Bradyrhizobium sp. sbr26, preparation and application thereof

Abstract

The application discloses a new Bradyrhizobium species SBR26, a preparation and application thereof, and belongs to the technical field of microorganisms. The new Bradyrhizobium species SBR26 of the application is preserved in the China General Microbiological Culture Collection Center, and has a preservation number of CGMCC No. 29122. The bacteria can resist a part of bactericides and insecticides, and have strong nitrogen tolerance and nodulation and nitrogen fixation capacity, and therefore have the capacity of nitrogen saving and yield improvement. In the case of field planting with 50% reduction of nitrogen fertilizer application amount, the strain can significantly improve the nitrogen fixation and growth performance of crops, reduces the application of nitrogen fertilizer, ensures the normal implementation of crop pesticides, and finally improves the yield of crops.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a new species of slow-growing rhizobium, SBR26, its formulations, and applications. Background Technology

[0002] Excessive application of nitrogen fertilizer during peanut cultivation has caused significant ecological damage and compromised the quality and safety of agricultural products. Peanut slow-growing rhizobia are a type of Gram-negative bacteria that form symbiotic nodules with peanuts and provide nitrogen to the peanut by fixing atmospheric nitrogen. Within the nodules, the peanut provides the rhizobia with carbohydrates, water, and minerals, while the rhizobia provide NH4 to the peanut through their own nitrogen fixation. + Because root nodules rupture and fall off after aging, releasing nitrogen and some free-growing rhizobia into the soil, the symbiotic nitrogen fixation of root nodules can also improve soil fertility. The symbiotic nitrogen fixation between peanut slow-growing rhizobia and peanuts can replace some nitrogen fertilizer, effectively mitigating the environmental damage caused by excessive nitrogen application.

[0003] Nitrogen applied to the soil inhibits the formation of nodules and nitrogen fixation by peanut slow-growing rhizobia. Nitrogen fertilizer can suppress the colonization and infection of peanut roots by slow-growing rhizobia by activating the auxin and ethylene regulation systems, nitrogen feedback regulation systems, and automatic nodule number regulation systems within the peanut plant. Nitrogen-tolerant slow-growing rhizobia can form nodules in medium / high nitrogen soils, providing nitrogen to peanuts through nitrogen fixation, thereby reducing the peanut's dependence on and demand for nitrogen fertilizer. This ensures high crop yield and improves crop quality even with unstable nitrogen fertilizer application rates. Although nitrogen-tolerant slow-growing rhizobia inoculants have many advantages in agricultural production, the lack of commercially available nitrogen-tolerant rhizobia and the unstable nitrogen-fixing and nitrogen-sparing abilities of existing rhizobia make the screening of a slow-growing rhizobia strain with strong nitrogen fixation, good nitrogen-sparing effect, certain tolerance to nitrogen inhibition, and promotion of high peanut yields of practical value. Summary of the Invention

[0004] This invention provides a new species of slow-growing rhizobium (Bradyrhizobium sp.) SBR26, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 29122.

[0005] The aforementioned novel slow-growing rhizobium species SBR26 exhibits strong tolerance to various pesticides and nitrogen, along with strong nodulation and nitrogen fixation capabilities, and significant nitrogen-saving and yield-promoting effects. Based on this, the present invention provides the application of the aforementioned novel slow-growing rhizobium species SBR26 in promoting plant nodulation, nitrogen fixation, and / or growth.

[0006] This invention provides a rhizobium inoculant containing the aforementioned novel slow-growing rhizobium species SBR26. Furthermore, the inoculant may also contain other conventional excipients.

[0007] The formulation of the above-mentioned rhizobium inoculant can be selected from liquid inoculant, powder or granule.

[0008] In one specific embodiment, the inoculum is a liquid inoculum, which is obtained by culturing the aforementioned new species of slow-growing rhizobium SBR26 using TY liquid culture medium; the concentration of the new species of slow-growing rhizobium SBR26 in the liquid inoculum is 1×10⁻⁶. 10 cfu / mL.

[0009] The present invention provides the application of the above-mentioned rhizobium inoculant in promoting plant nodulation, nitrogen fixation and / or growth.

[0010] The aforementioned novel slow-growing rhizobium species SBR26 or rhizobium inoculants can replace part of the nitrogen fertilizer and, together with phosphate and potassium fertilizers, form microbial fertilizers. Based on this, the present invention provides the application of the aforementioned novel slow-growing rhizobium species SBR26 or rhizobium inoculants in the preparation of microbial fertilizers.

