Method for producing Her-2 antibody based on transgenic plants

Abstract

The present application discloses a method for expressing Her-2 antibody gene in tomato. The Her-2 antibody gene is cloned into a eukaryotic expression vector to obtain a plasmid containing the Her-2 antibody gene sequence. Subsequently, the plasmid is transformed into Agrobacterium and the transformed Agrobacterium is used to infect tomato callus, thereby obtaining a transgenic tomato plant capable of expressing the Her-2 antibody gene. The tomato plant expressing the antibody Her-2 gene obtained in the present application has important value in the application of antibody production.

Description

Technical Field

[0001] The present application belongs to the field of plant genetic engineering technology, and in particular relates to a method for producing Her-2 antibodies based on transgenic plants. Background Art

[0002] Her-2 (human epidermal growth factor receptor 2, p185, erbB-2) is a cell surface transmembrane glycoprotein encoded by the oncogene neu / erbB-2 / Her-2. It has been found that its expression is significantly increased in more than ten types of cancer, especially breast cancer and ovarian cancer, 25-30% of which are HER-2 overexpression types. This type of tumor shows high malignancy, rapid tumor proliferation and deterioration, poor prognosis and easy recurrence. In particular, they are insensitive to traditional therapies such as chemotherapy and radiotherapy, and are more harmful.

[0003] The anti-p185neu / erbB-2 / Her-2 antibody drug Herceptin (trastuzumab) targeting HER-2 can effectively downregulate the expression of Her-2, significantly inhibit the growth of Her-2 overexpressing tumors and even completely reverse the tumor. The use of anti-Her-2 antibodies combined with chemotherapy has become an internationally recognized first-line drug for the treatment of Her-2 overexpressing metastatic cancer, with a treatment response rate of 45-65% and a survival period doubled.

[0004] The systems currently used for genetic engineering antibody expression mainly include: Escherichia coli, mammalian cells, yeast cells, insect cells, plant expression systems, etc.

[0005] Among them, the main advantages of the E. coli expression system are low cost, short cycle, and easy operation, but it lacks processing mechanisms such as phosphorylation and glycosylation and is not suitable for expressing complex proteins. Yeast has strong protein folding and post-translational processing and modification capabilities. Compared with mammalian expression systems, it can grow rapidly and ferment at high density under simple culture conditions, but its glycosylation modification is significantly different from that of humans. Currently, humanized N-glycosylation modification has been performed on Pichia pastoris (Nature Biotechnology, 2006, 24(2): 210-215).

[0006] The characteristics of the insect expression system are similar to those of the yeast expression system, and it even has a stronger ability to process the expression products. However, its glycosylation modification, signal peptide removal and post-translational processing are different from those of mammalian cells.

[0007] Mammalian cells are currently the most commonly used expression system for producing antibodies. Post-translational modifications such as glycosylation are relatively close to humans, and are used to produce antibodies for clinical applications and fully humanized antibodies. However, the production cost of mammalian cells is relatively high.

[0008] Plants can be grown and cultured on a large scale using simple inorganic substances, sunlight, water, etc., with low culture costs, no need for special reaction equipment, easy to scale up, and low artificial production costs. Plant roots, stems, leaves, fruits, whole plants, algae, suspended plant cells, hairy roots, etc. can be used to express foreign proteins.

[0009] Many animal-derived proteins have been expressed and produced in plants, such as therapeutic monoclonal antibodies, vaccines, cytokines, blood protein components and other therapeutic recombinant proteins, as well as industrial enzymes and biopolymers, expressed in tobacco. The protein expression level can reach 0.01% of the total soluble protein (TSP) (Plant Biotechnol J, 2009. 7: 537-39), or even as high as 25% of the soluble protein (Plant CellRep, 2007. 26: p. 1151-9) and 247mg / L (Biotechnol Prog, 2005. 21:728-34).

