An internal reference gene for okra seed fluorescence quantitative PCR and its application

Abstract

The invention discloses an okra seed fluorescence quantitative PCR internal reference gene and application thereof, wherein the internal reference gene is ZCCHC11L or / and SEU; the nucleotide sequence of the internal reference gene ZCCHC11L is shown in SEQ ID NO.1; the nucleotide sequence of the internal reference gene SEU is shown in SEQ ID NO.2, and the internal reference gene is used for quantitative PCR detection of target genes in okra seeds. Experiments show that ZCCHC11L and SEU are stably expressed in okra seeds at different developmental stages, and can be used as internal reference genes for okra seeds at different developmental stages, and their stability and reliability are significantly better than other internal reference genes.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a fluorescence quantitative PCR internal reference gene, in particular to an okra seed fluorescence quantitative PCR internal reference gene and application of the internal reference gene in okra seed gene expression analysis. Background Art

[0002] Real-time fluorescence quantitative PCR (qRT-PCR) technology is widely used in gene expression analysis due to its advantages of accurate quantification, simple operation, high sensitivity and strong specificity. However, due to factors such as sample quality, initial template amount, RNA quality or reverse transcription efficiency, the accuracy of quantitative detection results is often affected and cannot truly reflect the expression level of the target gene.

[0003] Therefore, in order to obtain accurate and reliable experimental results, appropriate internal reference genes are needed to correct and standardize the target genes, thereby reducing the impact of the sample on the quantitative results.

[0004] Selecting the most appropriate internal reference gene is particularly important for accurately analyzing the expression of the target gene.

[0005] Usually, housekeeping genes are expressed in all cells, and their expression levels are generally relatively constant, and they are often used as reference genes for gene quantitative analysis. An ideal reference gene is a housekeeping gene that can be stably expressed in all experimental materials under different physiological conditions, different individuals, or different tissues of the same individual.

[0006] Numerous studies have shown that no traditional housekeeping gene is consistently expressed in different tissue types or experimental conditions.

[0007] Therefore, during the experiment, researchers should screen and use appropriate internal reference genes according to different experimental materials and conditions to ensure the accuracy and reliability of quantitative data.

[0008] Okra (Abelmoschus esculentus L.) is an important vegetable. Its seeds are rich in oil, protein, amino acids, mineral elements and polyphenol compounds, and have high nutritional value and development and utilization value.

[0009] The screening of existing okra internal reference genes is mostly based on the functional annotation of the okra reference-free transcriptome database, which is compared with other crops on NCBI to obtain housekeeping genes with high homology, such as EF1-α, TUA, ACT, GAPDH, ACT2, YLS8, eIF4A and other genes, and then these candidate internal reference genes are evaluated and verified.

[0010] In the process of implementing the present invention, the inventors found that the prior art has at least one of the following technical problems:

[0011] 1) The prior art has not disclosed any internal reference gene for quantitative detection of okra seed genes.

[0012] 2) The existing okra reference genes obtained based on housekeeping gene screening have poor expression stability. The existing technology is based on the functional annotation of the non-reference transcriptome database, using the NCBI website to compare with other crops to obtain okra homologous housekeeping genes. The screening of its reference genes is limited to common housekeeping genes, and no more stable reference genes have been discovered.

[0013] 3) The same gene has different expression levels at different developmental stages of okra seeds, and the existing internal reference gene quantitative detection reliability is poor, and it cannot stably express at different developmental stages of okra seeds. For example, the inventors found that when quantitatively analyzing the expression level of the AGPL2 gene in okra seeds at different developmental stages, using TUA5 as an internal reference, the expression level was low in the early stage of seed development, and increased in the middle and late stages of grain development, which cannot objectively reflect the expression of the AGPL2 gene in okra seeds at different developmental stages. Summary of the invention

[0014] In view of this, the object of the present invention is to provide an internal reference gene that is stably expressed in different developmental stages of okra seeds.