[0011] This invention provides a microbial fertilizer containing the aforementioned new species of slow-growing rhizobium SBR26 or rhizobium inoculant, phosphate fertilizer, and potassium fertilizer.

[0012] This invention provides a rhizobium seed dressing agent containing the aforementioned novel slow-growing rhizobium species SBR26. The seed dressing agent may also contain trace elements, sodium carboxymethyl cellulose, and / or pesticides. The pesticides may be selected from metalaxyl-mancozeb, carbendazim, thiamethoxam, or imidacloprid.

[0013] Preferably, in the seed coating agent, the concentrations of metalaxyl-mancozeb are ≤200ppm, carbendazim is ≤1667ppm, thiamethoxam is ≤60ppm, and imidacloprid is ≤93ppm.

[0014] This invention provides a seed coating method, the steps of which are as follows:

[0015] Add trace element stock solution to the above-mentioned slow-growing rhizobium species SBR26 bacterial solution, mix well to form a mixed bacterial solution; then spray the mixed bacterial solution evenly on the seed surface and air dry; use sodium carboxymethyl cellulose solution to coat the air-dried seeds again, and air dry.

[0016] If pesticide coating is required for seeds, after the seeds have been treated with a solution of the new species of slow-growing rhizobium SBR26 and sodium carboxymethyl cellulose, they can be coated with a pesticide dilution of the appropriate concentration to achieve pesticide coating.

[0017] The above seed coating process can also be carried out directly using the above-mentioned rhizobium seed coating agent.

[0018] The above-mentioned new species of slow-growing rhizobium SBR26 was obtained by culturing the new species SBR26 in TY liquid medium; the concentration of the new species SBR26 in the bacterial solution was 1×10⁻⁶. 10 cfu / mL.

[0019] The composition of the aforementioned trace element stock solution is as follows: H3BO3 2.86 g / L, MnSO4 1.81 g / L, CuSO4·5H2O 0.80 g / L, ZnSO4 0.22 g / L, H2MoO4 0.02 g / L, with the balance being water; wherein, the function of the trace elements is to provide nutrients for plants.

[0020] The above-mentioned sodium carboxymethyl cellulose solution was selected from an aqueous solution containing sodium carboxymethyl cellulose at a final concentration of 10 g / L, i.e., a concentration of 1%.

[0021] The volume ratio of the above-mentioned trace element stock solution to the SBR26 bacterial culture of the slow-growing rhizobium species is selected as 1:1000. That is, the amount of trace element stock solution added to the bacterial culture can be selected as: 1 mL of the trace element stock solution per 1000 mL of the bacterial culture.

[0022] The amount of the above mixed bacterial solution used is 150 mL / 30 kg of seeds.

[0023] The amount of sodium carboxymethyl cellulose solution used was 150 mL / 30 kg of seeds, used to maintain the adhesion of the new species of slow-growing rhizobium SBR26 and the moisture content of the seed surface.

[0024] In this invention, the plant is selected from legumes; preferably peanuts.

[0025] The beneficial effects of this invention are as follows:

[0026] The novel slow-growing rhizobium species SBR26 provided by this invention can tolerate some fungicides and insecticides, while also exhibiting strong nitrogen tolerance and nodulation nitrogen-fixing capabilities, thus possessing the ability to conserve nitrogen and promote high yields. In field planting conditions where nitrogen fertilizer application is reduced by 50%, this strain can significantly improve crop nitrogen fixation and growth performance, not only reducing nitrogen fertilizer application but also ensuring the proper implementation of pesticides, ultimately increasing crop yield. Attached Figure Description

[0027] Figure 1 This is a diagram showing the colony morphology of SBR26 on TY medium.

[0028] Figure 2 Gram staining image of SBR26 bacterial cells;

[0029] Figure 3 Phylogenetic tree of 16S rDNA and atpD for SBR26;

[0030] Figure 4 The recA and nifH phylogenetic trees of SBR26;

[0031] Figure 5 For the determination of SBR26's pesticide resistance;

[0032] Figure 6 The symbiotic relationship between peanuts inoculated with SBR26 under greenhouse cultivation conditions;

[0033] Figure 7 To investigate the symbiotic relationship between SBR26 inoculated peanuts and different concentrations of KNO3.