[0010] Wuhan University and Sun Yat-sen University have used rice and tobacco suspension cells to produce human albumin, with the expression levels reaching 2.75 g of human albumin per kilogram of rice (Proc Natl Acad Sci USA, 2011. 108(47):19078-19083) and 11.88 g / mL of cell suspension (Journal of Biotechnology, 2011. 155:164-172). In addition, Wuhan University has also expressed recombinant human antitrypsin (OsrAAT), recombinant human acidic fibroblast growth factor (OsraFGF), and recombinant human basic fibroblast growth factor (OsrbFGF). Jilin Agricultural University has used tomatoes to express epidermal growth factor (Journal of Northwest Agriculture and Forestry University (Natural Science Edition), 2012. 40(1): p. 141-146). ), and vaccines against rabies virus and cholera toxin B subunit expressed in tomatoes (BiotechnologyAdvances. 29: p. 210-222).

[0011] Therefore, there is an urgent need to provide a suitable technical solution to achieve the expression of Her-2 antibodies in plants. Summary of the invention

[0012] The present application provides a method for expressing the Her-2 antibody gene in tomatoes, aiming to solve the defects of the existing Her-2 antibody production methods.

[0013] In a first aspect, the present application provides a recombinant expression plasmid, which includes a Her-2 antibody gene and a eukaryotic cell expression element, so that the Her-2 antibody gene can be expressed in plant cells.

[0014] In a second aspect, the present application also provides a method for obtaining transgenic tomatoes. The method comprises: using a eukaryotic expression vector to transform Agrobacterium; the eukaryotic expression vector contains a Her-2 antibody gene sequence; using the transformed Agrobacterium to infect tomato callus; and screening transgenic tomato plants expressing the Her-2 antibody gene in tomatoes infected with Agrobacterium.

[0015] Optionally, the eukaryotic expression vector is constructed by the following method: amplifying the Her-2 gene fragment by PCR; double-digesting the eukaryotic expression vector and the Her-2 gene fragment with XbaI and SacI enzymes respectively, and recovering the digested fragments; connecting the recovered digested fragments with T4 ligase; using the ligation product to transform DH5α Escherichia coli, picking positive clones and verifying them with PCR to obtain the eukaryotic expression vector.

[0016] Optionally, when amplifying the Her-2 gene fragment by PCR, the forward primer used is SEQ ID No. 1; and the reverse primer used is SEQ ID No. 2.

[0017] Optionally, the use of a eukaryotic expression vector to transform Agrobacterium specifically includes: transferring the constructed plant expression vector into Agrobacterium, streaking on LB solid culture medium containing kanamycin and rifampicin (both at a concentration of 50 mg / L); culturing in the dark at 28°C for two days, picking a single colony and verifying it through PCR to obtain successfully transformed Agrobacterium.

[0018] Optionally, the screening of transgenic tomato plants expressing the Her-2 antibody gene in tomatoes infected with Agrobacterium specifically includes: screening positive transgenic tomato plants by PCR amplification based on the NPTII marker gene.

[0019] Optionally, when screening positive transgenic tomato plants by PCR amplification, the forward primer used is SEQ ID No. 3; and the reverse primer used is SEQ ID No. 4.

[0020] At least one beneficial effect of the present application is that a transgenic tomato plant capable of expressing the Her-2 antibody gene is obtained, and the transgenic tomato plant can play an important role in the production and application of the Her-2 antibody. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1It is the electrophoresis diagram of the Her-2 antibody chA21 gene fragment obtained by PCR amplification of the present application;

[0022] Figure 2 It is a schematic diagram of the PCR identification results of the transgenic tomato plants ChA550 and ChA570 of the present application using NPTII primers;

[0023] Figure 3 This is a schematic diagram of the PCR identification results of extracting total RNA from transgenic tomato plants ChA550 and ChA570, performing reverse transcription, and using cDNA as a template and Her-2 antibody gene as a primer;

[0024] Figure 4 It is the ELISA test result of the Her-2 antibody chA21 transgenic tomato plants ChA550, ChA570 and wild tomato Ac+ protein extract of the present application;

[0025] Figure 5 The results are Western-blotting of the Her-2 antibody chA21 transgenic tomato plants ChA550, ChA570 and wild tomato Ac+ protein extracts of the present application.