[0015] The inventors have continuously innovated through long-term exploration and attempts, as well as multiple experiments and efforts, to solve the above technical problems. The technical solution provided by the present invention is to provide an okra seed fluorescence quantitative PCR internal reference gene, wherein the internal reference gene is ZCCHC11L and / or SEU; the nucleotide sequence of the internal reference gene ZCCHC11L is shown in SEQ ID NO.1; the nucleotide sequence of the internal reference gene SEU is shown in SEQ ID NO.2.

[0016] The present invention also provides a primer pair for amplifying the internal reference gene ZCCHC11L, wherein the primer pair is:

[0017] First forward primer ZCCHC11LF: 5′-TTGAGAATCAGCGTGCGAAAT-3′;

[0018] Second reverse primer ZCCHC11LR: 5'-CACTCATACGGTCATTCTTAGCC-3'.

[0019] The present invention also provides a primer pair for amplifying the internal reference gene SEU, wherein the primer pair is:

[0020] Second forward primer SEUF: 5′-ATCAGTCTTTCGGCAATGGG-3′;

[0021] The second reverse primer SEUR: 5'-GGTGTCAACGATGAAGGAGG-3'.

[0022] The present invention also provides an application of the okra seed fluorescence quantitative PCR internal reference gene for okra seed target gene quantitative PCR detection.

[0023] According to one embodiment of the application of the present invention, the fluorescence quantitative PCR detection is real-time fluorescence quantitative PCR detection.

[0024] According to one embodiment of the application of the present invention, the real-time fluorescence quantitative PCR detection steps are as follows:

[0025] The results were performed on a CFX Conncet real-time fluorescence quantitative PCR instrument (Bio-Rad);

[0026] The cDNA diluted 10 times was used as the template; the qRT-PCR reaction system was 10 μL: 2 μL of diluted cDNA, 5 μL of SYBR Premix Ex TaqⅡ, 0.20 μL of each forward and reverse primer, and 2.6 μL of RNase-free ddH2O;

[0027] Reaction program: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 30 s, amplification, 40 cycles.

[0028] According to one embodiment of the application of the present invention, the target gene includes the starch synthase gene AGPL2.

[0029] According to one embodiment of the application of the present invention, the AGPL2 gene fragment amplification primers are:

[0030] Third forward primer: 5′-AGCAGTTCCCATTGGAGGTT-3′;

[0031] Third reverse primer: 5'-TGTCCTTGCCAAGTGACGATT-3'.

[0032] According to one embodiment of the application of the present invention, the okra seeds are seeds at different developmental stages.

[0033] According to one embodiment of the use of the present invention, the okra seeds are seeds in the early, middle and / or mature stages of development.

[0034] Compared with the prior art, one of the above technical solutions has the following advantages:

[0035] a) ZCCHC11L and SEU were stably expressed in okra seeds at different developmental stages and could be used as internal reference genes for okra seeds at different developmental stages.

[0036] b) According to the sequencing results of the transcriptome of okra seeds with reference, the inventor selected two genes SEU and ZCC HC11L with FPKM values ​​greater than 10 and a smaller coefficient of variation |log2 FC| (Fold Change, FC) as the internal reference genes of okra seeds, and compared other internal reference genes (RPL11, MBR2L, FKBP62, BOB1), as well as the internal reference genes ACT2, YLS8, eIF 4A reported by the inventor earlier, and the genes EF1-α, GAPDH and TUA5 from other literature, a total of 12 internal reference genes were compared, and the transcription levels of the internal reference genes in okra seeds at different developmental stages were detected by qRT-PCR technology, and the detection results were comprehensively analyzed in combination with geNorm, NormFinder and Bestkeeper software to evaluate the expression stability of each internal reference gene. The okra starch synthase gene AGPL2 was used as the target gene to verify the reliability of the candidate internal reference genes. The results showed that the stability and reliability of the reference genes ZCCHC11L and SEU were significantly better than those of other reference genes, providing a reference for the selection of reference genes in the study of gene expression in okra seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is the electrophoresis diagram of the candidate internal reference gene PCR product. Figure 1 In the figure, lane 1 is FKBP62, lane 2 is BOB1, lane 3 is ZCCHC11L, lane 4 is RPL11, lane 5 is MBR2L, lane 6 is SEU, lane 7 is ACT2, lane 8 is eIF 4A, lane 9 is EF1-α, lane 10 is GAPDH, lane 11 is TUA5, lane 12 is YLS8, lane 13 is AGPL2, M: DNA Marker 2000.