[0034] Figure 8 The growth of SBR26-inoculated peanuts under field cultivation conditions in 2023. Detailed Implementation

[0035] 1. Test materials

[0036] (1) The culture medium, reagents and other materials used in this invention are as follows:

[0037] TY medium: 5g tryptone, 3g yeast extract and 0.6g CaCl2, 1000mL deionized water, pH 6.8-7.2, 15-20g agar (solid medium), sterilized at 121℃ for 30min.

[0038] YMA medium: mannitol 10.0g, K2HPO4 0.25g, KH2PO4 0.25g, MgSO4 0.1g, NaCl 0.1g, yeast extract 3.0g, deionized water 1000mL, pH 6.8~7.0, agar 15~20g (solid medium), sterilized at 121℃ for 20min.

[0039] Blood agar medium: 18g peptone, 1g yeast extract, 5g NaCl, 15-20g agar (solid medium), 1000mL deionized water, pH 6.8-7.2. Sterilize at 121℃ for 20min. After the medium cools to 50℃, add 5% (5mL / 100mL) defibrinated sheep blood, mix well, and pour into plates.

[0040] 20× Low-nitrogen nutrient solution for plants: 0.075g ferric citrate, 0.03g Ca(NO3)2, 0.136g K2HPO4, 0.46g CaSO4, 0.075g KCl, 0.06g MgSO4·7H2O, 20mL trace element stock solution, and 1000mL deionized water.

[0041] Trace element stock solution: H3BO3 2.86g, H2MoO4 0.02g, ZnSO4 0.22g, CuSO4·5H2O 0.8g, MnSO4 1.81g, deionized water 1000mL.

[0042] Sterile saline solution: NaCl 0.8g, deionized water 100mL, sterilized at 121℃ for 30min.

[0043] Water agar medium: 0.6g agar powder, 100mL deionized water, sterilize at 121℃ for 30min.

[0044] 5mM KNO3 solution: 50.5g KNO3, 100mL deionized water, sterilized at 121℃ for 30min.

[0045] Sodium carboxymethyl cellulose solution (seed surface protectant): Dissolve 1g of sodium carboxymethyl cellulose (800-1200mPa·s) in 100mL of deionized water at 60℃ and stir until a transparent paste-like solution is obtained.

[0046] Pesticide solid culture medium: Commonly used herbicides, fungicides, and insecticides in peanut cultivation in Shandong Province were selected. Four concentration gradients were set up according to the highest concentration in the instructions, decreasing in descending order. The dosage of each gradient / 30mL was calculated (Table 1). After sterilization, the TY solid culture medium was cooled to about 50℃, and the pesticide amounts of the four concentration gradients were quickly added. After rapid mixing, the medium was poured into plates, and three replicate plates were set up for each concentration gradient.

[0047] Table 1. Pesticide gradient settings and corresponding pesticide contents used in the experiment.

[0048]

[0049]

[0050] The nitrogen, phosphorus, and potassium fertilizers applied in the field are conventional urea, calcium magnesium phosphate, and potassium sulfate.

[0051] (2) Primer information

[0052] The primers used in this invention are shown in Table 2:

[0053] Table 2

[0054]

[0055] The genome extraction kit, Taq Mix for PCR amplification, and ddH2O were all from Kangrun Biotechnology Co., Ltd.

[0056] 2. Isolation and Identification of Microbial Strains

[0057] Peanut root nodules were collected on July 10, 2020, in Rongcheng City, Shandong Province. After sterilization with 75% alcohol solution for 1 min, sodium hypochlorite solution (sodium hypochlorite:water = 1:5) for 7 min, and washing with sterile water 8 times, sterile root nodules were obtained. The sterile root nodule tissue fluid was streaked onto YMA solid medium and incubated at 28℃ for 14 days. After colonies grew, single colonies were picked, purified three times on TY solid medium, and stored at -80℃. This strain was designated SBR26.

[0058] Following the methods described in Berger's Manual of Bacterial Identification (8th Edition), strain SBR26 was identified, and the specific results are as follows:

[0059] (1) Morphological and biological characteristics

[0060] Strain SBR26 was inoculated onto TY solid medium and incubated at 28°C for 7 days. The colony morphology included: small, opaque, milky-white, round colonies with a smooth, moist surface. Figure 1 As shown. Gram staining produces red rod-shaped stalks, indicating that this strain is a Gram-negative bacillus. Figure 2 As shown.

[0061] (2) Genetic characteristics

[0062] 16S rDNA, atpD, recA, and nifH sequence sequencing:

[0063] Genomic DNA was extracted from strain SBR26 and amplified by PCR using universal 16S rDNA primers 16S rDNA P1 / P6, primers atpD255 F / R for the housekeeping gene atp D, primers recA41 F / R for the housekeeping gene rec A, and primers nifHF / R for the symbiotic gene nif H.

