mutation to A at the 143rd bp.

4. The selection method according to claim 3, characterized in that: The specific steps of performing PCR amplification to detect the genotype of chromosome 3 of the Brassica napus to be tested in (1) are as follows: The genomic DNA of the Brassica napus to be tested is amplified by PCR using primers with nucleotide sequences as shown in SEQ ID No: 3 and SEQ ID No: 4, and the PCR amplification product is sequenced to obtain the genotype of the Brassica napus to be tested.

5. The selection method according to claim 4, characterized in that: The reaction system for PCR amplification is: The reaction system for PCR amplification was as follows: add 10-500 ng of genomic DNA, add 2.0 μL of upstream and downstream primers, add 5.0 μL of 2× Phanta Flash Master Mix, and add ddH2O until 50 μL; The reaction program of PCR amplification was as follows: pre-denaturation at 98°C for 1 min; 95°C for 10 s, 60°C for 5 s, and 72°C for 15 s; the number of cycles was 34; and full extension was at 72°C for 5 min.

Images