Recombinant lactic acid bacteria expressing HSV-1 gD-IL-2-Fc fusion gene and uses thereof
By constructing a recombinant lactic acid bacteria expressing the HSV-1gD-IL-2-Fc fusion gene, the problem of HSV-1 vaccine transmucosal transport was solved, the immune response was enhanced, and effective HSV-1 immune protection was achieved.
Patent Information
- Application Number
- CN202310578200.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-22
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2043-05-22
AI Technical Summary
Current HSV-1 vaccine research is not yet mature, and existing anti-HSV-1 drugs have problems with significant adverse reactions and cross-resistance. Fusion proteins have difficulty crossing the respiratory mucosal barrier to enter the body, affecting treatment efficacy.
A recombinant lactic acid bacteria expressing the HSV-1gD-IL-2-Fc fusion gene was constructed. By inserting the HSV-1gD gene, IL-2 gene, and IgG Fc fragment into the lactic acid bacteria expression vector, the FcRn was used to mimic the IgG transmucosal barrier transport pathway, and IL-2 was used as a vaccine adjuvant to enhance the immune response.
It increased antibody titers, enhanced the amplification of T lymphocytes and germinal center B cells, reduced vaccine side effects, and achieved effective HSV-1 immune protection.
Smart Images

Figure CN117844717B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biological products, and particularly relates to a recombinant lactic acid bacteria expressing an HSV-1 gD-IL-2-Fc fusion gene and use thereof. BACKGROUND
[0002] Herpes simplex virus type 1 (HSV-1) is a common herpes virus, which is mainly transmitted through respiratory tract, skin and mucosal close contact, and can cause herpes stomatitis, herpes keratitis, etc., and can also cause pneumonia, especially in patients with low immunity such as organ transplantation, resulting in lung lesions and causing acute exacerbation of pulmonary fibrosis. HSV-1 can be latent in the trigeminal ganglion for life, and the virus can persist in the host body but the host itself does not show any related clinical symptoms; the HSV-1 virus in latent infection can be reactivated from the latent state and accompanied by the production of infectious virus particles; the virus is in a latent infection state, does not express any related proliferative genes, but a large number of latency-associated transcripts (Latency-Associated transcripts, LATs) accumulate in the host cell nucleus; the virus does not express related antigens, but the presence of the viral genome can be detected in the host body.
[0003] At present, the research on the vaccine against HSV-1 has not yet matured, and in addition to some supportive treatment in the clinic, the main method is to take nucleos(t)ide anti-HSV-1 drugs represented by acyclovir, valacyclovir, etc. to control symptoms and recurrence. However, such drugs have large adverse reactions, and cross-resistance is increasing year by year. Therefore, we try to find new treatment methods to make up for the gap in the treatment of HSV-1.
[0004] HSV vaccine research has been carried out for many years and has made some progress, but the current research on HSV vaccine still stays in the stages of in vitro experiment, animal experiment and pre-marketing clinical trial, and there is no HSV vaccine approved for marketing worldwide. And the existing expressed antigen gene fusion protein in other forms cannot effectively transport into the body by crossing the respiratory mucosal barrier through nasal instillation, affecting the effect. SUMMARY
[0005] In view of the above technical problems, the present application provides a recombinant lactic acid bacteria expressing an HSV-1 gD-IL-2-Fc fusion gene.
[0006] In a first aspect, the present application provides a recombinant lactic acid bacteria expressing an HSV-1 gD-IL-2-Fc fusion gene, which is obtained by inserting an HSV-1 gD gene, an IL-2 gene and an IgG Fc fragment gene into a lactic acid bacteria expression vector and transforming lactic acid bacteria.
[0007] Preferably, it is obtained according to the following steps:
[0008] The HSV-1 gD gene is fused with the IL-2 gene through a linker 1 by fusion PCR to obtain gD-IL-2;
[0009] The gD-IL-2 is fused with the IgG Fc gene through a linker 2 by fusion PCR to obtain a fusion fragment gD-IL-2-Fc;
[0010] The fusion fragment gD-IL-2-Fc is connected to a pUC57 vector to obtain a recombinant vector pUC57-gD-IL-2-Fc;
[0011] The HSV-1 gD gene, the IL-2 gene and the IgG Fc gene are amplified by taking the recombinant vector pUC57-gD-IL-2-Fc as a template, and a target fragment containing the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene is recovered; then the target fragment containing the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene is amplified by fusion PCR to obtain gD-IL-2-Fc;
[0012] The pNZ8148 plasmid and the gD-IL-2-Fc are double-digested by NcoI and KpnI respectively, the obtained digestion products are connected, and a connection product is obtained;
[0013] The connection product is electro-transformed into lactococcus lactis NZ3900 competent cells to obtain recombinant lactococcus lactis expressing the HSV-1 gD-IL-2-Fc fusion gene;
[0014] The nucleotide sequence of the linker 1 is shown as SEQ ID NO: 2, and the nucleotide sequence of the linker 2 is shown as SEQ ID NO: 4.