[0026] Description of reference numerals:

[0027] M: molecular weight marker (Takara, Catalog No. 3427A);

[0028] chA21: Her-2 antibody chA21 gene fragment;

[0029] Ac+: wild-type tomato as negative control;

[0030] ChA550: transgenic tomato plant ChA550;

[0031] ChA570: Transgenic tomato plant ChA570. DETAILED DESCRIPTION

[0032] In order to facilitate the understanding of the present application, the present application is described in more detail below in conjunction with the accompanying drawings and specific embodiments. It should be noted that when an element is described as "fixed to" another element, it can be directly on another element or there can be one or more centered elements therebetween. When an element is described as "connected" to another element, it can be directly connected to another element or there can be one or more centered elements therebetween. The orientation or positional relationship indicated by the terms "upper", "lower", "inner", "outer", "bottom" and the like used in this specification is based on the orientation or positional relationship shown in the accompanying drawings, only for the convenience of describing the present application and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present application. In addition, the terms "first", "second", "third" and the like are used only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0033] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used in this specification and in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used in this specification includes any and all combinations of one or more of the related listed items.

[0034] In addition, the technical features involved in the different embodiments of the present application described below can be combined with each other as long as they do not conflict with each other.

[0035] As an important economic plant, tomato is a safe food for humans, and its gene sequencing has been completed, which is conducive to genetic modification. The embodiment of the present application provides a technical solution for expressing Her-2 antibody drugs in tomatoes and obtaining transgenic tomato plants producing Her-2 antibodies.

[0036] Example 1: Construction of Her-2 antibody gene vector

[0037] 1) Design the following forward primer and reverse primer according to the Her-2 antibody gene sequence:

[0038] Her-2F: 5'GC TCTAGA ATGACCTGCAAGTCCAGTCCAGTCAGAC 3′;

[0039] Her-2R: 5'C GAGCTC TCATTTACCCGGAGACAGGGA 3′;

[0040] The underlined nucleic acids are the restriction sites of XbaI and SacI, respectively. Figure 1 Figure 2 is a schematic diagram of amplifying gene fragments. Figure 1 As shown, the electrophoresis lanes from left to right are:

[0041] Lane 1: Molecular weight marker;

[0042] Lane 2: Her-2 antibody chA21 gene fragment (size approximately 1400 bp).

[0043] 2) Construction of plant expression vector for Her-2 antibody gene:

[0044] 2.1) The amplified Her-2 antibody gene PCR fragment and the eukaryotic expression vector were double-digested with XbaI and SacI enzymes (both endonucleases are products of Takara Biotechnology (Dalian) Co., Ltd.), and the above-mentioned enzyme-digested fragments were recovered using a gel recovery kit (product of Transgene) according to the instructions. The enzyme digestion conditions are as follows:

[0045] PCR product or eukaryotic expression vector: 200 ng

[0046] XbaI 10 U;

[0047] SacI 10 U;

[0048] 10XM buffer 5μL;

[0049] Add double distilled water (ddH2O) to 50 μL;

[0050] Digest at 37℃ for 3h.

[0051] 2.2) The recovered gene fragments were ligated with T4 ligase. The ligation reaction conditions are as follows:

[0052] PCR digestion recovery fragment: 10 ng

[0053] PBI121 vector fragment: 60 ng

[0054] 5X T4 buffer: 2 μL

[0055] T4 ligase: 100 U

[0056] Add ddH2O to final volume: 10 μL

[0057] Ligation was carried out at 16°C overnight.

[0058] 2.3) The above ligation reaction system was transformed into DH5α Escherichia coli, positive clones were picked and verified by PCR, plasmids were extracted using a plasmid extraction kit (Transgene) and identified by enzyme digestion, and those with correct results were sent for sequencing (Nanjing GenScript Biotechnology Co., Ltd.).

[0059] 2.4) The constructed plant expression vector was transferred into Agrobacterium, streaked on LB solid medium containing kanamycin and rifampicin (both at a concentration of 50 mg / L), and cultured in the dark at 28°C for two days. Single colonies were picked and verified by PCR. The leaf disc transformation method (Plant Cell Rep, 1986, 5: 81-84) was used to transform tomatoes to obtain transgenic plants.

[0060] Example 2: Agrobacterium-mediated genetic transformation of Her-2 antibody gene into tomato

[0061] Agrobacterium-mediated genetic transformation of Her-2 antibody chA21 gene into tomato callus tissue was performed as follows:

[0062] 1) Preparation of plant materials

[0063] First, soak the tomato seeds in warm water at about 35°C for 18-30 hours, then soak them in a 10% sodium hypochlorite solution for 10-15 minutes, shaking them 2-3 times, and finally rinse the seeds thoroughly with sterile water 3-4 times.