[0064] The amplification system was 50 μL.

[0065] 25 μL Taq Mix, 22 μL ddH2O, 1 μL forward primer P1 / F (concentration 10 μmol / L), 1 μL reverse primer P6 / R (concentration 10 μmol / L), and 1 μL DNA template.

[0066] The amplification reaction conditions are:

[0067] The PCR sequence was performed at 95℃ for 5 min, 94℃ for 1 min, 60℃ / 58℃ for 30 s, and 72℃ for 90 s for 30 cycles; a final extension at 72℃ for 10 min was then performed. PCR primer synthesis and sequencing were performed by Qingke Sequencing Company.

[0068] Sequencing results:

[0069] The paired-end sequencing sequences were assembled using DNAMAN software, yielding a total of 1350 bp 16S rDNA sequence, the nucleotide sequence of which is shown in SEQ ID No:1.

[0070] 16S rDNA sequence (SEQ ID No:1):

[0071]

[0072] The 541 bp housekeeping gene atp D sequence was obtained, and its nucleotide sequence is shown in SEQ ID No:2.

[0073] atp D sequence (SEQ ID No:2):

[0074] TATTTCATCGATCGATGAGCCGGTCCCGTCAAGTCGGAAGGCCTGCGCGATCCACCAGGAAGCGCCCACCTACACCGACCAGTCGACCGAAGCTGAAATTCTCGTCACCGGCATCAAGGTCGTCGACCTGCTC GCTCCGTATGCCAAGGGCGGCAAGATCGGCCTGTTCGGCGGCGCCGGCGTCGGCAAGACCGTGCTGATTCAGGAGCTGATCAACAACGTCGCGAAGGCGCACGGCGGTTACTCCGTGTTCGCCGGCGTCGGCGAG CGTACCCGCGAAGGCAACGACCTCTATCACGAGTTCATCGAGTCCAAGGTCAACGCCGATCCGAAGAATCCGGATCCGAGCGTGAAGTCGAAGTGCGCGCTGGTGTTCGGCCAGATGAACGAGCCGCCGGGCGCC CGCGCCCGCGTCGCGCTCACCGGTCTGACCATTGCGGAAGACTTCCGCGACAGGGGCCAGGACGTGCTGTTCTTCGTCGACAACATCTTCCGCTTCACCCAGGCAGGTTGAAAGGGGGGGGGCGAAAAAAAACCCCC

[0075] The 525bp housekeeping gene rec A sequence was obtained, and its nucleotide sequence is shown in SEQ ID No:3.

[0076] rec A sequence (SEQ ID No:3):

[0077] TGGGGACGATCGTTCGATGGACATCGAGGCGGTCTCGTCGGGCTCGCTGGGGCTGGACATCGCGCTCGGCATCGGCGGCCTGCCCAAGGGGCGTATCGTCGAGATCTACGGGCCGGAATCGTCGGGCAAGACCACCCTGGCGCTGCATACCGTGGCGGAAGCCCAGAAGAAGGGCGGCATTTGCGCCTTCATCGACGCCGAGCACGCGCTCGACCCGGTCTATGCCCGCAAGCTCGGGGTCAACATCGACGAGCTCTTGATCTCGCAACCCGACACCGGCGAGCAGGCGCTGGAAATCTGCGACACGCTGGTGCGCTCGGGTGCGGTGGATGTGCTGGTGGTCGATTCGGTCGCGGCGCTGGTGCCGAAGGCCGAGCTCGAAGGCGAGATGGGCGATGCACTGCCGGGTCTTCAAGCGCGGTTGATGAGCCAGGCGCTGCGCAAGCTGACCGCCTCGATCAACAAGTCCAACACCATGGTGATCTTCATCAACCAGATCCGCATGAAGACGGCGGTTCATGGAAA

[0078] A 748 bp symbiotic gene nif H sequence was obtained, and its nucleotide sequence is shown in SEQ ID No:4.