[0038] Figure 2 These are the melting curves of the candidate reference genes RPL11, MBR2L, SEU, and FKBP62.

[0039] Figure 3 These are the melting curves of candidate reference genes ACT2, EF1-α, GAPDH, and TUA5.

[0040] Figure 4 These are the melting curves of the candidate reference genes eIF4A, ZCCHC11L, YLS8, and BOB1.

[0041] Figure 5It is a box plot of the Cq values ​​of candidate internal reference genes.

[0042] Figure 6 The expression of AGPL2 gene in okra seeds at different developmental stages is different. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0044] In this embodiment, the nucleotide sequence of the internal reference gene ZCCHC11L is shown in SEQ ID NO. 1. Its amplification primer pair is shown in SEQ ID NO. 3-4, which are respectively:

[0045] First forward primer ZCCHC11LF: 5′-TTGAGAATCAGCGTGCGAAAT-3′;

[0046] Second reverse primer ZCCHC11LR: 5'-CACTCATACGGTCATTCTTAGCC-3'.

[0047] The nucleotide sequence of the internal reference gene SEU is shown in SEQ ID NO. 2. Its amplification primer pairs are shown in SEQ ID NO. 5-6, which are respectively:

[0048] Second forward primer SEUF: 5′-ATCAGTCTTTCGGCAATGGG-3′;

[0049] The second reverse primer SEUR: 5'-GGTGTCAACGATGAAGGAGG-3'.

[0050] The target gene used for verification in this example is the starch synthase gene AGPL2, and the nucleotide sequence is shown in SEQ ID NO.7. The amplification primer pairs are shown in SEQ ID NO.8-9, which are respectively:

[0051] Third forward primer: 5′-AGCAGTTCCCATTGGAGGTT-3′;

[0052] Third reverse primer: 5'-TGTCCTTGCCAAGTGACGATT-3'.

[0053] The stability and reliability of the internal reference genes ZCCHC11L and SEU are explained below in conjunction with the experimental process.

[0054] 1 Materials and methods

[0055] 1.1 Experimental Materials

[0056] The okra (Abelmoschus esculentus L.) variety was 'Green Five Star', planted in the experimental base of Sichuan Institute of Agricultural Characteristic Plants, and the grains at different developmental stages (6DAP, 15DAP, 25DAP, 40DAP) were used as materials. Three biological replicates were set for each sample. The materials were quickly frozen in liquid nitrogen and stored in a -80℃ ultra-low temperature refrigerator for future use.

[0057] 1.2 Experimental methods

[0058] 1.2.1 Total RNA extraction and cDNA synthesis

[0059] The total RNA of each sample was extracted using the Plant Total RNA Isolation Kit Plus (FOREGENE), and genomic DNA was removed. The integrity of the extracted total RNA was detected by 1.2% agarose gel electrophoresis, and its concentration and purity were determined using a spectrophotometer Nanodrop 2000C (Thermo). The first strand of cDNA was synthesized using PrimeScript from TaKaRa TM RT reagent Kit with gDNA Eraser (RR047A) was used. The specific operations were carried out according to the product instructions, and the successfully reversed cDNA was stored at -20°C for later use.

[0060] 1.2.2 Candidate gene selection and primer design

[0061] According to the transcriptome sequencing results of okra seeds, two genes SEU and ZCCHC11L with FPKM values ​​greater than 10 and small coefficient of variation |log2FC| (Fold Change, FC) were selected as internal reference genes of okra seeds. Other internal reference genes (RPL11, MBR2L, FKBP62, BOB1) and existing internal reference genes ACT2, YLS8, eIF4A, EF1-α, GAPDH, TUA5) were compared, and a total of 12 genes were selected as candidate genes. The starch synthase gene AGPL2 was selected as the target gene for verification.