[0064] Then, the seeds were sown in a tube containing 1 / 2 MS culture medium and cultured in the dark for 2-3 days. After turning white, they were transferred to culture under light at 25°C.

[0065] Finally, remove the cotyledons before the first true leaf emerges. If the cotyledon length is >1 cm, cut it in half and place it face down on the pre-culture medium.

[0066] 2) Resuspension of recombinant Agrobacterium

[0067] First, the transformation-positive Agrobacterium was streaked on LB solid medium containing kanamycin and rifampicin, cultured in the dark at 28°C for 2 days, and a single colony was picked and cultured at 28°C with shaking for 24 h.

[0068] Then, take 200 μL of the overnight culture and add it to 5 mL of LB selection medium, and culture it with shaking at 28°C overnight. After the overnight culture, centrifuge it at 5000 rpm at room temperature for 10 min.

[0069] Finally, the supernatant after centrifugation was discarded and the induction medium was added to resuspend the bacterial pellet for transformation.

[0070] 3) Callus regeneration and rooting

[0071] 3.1) Co-cultivation: Immerse the pre-cultured cotyledons in the Agrobacterium resuspension for 15 min, take out the cotyledons and place them on sterile filter paper to absorb the liquid on the surface of the explants, put them in the co-culture medium, seal the tube, and culture at 25°C with 16 h light for 3 days.

[0072] 3.2) Regeneration culture: Transfer the explants from the co-culture medium to the regeneration medium (containing carbenicillin and kanamycin), with 16 hours of light per day and 25°C; replace the medium after 3 weeks and subculture until the explant callus grows new buds and differentiates into long stems.

[0073] 3.3) Rooting culture: When the plant grows to 2-3 cm, remove the excess callus around the base of the explant and transfer it to the rooting medium. Rooting should be carried out at 25°C with 16 hours of light per day.

[0074] 3.4) Potted culture: After the seedlings have developed root systems, remove them and transfer them to pots. Cultivate them in a greenhouse at 25°C with 16 hours of light per day.

[0075] 4) Positive identification of genetically modified tomatoes:

[0076] The following forward primer and reverse primer were designed according to the sequence of NPTII screening marker gene:

[0077] NPTII-F: 5' TCTCATGCTGGAGTTCTTCGC 3';

[0078] NPTII-R: 5' GTCACCGACTTGAGCCATTTG 3'

[0079] The total DNA of the transformed seedlings was extracted, and the total DNA of the non-transgenic plants was used as a negative control. The above primers were used for PCR amplification to identify the transgenic plants. The identification results of the transgenic plants are shown in Figure 2 shown.

[0080] Example 3: RT-PCR verification of tomato fruit expressing Her-2 antibody gene

[0081] In this example, the test materials used include Taq DNA polymerase, Trizol reagent, and reverse transcription kit purchased from Transgene; PCR primers were synthesized by Nanjing GenScript; and the remaining reagents were imported or domestic analytically pure products.

[0082] 1) RNA extraction from tomato

[0083] 1.1) Grind tomato tissues quickly with liquid nitrogen, add Trizol at a ratio of 50-100 mg tissue / ml Trizol, shake vigorously, and leave at room temperature for 5 min.

[0084] Then, centrifuge at 12,000 rpm for 5 min. Take the supernatant after centrifugation and add chloroform at a ratio of 200 μL chloroform / ml Trizol, shake vigorously for 15 s, and leave at room temperature for 3 min.

[0085] 1.2) Centrifuge at 4°C and 12,000 g for 15 min. Take the supernatant after centrifugation, add isopropanol at a ratio of 0.5 mL isopropanol / mL Trizol, mix well, and leave at room temperature for 10 min.

[0086] 1.3) Centrifuge at 4°C and 12,000 g for 10 min. Discard the supernatant and the RNA will settle at the bottom of the tube.

[0087] 1.4) Add 75% ethanol to the centrifuge tube at a ratio of 1 mL 75% ethanol / mL Trizol and gently shake the tube to resuspend the precipitate.

[0088] 1.5) Centrifuge at 8,000 g for 5 min at 4°C and discard as much supernatant as possible.