[0079] nif H sequence (SEQ ID No:4):

[0080] GGGTTGTTCGCGACCGCTGGCGGCGTTAGCCGAGATGGGTCAGAAAATCCTGATTGTAGGATGCGATCCGAAGGCAGATTCGACCCGCCTGATTCTGCACGCCAAGGCGCAGGACACGATTTTGAGCCTTGCCGCGAGCGCCGGCAGCGTGGAGGACCTAGAACTGGAAGACGTCATGAAGGTCGGCTACAAGGACATTCGTTGCGTGGAGTCCGGTGGTCCTGAGCCAGGTGTCGGCTGTGCCGGCCGCGGTGTCATCACCTCGATCAATTTTCTGGAAGAGAACGGCGCTTACGAGAACATCGACTATGTCTCGTACGACGTGCTTGGCGACGTTGTTTGCGGCGGCTTTGCGATGCCAATCCGCGAGAATAAGGCGCAGGAAATCTACATCGTGATGTCCGGTGAAATGATGGCGATGTATGCCGCGAACAACATCTCCAAGGGCATCCTAAAATACGCGAACTCTGGCGGCGTGCGGCTGGGCGGTCTGATCTGCAACGAGCGGCAGACTGACAAGGAGCTGGAGCTAGCGGAAGCGTTAGCCAAGAAGCTAGGCACTCAGCTGATCTACTTCGTGCCGCGCGACAACGTGGTGCAGCATGCAGAATTACGCAGGATGACGGTTCTCGAATATGCACCCGATTCCAAGCAGGCTGATCACTATCGCAATCTTGCAACCAAGGTTCACAATAATGGCGGCAAGGGCATCATCCCCACCCCGATCTCCTGATACGTTAAAAAATAT

[0081] BLAST alignment was performed on the NCBI website, and the ML method was used to construct an evolutionary tree for SBR26 and strains with similar sequences. The results are as Figure 3 and Figure 4As shown, the 16S rDNA sequence of strain SBR26 can cluster with all Bradyrhizobium species. Based on its morphological and biological characteristics, this strain is identified as belonging to the genus *Bradyrhizobium* (*Bradyrhizobium sp. strainSBR26*). The housekeeping gene recA phylogenetic tree shows that SBR26 clusters with *Bradyrhizobium sp. CCBAU 53338*. The housekeeping gene atpD phylogenetic tree shows that SBR26 and *Bradyrhizobium sp. CCBAU 53338* share a common evolutionary ancestor, but differ in their evolutionary stages. The symbiotic gene nifH phylogenetic tree shows that SBR26 clusters with *Bradyrhizobium sp. SCAUd29*, but cannot cluster with *Bradyrhizobium sp. CCBAU 53338* at all. Therefore, SBR26 is different from the closely related Bradyrhizobium sp. CCBAU 53338 and belongs to an unnamed new species.

[0082] This bacterium was deposited on November 23, 2023, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 29122. The proposed classification name is Bradyrhizobium sp.

[0083] 3. Safety testing

[0084] Strain SBR26 was inoculated into blood agar medium and incubated at 28°C for 14 days. The presence or absence of hemolysis zones was observed. The appearance of hemolysis zones indicates that the strain has hemolytic activity and poses a potential threat to humans and animals; therefore, the strain should not be used in microbial fertilizers. The absence of hemolysis zones indicates that the strain has no hemolytic activity and is a safe strain that can be used in microbial fertilizers. The results showed that after 14 days of incubation on blood agar plates, no hemolysis zones appeared, indicating negative hemolytic activity. This demonstrates that the strain is a safe strain and can be safely used in microbial fertilizers.

[0085] Other materials used in this invention, unless otherwise stated, are commercially available. Other terms used in this invention, unless otherwise specified, generally have the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and not intended to limit the scope of the invention in any way.

[0086] Example 1

[0087] Pesticide resistance testing:

[0088] Strain SBR26 was inoculated into TY liquid medium and cultured at 37°C with shaking at 180 rpm / min for 4 days. The OD of the bacterial culture was measured using sterile physiological saline. 600nm Adjust the temperature to 0.2. Spot 2 μL of bacterial suspension onto the pesticide solid culture medium and incubate at 37°C for 7 days, then observe the colony growth.

[0089] The experimental results are shown in Table 3 and Figure 5 As shown, where Figure 5 This displays the colony growth status of bacteria that tolerate the highest concentrations of pesticides:

[0090] Table 3. Results of drug resistance identification for strain SBR26

[0091]

[0092]

[0093]

[0094] Note: + indicates that the strain is growing normally; - indicates that the strain is not growing.

[0095] The results showed that strain SBR26 tolerated insecticides imidacloprid and thiamethoxam at concentrations of 93 ppm and 60 ppm, respectively, and fungicides metalaxyl-mancozeb and carbendazim at concentrations of 200 ppm and 1667 ppm, respectively. These results indicate that in peanut cultivation, strain SBR26 can be used in combination with appropriate concentrations of imidacloprid, thiamethoxam, metalaxyl-mancozeb, or carbendazim to form a seed dressing agent that combines slow-growing rhizobia with pesticides.