[0015] Preferably,
[0016] The primer sequence for amplifying the HSV-1 gD gene is F1:
[0017] CATG CCATGG CCATGCATCACCATCATCATCATAAGTACGCTCTGGC, as shown in SEQ ID NO: 6;
[0018] R1: CGAGCCACCTCCTCCGGACCCACCCCCGCC GAGAAAGGGCTGGTCGGTACT, as shown in SEQ ID NO: 7;
[0019] The primer sequence for amplifying the IL-2 gene is F2: GGCGGGGGTGGGTCCGGAGGAGGTGGCTCG GCATGCGCTCCGACTTCTAG, as shown in SEQ ID NO: 8;
[0020] R2-2: AGATCCCGAGCCACCTCCTCCGGACCCACCCCCGCCTGATCC AGTCAGAGTAGAGATGATAGACTGAGAGA, as shown in SEQ ID NO: 10;
[0021] The primer sequence for amplifying the IgG Fc gene is as follows:
[0022] F3: GGATCAGGCGGGGGTGGGTCCGGAGGAGGTGGCTCGGGATCT GAGCCCAGAGGGCCCACA, as shown in SEQ ID NO: 11;
[0023] R3: AAT GGTACC AATGGTACCCATTTACCCGGAGTCCGGG, as shown in SEQ ID NO: 12.
[0024] Preferably, the amplification reaction system for fusion PCR amplification and amplification of the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene is as follows: 2x PrimeSTAR Premix 25 μL, pUC57-gD-IL-2-Fc 1 μL, upstream primer 1 μL, downstream primer 3 μL, ddH2O 20 μL.
[0025] Preferably, the amplification conditions for fusion PCR amplification and amplification of the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene are as follows: 98℃ for 3 min, 98℃ for 15 sec, 58℃ for 15 sec, 72℃ for 10 s, 30 cycles of 72℃ for 10 min.
[0026] Preferably, the enzyme digestion system for double enzyme digestion is as follows: 10 μL of the expression vector or PCR product, 1.5 μL of NcoI, 1.5 μL of KpnI, 3 μL of 10x Fast digestion.
[0027] In the second aspect of the present application, the recombinant lactic acid bacteria are used for preparing immunomodulatory products.
[0028] Preferably, the recombinant lactic acid bacteria are used for preparing vaccines against HSV-1.
[0029] Compared with the prior art, the present application has the following beneficial effects:
[0030] 1. The HSV-1 envelope protein gD is fused with the IgG Fc fragment, and the transport pathway of IgG across the mucosal barrier is simulated by means of FcRn, thereby solving the key problem of mucosal transmission. At the same time, the gD-IL-2-Fc has FcγRI binding sites, which is more conducive to the recognition and uptake of antigen-presenting cells.
[0031] 2. Fusion IL-2 as vaccine adjuvant, compared with vaccine alone, the antibody titer of animal IL-2 fusion vaccine is higher, and T follicular helper cells and germinal center B cells are expanded.
[0032] 3. Lactococcus lactis is selected as a transport carrier of exogenous protein, can be directly taken orally, avoids infection caused by intravenous injection of vaccine, and the vaccine itself has small side effects, the lactococcus lactis is easy to culture and operate and has low cost, and some special strains of lactococcus lactis can colonize in the intestinal tract to improve the immune function of the body. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 PCR amplification of recombinant plasmid; M: DNA marker, 1: gD-IL-2-Fc, 2: gD-IL-2;
[0034] Figure 2 Restriction enzyme identification of recombinant plasmid; M: DNA marker, 1: gD-IL-2-Fc, 2: gD-IL-2;
[0035] Figure 3 SDS-PAGE and Western blot detection of fusion protein; M: Protein marker, 1: Negative Control, 2: gD-IL-2, 3: gD-IL-2-Fc;
[0036] Figure 4 Effect of recombinant lactococcus on serum IFN-γ (A), IL-4 (B), IgG (C) levels of mice;
[0037] Figure 5 Effect of recombinant lactococcus on immune function of mice; A, detection of serum IgA level of immunized mice, B, proliferation change of peripheral blood T lymphocytes of immunized mice, C, proliferation change of spleen T lymphocytes of immunized mice;
[0038] Figure 6 Recombinant lactococcus resists HSV-1 infection;
[0039] Figure 7 HE section observation of lung tissue of recombinant lactococcus immunized mice after challenge. DETAILED DESCRIPTION
[0040] In order to facilitate the understanding of the present application, the present application will be described more fully below, and preferred embodiments of the present application are given. However, the present application can be realized in many different forms, and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the disclosure of the present application more thorough and comprehensive.