[0089] 1.6) Discard the supernatant and dry at room temperature for 5-10 min.

[0090] 1.7) Dissolve RNA sample in 50 μL DEPC-H2O at 55-60°C for 5-10 min.

[0091] 2) Semi-quantitative PCR (RT-PCR)

[0092] First, add the following components and perform reverse transcription according to the following procedure.

[0093] Added ingredients:

[0094] 5×RT Buffer 4 μL;

[0095] dNTP Mixture (10 mM each) 2 μL;

[0096] RNase Inhibitor(10 U / μL) 1 μL;

[0097] Oligo(dT) 20 (10 pmol / μL) 1 μL;

[0098] Total RNA 1 μL;

[0099] RNase-Free H2O 10 μL;

[0100] ReverTra Ace 1 μL;

[0101] Reverse transcription procedure:

[0102] 42°C for 45 min;

[0103] 94℃ for 5 min;

[0104] 4℃ for 5 min.

[0105] Subsequently, the expression of Her-2 antibody gene was identified by reverse transcription PCR. When reverse transcription PCR was performed, the expected amplified fragment was about 1400 bp.

[0106] The PCR reaction system is as follows:

[0107] 10×PCR Buffer 2 μL;

[0108] Mg 2+ (1.5 mM) 1.2 μL;

[0109] dNTP Mixture (2.5 mM each) 1.6 μL;

[0110] cDNA 1 μL;

[0111] Forward primer Her-2F 0.4 μL;

[0112] Reverse primer Her-2R 0.4 μL;

[0113] ddH2O 12.4 μL;

[0114] Taq DNA polymerase 1 μL;

[0115] The PCR program was as follows: denaturation at 94°C for 5 min, 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 40 s for 30 cycles, and extension at 72°C for 5 min.

[0116] Finally, we get Figure 3 The identification results are shown. Figure 3 In the figure, Ac+ is a wild-type tomato, and ChA550 and ChA570 are transgenic tomato lines expressing the Her-2 antibody gene chA21. Figure 3 The identification results showed that the Her-2 antibody gene was successfully expressed in tomatoes.

[0117] Example 4: ELISA detection of Her-2 antibody protein expressed in tomato fruit

[0118] 1) Extraction of Her-2 antibody protein expressed in tomato fruit

[0119] First, grind the tomato fruit in the Breaker stage with liquid nitrogen, take the powdered tomato fruit and put it into a 15 mL centrifuge tube, about 1 mL, add 1 mL of protein extraction buffer, mix well, place on ice for 15 minutes, and shake once every 5 minutes. Then, centrifuge at 12,000 rpm for 15 minutes to obtain the supernatant as the Her-2 antibody primary extract, which can be used for ELISA detection.

[0120] 2) ELISA detection of Her-2 antibody protein

[0121] The chimeric antibody content in the supernatant was determined by sandwich ELISA, with goat anti-human Fc polyclonal antibody as the plate, HRP-labeled goat anti-human Fc polyclonal antibody as the labeled polyclonal antibody, and the antibody concentration was determined by IgG1 standard gradient control. The specific detection steps are as follows:

[0122] 2.1) Dilute goat anti-human Fc polyclonal antibody to a protein content of 5 μg / ml in 50 mM pH 9 carbonate coating buffer, add 0.1 ml of the diluted antibody to each reaction well of the polystyrene plate for coating, and incubate at 4°C overnight.

[0123] 2.2) Discard the solution in the wells, wash with PBST washing buffer 3 times, 3 minutes each time, and pat clean on clean absorbent paper. After cleaning, add 0.1ml of the sample to be tested or IgG1 standard gradient of a certain dilution to the above-mentioned coated reaction wells, incubate at 37℃ for 1 hour, and make blank wells, negative control wells and positive control wells at the same time.

[0124] 2.3) Discard the solution in the wells, wash three times with PBST washing buffer, 3 minutes each time, and pat clean on clean absorbent paper.

[0125] 2.4) Add 0.1 ml of HRP-labeled goat anti-human Fc polyclonal antibody to each reaction well and incubate at 37°C for 0.5 to 1 hour.

[0126] 2.5) Discard the solution in the wells, wash three times with PBST washing buffer, 3 minutes each time, and pat clean on clean absorbent paper.