[0062] Among them, the gene accession number of RPL11 is AesB13g10120, the gene accession number of MBR2L is AesB28g16030, the gene accession number of FKBP62 is AesB24g01090, and the gene accession number of BOB1 is AesB02g07090.

[0063] The specific qRT-PCR amplification primers for the 12 genes are shown in Table 1 . The quantitative primers were commissioned to be synthesized by Qingke Biotechnology Co., Ltd.

[0064] 1.2.3 Conventional PCR amplification and qRT-PCR analysis of candidate internal reference genes and AGPL2

[0065] The cDNA of each sample was mixed in equal amounts, and the reaction system was 25 μL: cDNA 1 μL; dNTPs 0.5 μL; Taq enzyme (TaKaRa) 0.15 μL; forward and reverse primers 0.5 μL each; 10×PCR Buffer 2.5 μL; ddH2O 19.85 μL. PCR amplification was performed on a PTC-200 Gradient Thermal Cycler (Bio-Rad) with the following program: 98°C pre-denaturation for 5 min; 98°C denaturation for 10 s, annealing for 10 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min; 10°C storage. PCR products were detected by 1.5% agarose gel electrophoresis.

[0066] qRT-PCR amplification was performed on a CFX Conncet real-time fluorescence quantitative PCR instrument (Bio-Rad). Using 10-fold diluted cDNA as a template, each sample was repeated 3 times, and the qRT-PCR reaction system was 10 μL: 2 μL of diluted cDNA, 5 μL of SYBR Premix Ex TaqⅡ (Til RNaseH Plus, TaKaRa); 0.20 μL of each forward and reverse primer, 2.6 μL of RNase-free ddH2O. The reaction procedure was: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 5 s, 60℃ annealing for 30 s amplification, and 40 cycles. After the amplification reaction, a melting curve analysis was performed at 65-95℃.

[0067] 1.2.4 Drawing of standard curve and calculation of amplification efficiency

[0068] Take an equal amount of cDNA from samples of each developmental stage, dilute and mix at 1:10, and use it as a template. Use the above-mentioned qRT-PCR system and procedure for amplification reaction. The obtained PCR product is diluted 10 times to obtain 5 concentration gradients (10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8) template, after the qRT-PCR reaction, the logarithm of the relative copy number was used as the horizontal axis and the Cq value was used as the vertical axis for standard curve analysis, and the linear correlation coefficient (R 2 ) and the amplification efficiency (E) of each gene (Table 1).

[0069] Table 1 qRT-PCR primers and amplification efficiency of candidate internal reference genes and target genes

[0070]

[0071]

[0072] 1.2.5 Data processing and analysis

[0073] The stability of expression of 12 candidate internal reference genes was comprehensively analyzed using geNorm, NormFinder, BestKeeper software and RefFinder algorithm.

[0074] According to the Cq value of the relative quantitative data of the internal reference gene, the average expression stability value (M) and stability value (S) of each internal reference gene were calculated using geNorm and NormFinder software, respectively. The higher the stability value, the more unstable the expression; conversely, the more stable it is.

[0075] In addition, geNorm was used to analyze the pairwise coefficient of variation (V n / n+1 ) to determine the optimal number of internal reference genes required for the experiment.

[0076] BestKeeper software was used to calculate the paired standard deviation (SD), coefficient of variation (CV) and correlation coefficient (r) of the Cq values ​​between different materials for each gene. The higher the correlation coefficient (r), the smaller the standard deviation (SD) and coefficient of variation (CV), and the more stable the expression of the internal reference gene.

[0077] The optimal internal reference gene was used as a reference to quantitatively analyze the expression level of AGPL2 gene in okra seeds at different developmental stages to verify the reliability of the selected internal reference gene. The relative expression of the target gene was calculated using 2 -△△Ct Law.