[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0042] The gD protein of HSV-1 has been a major candidate for HSV-1 vaccine or new therapeutic strategies. Interleukin-2 (IL-2) has the characteristics of immune enhancer, anti-tumor and anti-infection, and is mainly used in the treatment and adjuvant therapy of various malignant tumors and infectious diseases in clinic. The present application uses pNZ8148-gD-IL-2-Fc as a fusion gene plasmid, and uses Lactococcus lactis NZ3900 as an exogenous protein transport carrier to prepare a fusion gene recombinant lactic acid bacteria. The gD is one of the main envelope glycoproteins of type I herpes simplex virus, and the extracellular region genome is used. IL-2 is an immunoadjuvant, which can enhance the reactivity of the body to the antigen, and IL-2 can simultaneously enhance humoral immunity and cellular immunity, and mainly tends to enhance cellular immunity. Since viruses replicate in cells, humoral immunity has limited effect in viral infection, and IL-2 is a central cytokine in cellular immunity, which suggests that it has an important role in HSV-1 infection. Another data shows that the immune enhancement effect of cytokine gene adjuvant is better than that of cytokine, and it is speculated that after the cytokine gene adjuvant is taken up by cells, the expressed cytokine can stimulate immune active cells for a long time, and promote antigen-induced humoral immunity and cellular immunity. Meanwhile, the present application also fuses IgG Fc fragments, and uses FcRn to simulate the transport pathway of IgG across the mucosal barrier, to solve the key problem of mucosal transmission.
[0043] Example 1
[0044] Preparation of HSV-1 gD-IL-2-Fc fusion gene recombinant lactic acid bacteria
[0045] 1. Design and synthesis of target gene fragments and primers
[0046] The HSV-1 KOS strain glycoprotein gD gene (GenBank: JQ320083.1, as shown in SEQ ID NO: 1), linker1 (ggcgggggtg ggtccggagg aggtggctcg, as shown in SEQ ID NO: 2), and mouse IL-2 gene (GenBank: X07256.1, sequence as shown in SEQ ID NO: 3) were fused together and named gD-IL-2.
[0047] The gD-IL-2 gene fragment after fusion was fused with the heavy chain gene of mouse IgG2a (i.e. IgG Fc gene, accession number GenBank: V00798.1, as shown in SEQ ID NO: 5) using a linker2 (ggatcaggcgggggtgggtccggaggaggtggctcgggatct, as shown in SEQ ID NO: 4) and named gD-IL-2-Fc.
[0048] The gD-IL-2 gene fragment and the gD-IL-2-Fc gene fragment were respectively connected to a pUC57 vector to obtain recombinant vectors, and the recombinant vectors were respectively named pUC57-gD-IL-2 and pUC57-gD-IL-2-Fc.
[0049] 2. Amplification of gD gene, IL-2 gene and IgG Fc fragment gene
[0050] Using the pUC57-gD-IL-2 plasmid as a template, the gD was amplified by primers F1 and R1, and the IL-2 was amplified by primers F2 and R2. After the PCR products were identified to be correct in size by agarose gel electrophoresis, the target fragments were cut off and recovered by a gel recovery kit (purchased from Beijing Zixingjin Biotechnology Co., Ltd.), and then the gD and IL-2 fragments were subjected to fusion PCR amplification to obtain gD-IL-2.
[0051] Using the pUC57-gD-IL-2-Fc plasmid as a template, the gD was amplified by primers F1 and R1, the IL-2 was amplified by primers F2 and R2-2, and the Fc was amplified by primers F3 and R3. After the PCR products were identified to be correct in size by agarose gel electrophoresis, the target fragments were cut off and recovered by a gel recovery kit (purchased from Beijing Zixingjin Biotechnology Co., Ltd.), and then the gD, IL-2 and Fc fragments were subjected to fusion PCR amplification to obtain gD-IL-2-Fc.
[0052] The sequences of the primers are as follows:
[0053] The gD upstream primer F1 added a protective base (CATG), a Nco I enzyme cutting site (the sequence shown by underlining) and a frame shift mutation base (the sequence shown in bold), 6 his tags (shown in italics), and the downstream primer R1 introduced a linker1 (the sequence shown by underlining):
[0054] F1: CATG CCATGG CCATGCATCACCATCATCATCATAAGTACGCTCTGGC, as shown in SEQ ID NO: 6;
[0055] R1: CGAGCCACCTCCTCCGGACCCACCCCCGCCGAGAAAGGGCTGGTCGGTACT, as shown in SEQ ID NO:7.
[0056] The upstream primer F2 for IL-2 introduces linker1 (the underlined sequence), and the downstream primer R2 adds the protective bases AAT and KpnI restriction sites (the underlined sequence). If the Fc gene is fused, the downstream primer R2-2 is used to introduce linker2 (the underlined sequence).
[0057] F2: GGCGGGGGTGGGTCCGGAGGAGGTGGCTCG GCATGCGCTCCGACTTCTAG, as shown in SEQ ID NO:8;
[0058] R2:AAT GGTACC AGTCAGAGTAGAGATGATAGACTGAGAGAA, as shown in SEQ ID NO:9;
[0059] R2-2: AGATCCCGAGCCACCTCCTCCGGACCCACCCCCGCCTGATCC AGTCAGAGTAGAGATGATAGACTGAGAGA, as shown in SEQ ID NO:10.
[0060] The upstream primer F3 of Fc introduces linker2 (the sequence shown underlined below), and the downstream primer R3 adds the protective base AAT and the KpnI restriction site (the sequence shown underlined below).