[0127] 2.6) Add 0.1 ml of freshly prepared chromogenic substrate solution to each reaction well and incubate at 37°C for 10 to 30 minutes.

[0128] 2.7) Add 0.05 ml of 2M sulfuric acid to each reaction well to terminate the reaction.

[0129] 2.8) On the ELISA detector, measure the OD value of each well at 490nm after adjusting the blank control well to zero. Make a standard curve based on the IgG1 standard gradient and OD value. Calculate the concentration of the sample based on the standard curve and the sample OD value.

[0130] 3) Determination of protein concentration in supernatant by Lowry method

[0131] The protein concentration in the extract was determined using a protein assay kit (Pierce™), and a standard curve was prepared using BSA standard protein. Folin reagent was added to the samples and standard samples for color development, and then detected at a visible light wavelength of 750 nm.

[0132] Subsequently, the amount of antibody per unit protein amount in the protein extract can be calculated based on the ELISA antibody concentration and the total protein concentration in the extract.

[0133] Figure 4 is the test result of protein concentration. Figure 4 As shown, the antibody concentrations in the tomato fruits of the two transgenic lines ChA550 and ChA570 obtained reached 7.94 and 2.71 μg / mg protein, while no antibody protein was detected in the wild-type tomato fruits.

[0134] Example 5: Western Blotting Detection of Her-2 Antibody Protein Expressed in Tomato

[0135] 1) Extraction of Her-2 antibody protein expressed in tomato fruit

[0136] The steps for extracting the Her-2 antibody protein are the same as those in Example 4, and are not described here to avoid repetition.

[0137] 2) Western-blot protein detection

[0138] First, take 20 μL and add 5× loading buffer, the gel is 10% SDS-PAGE, the electrophoresis parameters are constant voltage 100 V, and the time is 90-100 min. Then, use a semi-dry transfer instrument to transfer the protein on the gel to the PVDF membrane, constant voltage 20 V, and transfer for 30 min.

[0139] After the transfer operation was completed, the membrane was removed and blocked with Western-Blot blocking solution at room temperature for 1 hour. After the blocking was completed, the blocking solution was removed and the blocking solution containing Anti-His mouse monoclonal antibody (Shanghai Bioengineering) was added for hybridization incubation at room temperature for 1 hour, and the membrane was washed three times with 1×TBST, each time for 10 minutes.

[0140] Finally, a blocking solution containing anti-mouse antibody was added and hybridized and incubated at room temperature for 1 h. The antibody was recovered and the membrane was washed three times with 1× TBST, each time for 10 min, and then developed.

[0141] Figure 5 This is a schematic diagram of Western Blotting results. Figure 5 As shown, the two transgenic lines ChA550 and ChA570 obtained expressed antibody protein, while no antibody protein was detected in wild-type Ac+ tomato fruits.

[0142] Specifically, the bacterial and Agrobacterium culture and Agrobacterium-mediated genetic transformation reagents and formulas involved in the embodiments of the present application are as follows:

[0143] Escherichia coli culture medium: LB medium (1 L): tryptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L.

[0144] Agrobacterium culture medium: YEB liquid medium (1 L): 5 g tryptone, 1 g yeast extract, 5 g beef extract, 5 g NaCl, 0.493 g MgCl2·7H2O, pH 7.0.

[0145] The culture medium and formula used for Agrobacterium-mediated genetic transformation are as follows:

[0146] Each liter of minimal medium (MS) includes the following components: anhydrous CaCl2 330 mg; KNO3 1900 mg; MgSO4·7H2O 370 mg; NH4NO3 1650 mg; KH2PO4 170 mg; FeSO4·7H2O 27.85 mg; Na2-EDTA 37.25 mg; inositol 100 mg; Nicotinic Acid 0.5 mg; Pyridoxine-HCl 0.5 mg; Glycine 2.0 mg; Ammonium Sulfate Hydrochloride 0.4 mg; Folic Acid 25 mg; Biotin 2 mg; KI 8.3 mg; H3BO 362 mg; Na2MoO4·2H2O 2.5 mg; MnSO4·4H2O 223 mg; ZnSO4·7H2O 86 mg; CuSO4·5H2O 0.25 mg; CoCl2·6H2O 0.25 mg; Sucrose: 20 g; Agar powder: 7 g, among which all organic components except sucrose and agar are sterilized by filtration, and the rest are sterilized at 121℃ for 20 min.