[0096] Example 2

[0097] Tests on the ability of nodule growth to promote growth:

[0098] A low-nitrogen nutrient solution for plants was prepared by mixing 100 mL of the solution with 1 kg of vermiculite, adding an appropriate amount of deionized water to keep the vermiculite moist, and sterilizing at 121℃ for 90 min. The peanut variety used in the experiment was BS1016. The seed disinfection procedure was as follows: disinfection with 75% alcohol solution for 1 min, disinfection with sodium hypochlorite solution (sodium hypochlorite:water = 1:4) for 10 min, rinsing with sterile water 8 times and soaking for 10 min, and germinating the sterile seeds in the dark on water agar medium for 4 days. Strains SBR26 and the control strain Bradyrhizobium zhanjiangense CCBAU 51778 were compared. T (A model strain exhibiting normal symbiotic effects) was inoculated into TY liquid medium and cultured at 28°C with shaking at 180 rpm / min for 5 days. The OD of the bacterial culture was measured using sterile physiological saline. 600nmAdjust to 0.2. Peanuts were grown using a double-layer pot method. The upper layer contained sterile vermiculite, and the lower layer contained sterile water. The upper layer of vermiculite absorbed the sterile water from the lower layer via a sterile gauze strip. Germinated peanut seeds were planted in the vermiculite and inoculated with 1 mL of SBR26 bacterial solution and 1 mL of CCBAU51778. T Bacterial suspension or sterile physiological saline was used as the SBR26 treatment group (SBR26) and CCBAU 51778, respectively. T The positive control group (51778) and the negative control group (CK) were each replicated with 10 peanut plants. The peanuts were cultured in a greenhouse at 28°C with 12 hours of artificial light followed by 12 hours of darkness. Peanut symbiotic phenotypes, including root nodule number, root nodule fresh weight, chlorophyll content, and aboveground dry weight, were assessed on day 40 post-inoculation.

[0099] The test results are shown in Table 4 and Figure 6 As shown:

[0100] (1) The number of root nodules, fresh weight of root nodules and chlorophyll content of SBR26 treatment and 51778 positive control treatment were significantly higher than those of CK negative control treatment, indicating that rhizobium SBR26 and 51778 can form nodules with peanuts and provide nitrogen source for leaves through root nodule nitrogen fixation, thereby significantly increasing chlorophyll content.

[0101] (2) The aboveground dry weight of SBR26 treatment was significantly higher than that of CK treatment, indicating that SBR26 has the ability to promote peanut growth;

[0102] (3) The number of root nodules and the fresh weight of root nodules in the SBR26 treatment were significantly higher than those in the 51778 control treatment, indicating that the nodulation ability of SBR26 was significantly higher than that of 51778.

[0103] The above results indicate that SBR26 has a strong nodulation ability, as well as the ability to increase peanut chlorophyll content and promote peanut growth.

[0104] Table 4. Symbiotic phenotypes of peanuts inoculated with SBR26 under greenhouse cultivation conditions (P<0.05)

[0105] deal with Nodule count Fresh weight of root nodules (g / plant) Chlorophyll content Dry weight above ground (g / plant) CK 0c 0c 35.25±1.20b 1.42±0.12b 51778 67.33±8.33b 0.10±0.01b 44.73±0.55a 1.86±0.16ab SBR26 122.40±22.45a 0.21±0.02a 44.55±0.50a 2.44±0.30a

[0106] Example 3

[0107] Nitrogen resistance test:

[0108] The disinfection and planting methods for peanut BS1016 seeds are described in Example 2. SBR26 and the control rhizobium strain Bradyrhizobium guangxiense CCBAU 51778 were also used. T Inoculate into TY liquid medium and incubate at 28°C with shaking at 180 rpm / min for 5 days. OD500 of the bacterial culture is then determined using sterile physiological saline.600nm Adjust the concentration to 0.2. Plant the germinated peanut seeds in vermiculite and inoculate with 1 mL of SBR26 bacterial solution or CCBAU 51778. T The control rhizobium culture was used as the SBR26 treatment group and the control rhizobium (51778) treatment group, respectively. Each inoculation treatment group included three nitrogen treatments: adding 1 mL of sterile physiological saline, 1 mL of 5 mM KNO3 solution, and 2 mL of 5 mM KNO3 solution to form 0 mM KNO3, 5 mM KNO3, and 10 mM KNO3 treatments, respectively. Each nitrogen treatment was replicated with 10 peanut plants. The peanuts were cultured in a greenhouse at 28℃ with 12 hours of artificial light and 12 hours of darkness. The symbiotic phenotype of the peanuts was assessed on day 40 post-inoculation.