[0061] F3: GGATCAGGCGGGGGTGGGTCCGGAGGAGGTGGCTCGGGATCT GAGCCCAGAGGGCCCACA, as shown in SEQ ID NO:11;
[0062] R3: AAT GGTACC AATGGTACCCATTTACCCGGAGTCCGGG, as shown in SEQ ID NO:12.
[0063] The PCR amplification reaction system is shown in Table 1. The amplification conditions were set as follows: 98℃ for 3 min, 98℃ for 15 sec, 58℃ for 15 sec, 72℃ for 10 s, and 30 cycles followed by a 10 min extension at 72℃.
[0064] Table 1. Reaction system for gene amplification
[0065] 2x PrimeSTAR Premix 25 μL pUC57-gD-IL-2 or pUC57-gD-IL-2-Fc 1 μL Upstream primer 1 μL Downstream primer 3 μL ddH2O 20 μL
[0066] like Figure 1 As shown, after fusion PCR, gD-IL-2 and gD-IL-2-Fc were obtained with the expected sizes, which were 1367bp and 2078bp, respectively.
[0067] 3. Enzymatic digestion of gD-IL-2, gD-IL-2-Fc gene and vector
[0068] The PCR product was digested with Ncol and Kpnl at 37°C for 3h, and pNZ8148 was also digested with Ncol and Kpnl at 37°C for 3h. The digestion system is shown in Table 2:
[0069] Table 2. Digestion system of expression vector or PCR product
[0070]
[0071]
[0072] The digested PCR product gD-IL-2, gD-IL-2-Fc was connected with the vector digestion product, respectively, and the vector pNZ8148 product was purified with a gel recovery kit (purchased from Beijing Zison Gold Biotechnology Co., Ltd.), and then connected at 16°C overnight to obtain the connection product. The connection system is shown in Table 3:
[0073] Table 3. Connection system
[0074] 2x T4 DNA Ligase Buffer 5 μL T4 DNA Ligase 1 μL Plasmid of interest (already digested) 1 μL Recovered and purified PCR or digested product 2 μL ddH2O up to 10 μL
[0075] 4. Electroporation of lactic acid bacteria
[0076] 1) Culturing lactic acid bacteria NZ3900 (Professor Xiao Yuncai of Huazhong Agricultural University) and preparing lactic acid bacteria competent cells
[0077] A single colony was picked from a fresh culture plate and inoculated in 5mL GM (0.5% glucose) culture solution, and cultured at 30°C overnight. 5mL NZ3900 was inoculated in 50mL GSGM17 culture solution and cultured at 30°C overnight. 5mL NZ3900 was inoculated in 400mL GSGM17 culture solution, and cultured at 30°C until the OD value was 0.2-0.3. Then, the bacteria were collected by centrifugation at 4°C and 4000r / min for 20min. The bacteria were washed once with 400mL solution I (solution I was prepared by mixing sucrose and glycerol, and the concentration of sucrose in solution I was 0.5mol / L and the concentration of glycerol was 100ml / L). 100mL solution II (solution II was prepared by mixing sucrose, glycerol and EDTA, and the concentration of sucrose in solution II was 0.5mol / L, the concentration of glycerol was 100ml / L, and the concentration of EDTA was 0.05mol / L) was added, and the mixture was mixed well and then placed on ice for 15min. The bacteria were collected by centrifugation at 4°C and 4000r / min for 20min. The bacteria were washed once with 100mL solution I, and finally suspended in 4mL solution I, and then stored at -80°C.
[0078] 2) Electroporation
[0079] The lactic acid bacteria NZ3900 competent cells were electro-transformed with the above connection product, and the transformation product was coated on Elliker screening medium (20 g / L tryptone, 5 g / L yeast extract, 4 g / L sodium chloride, 1.5 g / L sodium acetate, 0.5 g / L ( + ) ascorbic acid, 15 g / L agarose, 0.5% lactose, 0.004% bromocresol purple). After 24 h of static culture at 30°C, single yellow colonies on the plate were picked and cultured, and after 12 h, the bacterial solution was used for PCR identification (lactic acid bacteria identification primers, pNZ8148-F: GATTTCGTTCGAAGGAACTAC, as shown in SEQ ID NO: 11; pNZ8148-R: ATCAATCAAAGCAACACGTGC, SEQ ID NO: 12). After correct identification of the bacterial solution by PCR, the pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc recombinant plasmids were extracted, and after double enzyme digestion and sequencing identification, the obtained recombinant lactic acid bacteria were named as pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc fusion gene recombinant lactic acid bacteria.
[0080] As shown in Figure 2 , after double enzyme digestion of the recombinant plasmid, a large fragment consistent with the size of pNZ8148, a small fragment consistent with the size of gD-IL-2, and a small fragment consistent with the size of gD-IL-2-Fc gene were obtained, and the double enzyme digestion map is shown in Figure 2 , which proves that this clone is a positive clone. The sequencing result is completely consistent with the expected nucleotide sequence. The construction of pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc fusion gene recombinant lactic acid bacteria is successful.