[0147] Preculture medium: Add 1 mg / L 6-benzylaminopurine (6-BA) and 0.04 mg / L indoleacetic acid (IAA) to MS medium.

[0148] Induction medium (100 ml): 5 ml AB ​​salts, 2 ml MES buffer, 2 ml sodium phosphate buffer, 91 ml 1% glucose.

[0149] Co-culture medium: Add KH2PO4, 0.1 mg / L Kinetin (Kt), 0.2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 15 mg / L Acetosyringone (ACE) to MS medium at a final concentration of 0.2 mg / L

[0150] Regeneration medium: Add 500 mg / L carbenicillin sodium, 50 mg / L kanamycin sulfate, 2 mg / L 6-BA and 0.2 mg / L IAA to MS medium.

[0151] Rooting medium: Add 500 mg / L sodium carbenicillin and 2 mg / L IAA to the MS medium.

[0152] Protein extraction buffer: 50 μL 1 M Tris-HCl pH7.5, 60 μL 2.5M NaCl, 4 μL 0.5 MDTT, 10 μL 0.1M PMSF, 10 μL PPi, 10 μL 0.5 M EDTA, 200 μL 50% glycerol, 200 μL 10% PVPP, add ddH2O to make up to 1 mL.

[0153] The present application discloses a novel method for expressing the Her-2 antibody gene in tomatoes, which involves cloning the Her-2 antibody gene into a eukaryotic expression vector to obtain a plasmid containing the Her-2 antibody gene sequence. Subsequently, the plasmid is transformed into Agrobacterium and the transformed Agrobacterium is used to infect tomato callus tissue, thereby obtaining a transgenic tomato plant capable of expressing the Her-2 antibody gene. The tomato plant expressing the antibody Her-2 gene obtained in the present application has important value in the application of antibody production.

[0154] The above description is only an implementation method of the present application, and does not limit the patent scope of the present application. Any equivalent structure or equivalent process transformation made using the contents of the present application specification and drawings, or directly or indirectly used in other related technical fields, are also included in the patent protection scope of the present application.

Claims

1. A method for obtaining transgenic tomatoes, characterized in that: The method comprises: Transforming Agrobacterium using a eukaryotic expression vector; the eukaryotic expression vector contains a Her-2 antibody gene sequence and a eukaryotic cell expression element; Tomato callus was infected with transformed Agrobacterium; Screening transgenic tomato plants expressing the Her-2 antibody chA21 gene in tomatoes infected with Agrobacterium; The eukaryotic expression vector is constructed by the following method: The Her-2 antibody chA21 gene fragment was amplified by PCR; The eukaryotic expression vector and the Her-2 antibody chA21 gene fragment were double-digested with XbaI and SacI enzymes, and the digested fragments were recovered; Use T4 ligase to connect the recovered enzyme-cut fragments; The ligation product is used to transform DH5α Escherichia coli, and positive clones are picked and verified by PCR to obtain the eukaryotic expression vector; When the Her-2 antibody chA21 gene fragment is amplified by PCR, the forward primer used is SEQ ID No.1; the reverse primer used is SEQ ID No.2; The method of screening transgenic tomato plants expressing the Her-2 antibody chA21 gene from tomatoes infected with Agrobacterium specifically comprises: Based on the NPTII marker gene, positive transgenic tomato plants were screened by PCR amplification; When screening positive transgenic tomato plants by PCR amplification, the forward primer used is SEQ ID No.3; and the reverse primer used is SEQ ID No.

4.

2. The method according to claim 1, characterized in that The use of a eukaryotic expression vector to transform Agrobacterium specifically includes: The constructed plant expression vector was transformed into Agrobacterium and streaked on LB solid medium containing kanamycin and rifampicin; The cells were cultured in the dark at 28°C for two days, and single colonies were picked and verified by PCR to obtain successfully transformed Agrobacterium.

3. A method for producing a Her-2 antibody, characterized in that: include: The transgenic tomatoes obtained by the method according to claim 1 or 2 are used to produce Her-2 antibodies.

Images