[0109] The test results are shown in Table 5 and Figure 7 As shown:

[0110] In the 5mM and 10mM KNO3 treatments, the number of root nodules and the fresh weight of root nodules treated with SBR26 were significantly higher than those treated with the control 51778, indicating that SBR26 can form root nodules under nitrogen-inhibited peanut nodulation, that is, the SBR26 strain has good nitrogen-resistant nodulation ability.

[0111] Table 5. Symbiotic phenotypes of SBR26-inoculated peanuts under different KNO3 concentrations in greenhouse cultivation conditions (P<0.05)

[0112]

[0113] I. Field Application

[0114] Before applying it in the field, the following preparations should be made:

[0115] 1) Activation and scale-up culture of the strain:

[0116] The SBR26 strain, stored at -80℃, was activated on YMA solid medium using a three-zone streak pattern and incubated at 28℃ for 14 days. Single colonies were then inoculated onto TY liquid medium for expansion, and cultured at 28℃ with shaking at 180 rpm until the bacterial concentration reached 1×10⁻⁶. 10 CFU / mL. Before use, add trace element stock solution (1 mL / 1000 mL) to the bacterial agent and mix well.

[0117] 2) Peanut seed coating:

[0118] Spray the inoculant evenly onto the seed surface until it is moist, then place it in a cool, shady place to dry. After drying, treat the seeds with a 1% sodium carboxymethyl cellulose solution (150 mL / 30 kg of seeds) to maintain the inoculant's adhesion and moisture, then continue drying in the shade.

[0119] 3) Watering before sowing:

[0120] Sowing can be done manually or by machine. Water the soil 3 days before sowing to ensure the necessary moisture for the survival of the strain and seed germination.

[0121] 4) Peanut field planting, as shown below:

[0122] The experiment was conducted at the Shandong Peanut Research Institute base in Laixi City, Shandong Province. The peanut variety used was Huayu 917. The sowing dates were April 30, 2022 (sowing location: north of Xipodi Road) and May 13, 2023 (sowing location: south of Xipodi Road). Since the conventional pure nitrogen application rate is 120 kg / ha, the pure nitrogen application rate was 60 kg / ha when nitrogen was reduced by 50% in the experimental field. Based on this, the urea application rate was deduced to be 135 kg / ha when nitrogen was reduced by 50%. The conventional application rates of phosphate fertilizer (calcium magnesium phosphate) and potassium fertilizer (potassium sulfate) were 750 kg / ha and 240 kg / ha, respectively. The conventional fertilization level can be found in the literature "Wang Chunxiao et al. Effects of different nitrogen fertilizer application rates and organic fertilizer application on peanut senescence and nodulation. Peanut Journal, 2023, 52(2):1-7." All fertilizers were mixed as base fertilizer and applied to the soil at one time.

[0123] The land was prepared and ridged using conventional methods, with ridges 0.85m wide and 0.4m apart. One acre was divided into 6 plots. Two treatments were included: a control (CK) without inoculation and a treatment inoculated with SBR26 strain. Each treatment had 3 plots, and all plots were randomly distributed. The biological agent used was SBR26, a slow-growing rhizobium.

[0124] Peanuts were planted in two rows per ridge, with two seeds per hole and a hole spacing of 0.02m. Peanut cultivation followed conventional methods. Samples were taken on July 31, 2023, to determine the peanut symbiotic phenotype during the pod-forming stage, including indicators such as the number of root nodules, main stem height, number of lateral branches, number of pods, number of pegs, lateral branch length, pod dry weight, and above-ground dry weight. Peanut yield was measured in each plot on September 27, 2022, and September 22, 2023. Specifically, a 2m long ridge with uniform peanut growth was measured, all peanut pods within this area were harvested, naturally dried, and the dry weight of the pods with shells was measured. The yield per hectare was calculated using the following formula:

[0125] Peanut yield per mu = Dry weight of peanuts / (0.85 × 2) × 666.7

[0126] Peanut yield per hectare = Dry weight of peanut kernels / (0.85 × 2) × 666.7 × 15

[0127] Tests showed that peanuts inoculated with SBR26 in both years had higher growth indicators than the control group. The following results mainly show the indicators for 2023.