[0081] 5、Recombinant lactic acid bacteria pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc expression and identification:
[0082] The pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc recombinant bacteria were inoculated in M17 liquid medium (purchased from Qingdao Gaokexuan Haibo Biotechnology Co., Ltd.) at a volume ratio of 1:25, and when the concentration OD 600When the value is 0.3-0.4, nisin is added to a final concentration of 5 ng / mL to induce the expression of the target gene pEGF, and after 20 h of static culture at 30°C, the supernatant is collected by centrifugation. The supernatant is first subjected to Western blot identification using His-tagged mouse monoclonal antibody (purchased from Abbkine, USA), and after correct identification, it is concentrated using 80% saturated ammonium sulfate, dialyzed at 4°C for 2 days, filtered using a 0.45 um filter, and finally purified using a His-tagged nickel ion affinity chromatography column. The purified protein is subjected to SDS-PAGE and Western blot electrophoresis analysis and identification, and is stored at -80°C for later use.
[0083] As shown in Figure 3 SDS-PAGE and Western blot experiments, recombinant gD-IL-2 and gD-IL-2-Fc proteins are successfully induced to express.
[0084] Example 2
[0085] Evaluation of the immune effect of HSV-1 gD-IL-2-Fc fusion gene recombinant lactic acid bacteria
[0086] Manufacture of an immune animal model
[0087] Forty mice of the same age and size were randomly divided into four groups, two groups were experimental groups (pNZ8148-gD-IL-2 group, pNZ8148-gD-IL-2-Fc group), and the other two groups were control groups (PBS group, pNZ8148 group). The experimental groups were gavaged with pNZ8148-gD-IL-2 or pNZ8148-gD-IL-2-Fc recombinant bacteria and their culture supernatant of recombinant lactic acid lactobacillus induced by nisin for 20 h, and the control groups were gavaged with wild-type lactic acid lactobacillus and PBS, respectively. The immune program was as follows: first immunization (1-3d), booster immunization (11-13d), and last immunization (21-23d), each time for 3 consecutive days, once a day. Seven days after the end of immunization, the immune mice were anesthetized, the eyeball blood was collected, and the mice were sacrificed by decapitation. The collected fresh blood was allowed to stand at 4°C for 12 h, and then centrifuged at 4°C and 1000 r / min for 20 min. The serum was collected, and the contents of IFN-γ, IL-4, IgG, and IgA in the peripheral blood of mice were determined by double antibody sandwich ELISA method. The spleen was aseptically collected, and the anticoagulated blood was aseptically collected. The proliferation effect of T lymphocytes in the spleen and peripheral blood was determined by CCK-8 assay.
[0088] Method
[0089] 1. Detection of IFN-γ and IL-4 in the peripheral blood of mice
[0090] The double antibody sandwich ELISA method was used to determine IFN-γ and IL-4, and the operation steps were carried out according to the Mouse IFN-gama and IL-4 Enzyme immunoassay Kit instructions. The specific operation steps are as follows:
[0091] (1) The IFN-γ or IL-4 standard (kit with) was diluted according to the instructions, and the dilution was 800 pg / mL, 400 pg / mL, 200 pg / mL, 100 pg / mL, 50 pg / mL, 0 pg / mL, which was added to the ELISA plate in order;
[0092] (2) Blank control wells, standard wells and sample wells were set up, 50 μL of different concentrations of standard was added to the ELISA plate, the blank control wells did not add sample, enzyme labeled reagent and biotin labeled anti-IFN-γ antibody, the sample wells were added with 40 μL of sample first, and then 10 μL of biotin labeled anti-IFN-γ antibody or IL-4 antibody;
[0093] (3) 50 μL of enzyme labeled reagent was added to each well, except for the blank control wells;
[0094] (4) After sealing the plate with a sealing film, it was incubated at 37°C for 30 min;
[0095] (5) The 30-fold concentrated washing solution was diluted 30 times with distilled water for standby;
[0096] (6) Carefully remove the sealing film, discard the liquid, and shake dry, add enough washing solution to each well, stand for 30 s, then discard, repeat for 5 times, and pat dry;
[0097] (7) Add 50 μL of color developing agent A to each well first, then add 50 μL of color developing agent B, mix gently, and develop color at 37°C for 10 min in the dark;
[0098] (8) Add 50 μL of termination solution to each well, at this time the solution turns from blue to yellow immediately;
[0099] (9) Adjust the zero with the blank hole, measure the absorbance of each hole at 450 nm wavelength, use the concentration of the standard as the horizontal coordinate, and the absorbance value as the vertical coordinate, draw the standard curve on the coordinate paper, and calculate the linear regression equation of the standard curve with the concentration of the standard and OD value. Replace the OD value of the sample into the equation to convert the OD450nm value to the amount of IFN-γ or IL-4 (pg / mL).
[0100] 2. Detection of mouse peripheral blood IgG and IgA
[0101] Indirect enzyme-linked immunosorbent assay (ELISA) was used to detect HSV-1 specific IgA and IgG antibodies in serum.