[0078] 2 Experimental results

[0079] 2.1 Primer specificity detection

[0080] Equal amounts of cDNA from each sample were mixed as templates, and conventional RT-PCR was used to detect the specificity of the candidate internal reference gene primers. Agarose gel electrophoresis showed that the products of each candidate internal reference gene were between 90 bp and 249 bp ( Figure 1), and the bands were clear and single, without obvious primer dimers or non-specific amplification. The size of the amplified fragment was consistent with the expected target band, indicating that the primers of the candidate genes had good specificity. Through the melting curve analysis of the qRT-PCR results, it was found that the melting curves of the 12 candidate reference genes all showed a single signal peak, and the curves had good repeatability among the replicated samples ( Figures 2 to 4 ), further indicating that the primers of the 12 candidate reference genes had good specificity and could be used for qRT-PCR experiments.

[0081] 2.2 Reference gene C q value analysis

[0082] Analysis of the Cq values of the 12 candidate reference genes found that the Cq values of each gene were between 17.51 and 28.96 ( Figure 5 ). C q value reflects the expression abundance of the gene. The lower the value, the higher the expression abundance, and vice versa, the lower the gene expression abundance. The expression levels of the reference genes in okra seeds were different. Among them, the expression abundance of EF1-α was the highest, while the expression abundances of RPL11 and GAPDH were relatively low. The C q values of ZCCHC11L were relatively concentrated, and the C q values in the seeds at different developmental stages were between 23.78 and 25.35; while the C q values of TUA5 fluctuated greatly, and its C q values were distributed between 19.70 and 28.17.

[0083] It was preliminarily judged that the expression of ZCCHC11L was relatively stable.

[0084] 2.3 Evaluation of the expression stability of reference genes

[0085] 2.3.1 geNorm software analysis

[0086] After analysis by the geNorm software, the M values of the expression stability of the 12 reference genes were between 0.2441 and 1.053. The M value ranking of each gene was: ZCCHC11L = SEU(0.2441) < RPL11(0.396) < eIF4A(0.448) < ACT2(0.471) < YLS8(0.505) < EF1-α(0.559) < FKBP62(0.594) < MBR2L(0.638) < GAPDH(0.722) < BOB1(0.800) < TUA5(1.053) (Tables 2-1 to 2-2). The default threshold of this software program is 1.5. Values lower than the threshold indicate relatively stable gene expression, and the smaller the M value, the more stable the expression of the reference gene.

[0087] According to this algorithm, the M values ​​of the 12 candidate internal reference genes are all less than the threshold value of 1.5. Theoretically, they can all be considered as internal reference genes.

[0088] Among them, ZCCHC11L and SEU had the smallest M values ​​and the best expression stability.

[0089] In addition, geNorm software can also analyze the pairwise difference value V of the internal reference gene n / n+1 To determine the optimal number of internal reference genes required, the program default threshold is 0.15. n / n+1 When V is less than 0.15, it means that n internal reference genes have met the experimental requirements and there is no need to introduce the (n+1)th internal reference gene. 2 / 3 =0.15, V 3 / 4 =0.11, indicating that the optimal number of internal reference genes is 2.

[0090] Table 2-1 Expression stability and ranking of candidate internal reference genes

[0091]

[0092] Table 2-2 Expression stability and ranking of candidate internal reference genes

[0093]

[0094] 2.3.2 NormFinder software analysis

[0095] NormFinder software uses expression stability value (S) to measure the expression stability of internal reference genes based on intra-group and inter-group variance analysis. The S value is negatively correlated with the stability of the internal reference gene. The smaller the S value, the better the stability of the internal reference gene.

[0096] The results of Norm Finder software analysis showed that the stability of the 12 candidate reference genes from high to low was as follows: ACT2>YLS8>ZCCHC11L>SEU>RPL11>eIF4A>EF1-α>FKBP62>MBR2L>GAPDH>BOB1>TUA5 (Table 2-1 to Table 2-2).

[0097] The most stably expressed reference genes were ACT2, YLS8, and ZCCHC11L, and the least stable was TUA5.

[0098] The results of NormFinder analysis are similar to those of geNorm software. Among the candidate internal references in this embodiment, ZCCHC11L is one of the most stably expressed genes, and TUA5 has the worst expression stability. The results of NormFinder analysis are similar to those of geNorm software. Among the candidate internal references in this embodiment, ZCCHC11L is one of the most stably expressed genes, and GAPDH and TUA5 have the worst expression stability.