[0128] The test results are shown in Tables 6-7 and Figure 8 As shown:

[0129] Table 6. Peanut pod-setting growth parameters after application of SBR26 inoculant in 2023

[0130]

[0131]

[0132] Table 7 Peanut yield using SBR26 inoculant.

[0133]

[0134] The results showed that, under the premise of reducing nitrogen fertilizer application by 50%, the slow-growing rhizobium SBR26 could increase the number of root nodules, main stem height, number of lateral branches, number of pods, number of pegs, length of lateral branches, dry weight of pods, and above-ground dry weight during the pod-forming stage, thereby increasing peanut yield by 4.42%–7.32%. This indicates that SBR26 has significant potential for field application in reducing nitrogen and promoting high yield, and can be used as a stable and efficient microbial fertilizer strain resource.

[0135] It is worth noting that the number of peanut root nodules in the current year is significantly related to the nitrogen residue in the previous year's plot. If the previous year's plot had a high nitrogen residue, then during peanut cultivation, excess nitrogen fertilizer will inhibit the growth and number of peanut root nodules, resulting in significant differences in the number of root nodules for the same peanut variety when planted in different plots. However, this does not affect the experimental results of this invention. The purpose of this invention is to provide a strain that can improve the nitrogen fixation capacity of peanuts. Obviously, as shown in the above experimental results, the SBR26 strain provided by this invention can increase the number of peanut root nodules in the current year's planting, affect its various growth indicators, and ultimately increase peanut yield.

[0136] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A new species of slow-growing rhizobium ( Bradyrhizobium sp. SBR26, characterized in that, The strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 23, 2023, with accession number CGMCC No. 29122.

2. The use of the novel slow-growing rhizobium species SBR26 of claim 1 in promoting plant nodulation, nitrogen fixation and / or growth.

3. A rhizobium inoculant, characterized in that, The inoculum contains the novel species of slow-growing rhizobium SBR26 as described in claim 1.

4. The rhizobium inoculant according to claim 3, characterized in that, The formulation of the rhizobium inoculant is selected from liquid inoculant, powder or granule.

5. The application of the new slow-growing rhizobium species SBR26 of claim 1 or the rhizobium inoculant of claim 3 in the preparation of microbial fertilizers.

6. A microbial fertilizer, characterized in that, The fertilizer contains the new slow-growing rhizobium species SBR26 as described in claim 1 or the rhizobium inoculant as described in claim 3, phosphate fertilizer, and potassium fertilizer.

7. A rhizobium seed coating agent, characterized in that, The seed dressing agent contains the novel slow-growing rhizobium species SBR26 as described in claim 1.

8. The seed coating agent according to claim 7, characterized in that, The seed dressing agent also contains trace elements, sodium carboxymethyl cellulose, and / or pesticides; the pesticides may be selected from metalaxyl-mancozeb, carbendazim, thiamethoxam, or imidacloprid.

9. The seed coating agent according to claim 8, characterized in that, The seed coating agents contain metalaxyl-mancozeb at a concentration of ≤200 ppm, carbendazim at a concentration of ≤1667 ppm, thiamethoxam at a concentration of ≤60 ppm, and imidacloprid at a concentration of ≤93 ppm.

10. A seed coating method, characterized in that, The steps are as follows: A trace element stock solution was added to the above-mentioned SBR26 serovar Slow-growing rhizobium bacterial solution, and the mixture was stirred to form a mixed bacterial solution. The mixed bacterial solution was then evenly sprayed onto the seed surface and air-dried. The air-dried seeds were then coated again with sodium carboxymethyl cellulose solution and air-dried. The SBR26 serovar Slow-growing rhizobium bacterial solution was obtained by culturing the above-mentioned SBR26 serovar Slow-growing rhizobium on TY liquid medium. The concentration of SBR26 serovar Slow-growing rhizobium in the bacterial solution was 1 × 10⁻⁶. 10 The trace element stock solution has the following composition: H3BO3 2.86 g / L, MnSO4 1.81 g / L, CuSO4·5H2O 0.80 g / L, ZnSO4 0.22 g / L, H2MoO4 0.02 g / L, with the remainder being water; wherein, the trace elements are used to provide nutrients for plants; the sodium carboxymethyl cellulose solution is selected from an aqueous solution containing sodium carboxymethyl cellulose at a final concentration of 10 g / L.

Images