[0102] (1) Coating: The purified HSV-1 gD protein (100 μg / mL) was coated onto a 96-well enzyme-labeled plate with coating solution (pH 9.6, 0.05 moL / mL carbonate buffer) at 4°C overnight;
[0103] (2) Washing: The coating solution was discarded, and the plate was patted dry. Each well was added with washing solution (containing 0.05% Tween 20, 0.01 mol / L pH 7.4 PBS, PBST), and washed for 3 times, 5 min each time, and the plate was patted dry on the water-absorbing paper;
[0104] (3) Blocking: Each well was added with 100 μL of PBST containing 5% skimmed milk powder, and incubated at 37°C for 2 h. After centrifugation, the plate was washed as above;
[0105] (4) Adding the sample to be detected: 100 μL of 1:200 diluted serum sample to be detected was added, and incubated at 37°C for 1 h. The control was set, and the washing was as above;
[0106] (5) Adding HRP-labeled secondary antibody: Each well was added with 100 μL of 1:5000 diluted HRP-labeled goat anti-mouse IgG or IgA antibody, and incubated at 37°C for 1 h. The washing was as above;
[0107] (6) Color development: 100 μL of substrate color development solution (TMB) was added, and color developed for 10-20 min in the dark;
[0108] (7) Termination: Each well was added with 50 μL of 2 mol / L concentrated sulfuric acid termination solution, and reacted for 5 min;
[0109] (8) Enzyme-labeled instrument detection OD 450 nm value.
[0110] 3. Detection of the proliferation activity of mouse spleen and peripheral blood T lymphocytes
[0111] (1) Under sterile conditions, the spleen was taken, and the mouse spleen was ground and squeezed with a sterile grinding pestle to prepare a single cell suspension. The cell suspension was suspended in homogenate rinse solution. The tissue grinding solution was added dropwise to a centrifuge tube through a 70 μm cell screen, centrifuged at 450 g for 10 min, and the supernatant was discarded. If it was blood, the anticoagulant was mixed with whole blood at a ratio of 1:6, and the anticoagulated blood was collected aseptically. An equal volume of sample diluent was added and mixed well;
[0112] (2) A new centrifuge tube was taken, and not less than 4 ml of separation solution was added. The single cell suspension was carefully added to the surface of the separation solution, and centrifuged at 500 g for 30 min;
[0113] (3) After centrifugation, carefully aspirate the second layer of ring-shaped milky white lymphocytes into another 15ml centrifuge tube, add 5-10ml of washing solution to the centrifuge tube, mix the cells, centrifuge at 400g for 10min and discard the supernatant.
[0114] (4) Resuspend the cell pellet in 5 ml of washing solution, centrifuge at 250 g for 10 min and discard the supernatant;
[0115] (5) Resuspend the cell pellet in 5 ml of washing solution, centrifuge at 250 g for 10 min and discard the supernatant;
[0116] (6) Resuspend the cells in 0.5 ml of RPMI-1640 complete culture medium.
[0117] (7) Cell viability was detected using 0.4% trypan blue staining (>95%), and cell counting was performed simultaneously, adjusting the cell concentration to 1×10⁻⁶. 7 / ml;
[0118] (8) Add 50 μL of RPMI-1640 culture medium containing HSV-1 (MOI=1), Vero cell culture supernatant, and 50 μL of RPMI-1640 complete culture medium containing 20 μg / ml ConA to each group of T lymphocyte suspension. Add only RPMI-1640 complete culture medium to the control wells. Set up three replicate wells.
[0119] (9) Culture the lymphocytes at 37°C, 5% CO2, and saturated humidity for 72 hours;
[0120] (10) Discard the culture medium, add 100 μL of RPMI-1640 culture medium containing 10 ml CCK-8 to each well, and incubate for another 3 to 4 hours;
[0121] (11) The absorbance at 450 nm wavelength (OD450nm) was measured using an enzyme-linked immunosorbent assay (ELISA) instrument. The blank control well was zeroed. The results were expressed as the average value of the three replicate wells.
[0122] result
[0123] Mice were immunized with recombinant Lactococcus lactis. Peripheral blood was collected from the mice 30 days after immunization, and serum was separated. The levels of IFN-γ, IL-4, IgG, and IgA in the peripheral blood were measured using a double-antibody sandwich ELISA method. Figure 4 , 5(A) As shown, compared with the control group PBS, pNZ8148, the levels of IFN-γ, IL-4, IgG and IgA in the pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc groups were higher and had extremely significant differences (P<0.01), and the pNZ8148-gD-IL-2-Fc group was significantly higher than the pNZ8148-gD-IL-2 group (P<0.01). The results show that the effect of the recombinant Lactococcus lactis with gD as the target, IL-2 as the adjuvant and the Fc fragment is better.