[0099] 2.3.3 BestKeeper Software Analysis

[0100] BestKeeper uses standard deviation (SD), coefficient of variation (CV) and correlation coefficient (r) as indicators to evaluate the stability of reference genes. The larger the correlation coefficient, the smaller the standard deviation and coefficient of variation, the more stable the reference gene. The default threshold of the SD value is 1.0. When SD>1, the expression of the reference gene is considered unstable. From the analysis results (Table 2-1 to Table 2-2), it can be seen that among the 12 candidate reference genes, the SD values ​​of EF1-α and TUA5 are both greater than 1, indicating that the expression of these two candidate reference genes is unstable and not suitable as reference genes. Among the candidate reference genes, the standard deviation (SD=0.40) and coefficient of variation (CV=1.65) of ZCCHC11L are both the smallest, indicating that the expression of ZCCHC11L is the most stable.

[0101] The stability of the 12 candidate reference genes is ranked from high to low as ZCCHC11L>SEU>MBR2L>RPL11>BOB1>eIF4A>ACT2>GAPDH>YLS8>FKBP62>EF1α>TUA5.

[0102] 2.3.4 RefFinder analysis

[0103] The RefFinder algorithm (http: / / blooge.cn / RefFinder / ?type=reference) was used to weight the above four evaluations, comprehensively evaluate the stability of the candidate reference genes, and obtain the comprehensive ranking of the candidate genes (Table 2-1 to Table 2-2). The results showed that the expression of ZCCHC11L and SEU was the most stable, indicating that these two genes can be used as preferred reference genes during the development of okra seeds.

[0104] 2.3.5 Verification of the expression stability of internal reference genes

[0105] To verify the reliability of the evaluation results of the above software, the most stably expressed ZCCHC11L, SEU, and ZCCHC11L+SEU combination, and the least stable TUA5 were selected as internal reference genes to analyze the expression pattern of starch synthase gene AGPL2 in okra seeds at different developmental stages.

[0106] The results are as follows Figure 6 As shown, when ZCCHC11L, SEU, and ZCCHC11L+SEU were used as internal references, the expression pattern of the AGPL2 gene was consistent. The gene was highly expressed in the early stage of seed development and showed a downward trend in the middle and late stages of grain development, which was consistent with the function of the AGPL2 gene.

[0107] When TUA5 was used as a target, AGPL2 showed a completely different expression pattern, with high expression in the middle and late stages of grain development and the highest expression in mature grains.

[0108] It is proved that the screened reference genes ZCCHC11L and SEU are reliable.

[0109] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. An application of an internal reference gene for okra seed fluorescence quantitative PCR, characterized in that: Used for quantitative PCR detection of target genes in okra seeds; The internal reference gene is ZCCHC11L or / and SEU ; Reference gene ZCCHC11L The nucleotide sequence of is shown in SEQ ID NO.1; the nucleotide sequence of the internal reference gene SEU is shown in SEQ ID NO.2; okra seeds are seeds in the early, middle or / and mature stages of development.

2. The use according to claim 1, characterized in that: Fluorescence quantitative PCR detection is real-time fluorescence quantitative PCR detection.

3. The use according to claim 1, characterized in that: The steps of real-time fluorescence quantitative PCR detection are as follows: The results were performed on a CFX Conncet real-time fluorescence quantitative PCR instrument; The cDNA diluted 10 times was used as the template; the qRT-PCR reaction system was 10 μL: 2 μL of diluted cDNA, 5 μL of SYBR Premix Ex Taq Ⅱ, 0.20 μL of each forward and reverse primer, and 2.6 μL of RNase-free ddH2O; The reaction program was as follows: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 30 s, and 40 cycles.

4. The use according to claim 1, characterized in that: The target gene includes starch synthase gene AGPL2 .

5. The use according to claim 4, characterized in that: Said AGPL2 The primers for amplifying the gene fragment are: Third forward primer: 5′- AGCAGTTCCCATTGGAGGTT -3′; Third reverse primer: 5'- TGTCCTTGCCAAGTGACGATT -3'.

Images