[0124] The spleens of the immunized mice for 30 days were collected, and the isolated spleen T lymphocytes were stimulated by HSV-1, and the proliferation effect of the spleen T lymphocytes was detected by CCK-8 assay. Figure 5 As shown, compared with the control group PBS, pNZ8148, the levels of IFN-γ, IL-4, IgG and IgA in the pNZ8148-gD-IL-2 and pNZ8148-gD-IL-2-Fc groups were higher and had extremely significant differences (P<0.01).
[0125] It is shown that the recombinant Lactococcus lactis constructed in the application has good immunogenicity and can significantly improve the cellular and humoral immune response levels of the body.
[0126] Example 3
[0127] Virus challenge experiment of HSV-1 gD-IL-2-Fc fusion gene recombinant Lactococcus lactis
[0128] According to the grouping and immunization procedure of "manufacturing immune animal model immunization": two groups are experimental groups (pNZ8148-gD-IL-2 group, pNZ8148-gD-IL-2-Fc group), and the other two groups are control groups (blank group, pNZ8148 group); first immunization (1-3d), booster immunization (11-13d), and last immunization (21-23d), and each time of immunization is continuously for 3d, and once a day. After the immunization is completed, the mice are anesthetized and challenged, the four groups of mice are respectively infected with HSV-1 (10 6 PFU / ml) 100ul, and the mice are killed after 7d of infection, the infection of the mice in each group is evaluated, the lung tissues are taken, ground and extracted for DNA, and the copy number of HSV-1 is detected; the lung tissue pathological sections are prepared, and the infection damage of the lung tissues is evaluated.
[0129] Method:
[0130] 1) HSV-1 copy number detection
[0131] The DNA of the mouse lung tissues is extracted after grinding. The standard is that the copy number is 1×10 10 , 1×10 9 , 1×10 8, 1 x 10 7 , 1 x 10 6 , 1 x 10 5 , 1 x 10 4 , 1 x 10 3 , 1 x 10 2 , 1 x 10 1 Copies / mL of pMD18-T-gD plasmid, pMD18-T-gD plasmid is obtained by amplifying the complete gD gene of HSV-1 and inserting into pMD18-T vector. The copy number of HSV-1 in each sample is calculated by referring to the copy number of standard plasmid after quantitative PCR amplification.
[0132] 2) Preparation of pathological sections:
[0133] (1) Dehydration: the tissue soaked for 24 h was taken out from 10% formalin solution, rinsed with clean deionized water for two times, and then put into 70% ethanol, and then taken out every 2 h and put into 80%, 90% and 100% ethanol in turn, to complete the dehydration process;
[0134] (2) Transparency: the tissue was transferred into the mixture of anhydrous ethanol and xylene (1:1) for 1.5 h, and then transferred into xylene for impregnation until the tissue became transparent;
[0135] (3) Wax immersion and embedding: the transparent tissue was taken out and immersed in melted paraffin, and the tissue after wax immersion was put into melted solid paraffin, and then it was solidified to form a wax block containing the tissue, which was the embedding;
[0136] (4) Sectioning and mounting: the wax block was slightly trimmed and put into a microtome to cut into several 4-6 μm wax strips, which were flattened on the surface of warm water and then put onto a glass slide and baked in a 60°C incubator for 30 min;
[0137] (5) Staining: the dried section was deparaffinated with xylene and de-benzene with alcohol of different concentrations, and then rehydrated with distilled water for HE staining. The stained section was dehydrated with alcohol gradient and transparentized with xylene;
[0138] (6) Mounting: a drop of neutral gum was added to the center of the section, and then the cover glass was slowly put down. The prepared section was observed under a general inverted microscope.
[0139] Results
[0140] Compared with the control groups (PBS group, pNZ8148 group), the HSV-1 gD copy number of the mice in the pNZ8148-gD-IL-2 group and the pNZ8148-gD-IL-2-Fc group was significantly reduced, and the pNZ8148-gD-IL-2-Fc group was lower Figure 6), indicating that the recombinant lactic acid bacteria group can resist HSV-1 infection. The control group of mice infected with HSV-1 can see more serious tissue structure damage, lung interstitial thickening, a large number of inflammatory cell infiltration, alveolar septum reduction, accompanied by tissue fluid exudation and other phenomena, the recombinant lactic acid bacteria immunized mice infected with HSV-1, the lung tissue structure is basically intact, no obvious inflammatory cell infiltration, tissue fluid exudation and other phenomena Figure 7
[0141] The technical features of the above-described embodiments can be combined in any manner. To make the description concise, all possible combinations of the technical features in the above-described embodiments are not described, but as long as the combinations of the technical features do not exist contradictory, they should be considered as the scope of the present disclosure.
[0142] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but should not be understood as a limitation on the scope of the patent. It should be pointed out that for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.
Claims
1. An expression of HSV-1 gD-IL-2-Fc fusion gene recombinant lactic acid bacteria, characterized in that, It is obtained by inserting HSV-1 gD gene, IL-2 gene and IgG Fc fragment gene into lactic acid bacteria expression vector and transforming Lactococcus lactis NZ3900; IgG Fc fragment imitates the transport pathway of IgG across mucosal barrier through FcRn to realize transmucosal transmission; the sequence of IgG Fc fragment is shown as SEQ ID NO. 5, and the following steps are specifically performed: HSV-1 gD gene and IL-2 gene are fused through linker1 to obtain gD-IL-2; The gD-IL-2 and IgG Fc gene are fused through linker2 to obtain the fusion fragment gD-IL-2-Fc; The sequence of the fusion fragment gD-IL-2-Fc is inserted into the lactic acid bacteria expression vector and the lactic acid bacteria is transformed, and the recombination lactic acid bacteria is obtained.
2. The recombinant lactic acid bacterium according to claim 1, characterized in that, It is obtained by specifically performing the following steps: HSV-1 gD gene and IL-2 gene are fused through linker1 by fusion PCR to obtain gD-IL-2; The gD-IL-2 and IgG Fc gene are fused through linker2 by fusion PCR to obtain the fusion fragment gD-IL-2-Fc; The fusion fragment gD-IL-2-Fc is connected on pUC57 vector to obtain the recombination vector pUC57-gD-IL-2-Fc; HSV-1 gD gene, IL-2 gene and IgG Fc gene are amplified respectively by taking the recombination vector pUC57-gD-IL-2-Fc as a template, and the target fragment containing HSV-1 gD gene, IL-2 gene and IgG Fc gene is recovered; then the target fragment containing HSV-1 gD gene, IL-2 gene and IgG Fc gene is amplified by fusion PCR to obtain gD-IL-2-Fc; The pNZ8148 plasmid and the gD-IL-2-Fc are double digested by NcoI and KpnI respectively, the obtained digestion products are connected, and the connection product is obtained; The connection product is electrotransformed into Lactococcus lactis NZ3900 competent cells to obtain the recombination lactic acid bacteria expressing HSV-1 gD-IL-2-Fc fusion gene; The nucleotide sequence of the linker1 is shown as SEQ ID NO: 2, and the nucleotide sequence of the linker2 is shown as SEQ ID NO:
4.
3. The recombination lactic acid bacteria according to claim 2, characterized in that, The primer sequence for amplifying HSV-1 gD gene is F1: CATGCCATGGCCATGCATCACCATCATCATCATAAGTACGCTCTGGC, shown as SEQ ID NO: 6; and R1: CGAGCCACCTCCTCCGGACCCACCCCCGCCGAGAAAGGGCTGGTCGGTACT, shown as SEQ ID NO:
7. The primer sequence for amplifying the IL-2 gene is F2: GGCGGGGGTGGGTCCGGAGGAGGTGGCTCGGCATGCGCTCCGACTTCTAG, as shown in SEQ ID NO: 8; R2-2: AGATCCCGAGCCACCTCCTCCGGACCCACCCCCGCCTGATCCAGTCAGAGTAGAGATGATAGACTGAGAGA, as shown in SEQ ID NO: 10; The primer sequence for amplifying the IgG Fc gene is F3: GGATCAGGCGGGGGTGGGTCCGGAGGAGGTGGCTCGGGATCTGAGCCCAGAGGGCCCACA, as shown in SEQ ID NO: 11; R3: AATGGTACCAATGGTACCCATTTACCCGGAGTCCGGG, as shown in SEQ ID NO:
12.
4. The recombinant lactic acid bacterium according to claim 2, characterized in that, The amplification reaction system for fusion PCR amplification and amplification of the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene is as follows: 2x PrimeSTAR Premix 25 μL, pUC57-gD-IL-2-Fc 1 μL, upstream primer 1 μL, downstream primer 3 μL, ddH2O 20 μL.
5. The recombinant lactic acid bacterium according to claim 4, characterized in that, The amplification conditions for fusion PCR amplification and amplification of the HSV-1 gD gene, the IL-2 gene and the IgG Fc gene are as follows: 98℃ for 3 min, 98℃ for 15 sec, 58℃ for 15 sec, 72℃ for 10 s, 30 cycles, and then 72℃ for 10 min.
6. The recombinant lactic acid bacterium according to claim 2, characterized in that, The enzyme digestion system for the double enzyme digestion is as follows: 10 μL of the expression vector or the PCR product, 1.5 μL of NcoI, 1.5 μL of KpnI, and 3 μL of 10x Fast digestion.
7. Use of the recombinant lactic acid bacteria of claim 1 in the preparation of an immunomodulatory product.
8. Use according to claim 7, characterized in that, The recombinant lactic acid bacteria are used in the preparation of a vaccine against HSV-1. The recombinant lactic acid bacteria are used in the preparation of a vaccine against HSV-1.
Citation Information
Patent Citations
Recombinant lactobacillus for coexpression of foot and mouth disease virus VP1 gene and immunoadjuvant cattle IL-6 gene, and preparation method and application of recombinant lactobacillus
CN104894045A
Construction and application of fusion protein vaccine platform
CN115137812A
Bacterial-like particle vaccine for preventing viral myocarditis as well as preparation method and application of bacterial-like particle vaccine
CN118791633A
Interleukin-2 / viral antigen protein chimers
US5556946A