Tagged sequences, adapters, kits, and methods for DNA methylation sequencing
By introducing polycytosine sequence markers and adapters into the next-generation sequencing platform, the problem of cross-contamination between samples in DNA methylation detection is solved, achieving high ligation efficiency and consistency, making it suitable for DNA methylation detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI WEIHE MEDICAL LAB CO LTD
- Filing Date
- 2023-12-21
- Publication Date
- 2026-06-23
AI Technical Summary
Existing next-generation sequencing platforms suffer from cross-contamination between samples in DNA methylation detection, which is particularly difficult to avoid in experimental steps before adding index sequences.
By using marker sequences and adapters containing polycytosine sequences, modified or unmodified cytosine states are introduced on both sides or one side of the insert fragment, and then ligated with DNA ligase to form single-stranded or double-stranded libraries, a method for reducing cross-contamination between samples is adopted.
It effectively reduces cross-contamination between samples, improves ligation efficiency and efficiency consistency, and is suitable for DNA methylation detection.
Smart Images

Figure CN117887806B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of next-generation sequencing (NGS), and more particularly to the field of methylation sequencing, specifically to a marker sequence, an adapter containing the marker sequence, a kit containing the sequence or adapter, and a DNA methylation sequencing method using the adapter or kit. Background Technology
[0002] Next-generation sequencing (NGS) is a high-throughput sequencing method. During sequencing, multiple samples are processed in parallel, inevitably leading to cross-contamination between samples at various stages of sample processing. Current NGS platforms typically use index sequences in adapters to label samples. While this reduces cross-contamination to some extent, several experimental steps exist before adding the index sequence, and relying solely on the index sequence cannot completely eliminate sample contamination resulting from these experimental steps. Therefore, NGS platforms using index-labeled samples still experience a certain degree of cross-contamination.
[0003] DNA methylation is a stable silencing marker that plays a crucial role in epigenetic transcriptional silencing. Methylation does not affect base pairing but does influence DNA-protein interactions. To detect the methylation status of DNA sequences, samples typically undergo special treatment. For example, bisulfite treatment converts all unmethylated cytosine (C) to uracil (U), which is then converted to thymine (T) in subsequent PCR amplification. Methylated cytosine (mC) remains unchanged during this process, thus distinguishing between unmethylated and methylated cytosine (C). This step transforms normally undetectable epigenetic information into easily detectable sequence information, achieving single-base resolution. During methylation sequencing, existing sequencing platforms also use index sequences to label samples to reduce cross-contamination. However, as mentioned earlier, due to the late addition of index sequences, the aforementioned cross-contamination problem still exists.
[0004] Therefore, there is an urgent need in the field for a next-generation sequencing method that can further reduce cross-contamination between samples and is applicable to DNA methylation detection. Summary of the Invention
[0005] This invention provides a marker sequence, an adapter containing the marker sequence, a kit containing the sequence or adapter, and a DNA methylation sequencing method using the sequence, adapter, or kit, which can reduce cross-contamination between sequencing samples and is applicable to DNA methylation detection.
[0006] In a first aspect, the present invention provides a marker sequence comprising polycytosine sequences located on one or both sides of an insert fragment, wherein the cytosine on each side exists in either a modified or unmodified state.
[0007] In one embodiment, the cytosine at each site on each side of the polycytosine sequence is either modified or unmodified.
[0008] In one embodiment, the length of the polycytosine sequence on each side of the insert fragment is independently at least 1 base, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 bases, or the number of bases in a subrange consisting of any of these ranges.
[0009] In one embodiment, the modified cytosine is selected from 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), or 5-carboxycytosine (5CaC).
[0010] In one embodiment, the polycytosine lengths on both sides of the insert fragment can be the same or different.
[0011] In one embodiment, the polycytosine modifications on both sides of the insert fragment can be the same or different.
[0012] In one embodiment, one end of the polycytosine sequence is directly linked to the insert fragment or spaced A / T, and the other end is directly linked to the next-generation sequencing adapter.
[0013] In one embodiment, the polycytosine sequence is poly5-methylcytosine (5mC), poly5-hydroxymethylcytosine (5hmC), poly5-formylcytosine (5fC), poly5-carboxycytosine (5CaC), or polyunmodified cytosine (C).
[0014] In one embodiment, each base in the inserted fragment accounts for approximately 20%-30%, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30%, or a subrange consisting of any values within these ranges.
[0015] In one embodiment, the next-generation sequencing adapter can be a next-generation sequencing adapter used in the Illumina sequencing platform, the IonTorrent sequencing platform, or the MGI sequencing platform. For example, the P5 and P7 end adapters of the Illumina sequencing platform, the P1 and A adapters or the P1 and X adapters of the IonTorrent sequencing platform, and the linear adapters and bubbly adapters of the MGI sequencing platform.
[0016] In one embodiment, the cytosine in the next-generation sequencing adapter has been modified so that it does not transform during the library construction process of methylation sequencing. For example, the cytosine in the next-generation sequencing adapter is 5-methylcytosine.
[0017] In a second aspect, the present invention provides a connector for single-chain library construction, which includes the marker sequence of the first aspect of the present invention.
[0018] In one embodiment, the adapter for single-strand library construction includes a 5' adapter and a 3' adapter. The 5' adapter includes a 5' next-generation sequencing adapter, a marker sequence on one side of the first aspect of the present invention connected thereto, a complementary sequence that is complementary to the sequence of the 5' next-generation sequencing adapter and the marker sequence on that side, and a polynucleotide (PolyN) sequence connected to the complementary sequence. The 3' adapter includes a 3' next-generation sequencing adapter, a marker sequence on the other side of the first aspect of the present invention connected thereto, a complementary sequence that is complementary to the sequence of the 3' next-generation sequencing adapter and the marker sequence on that side, and another polynucleotide sequence connected to the complementary sequence on that side.
[0019] In one embodiment, the adapter for single-strand library construction is a mixture comprising multiple polynucleotide sequence portions, at least one of which can be complementary to the end of the insert fragment.
[0020] In one embodiment, the length of the polynucleotide sequence in the 5' end adapter and the 3' end adapter is each independently at least 1 base, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 bases, or the number of bases in a subrange consisting of any value in these ranges.
[0021] In one embodiment, each base in the polynucleotide sequence accounts for approximately 20%-30%, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30%, or a subrange consisting of any values within these ranges.
[0022] In one implementation, the polynucleotide sequences in the 5' and 3' end adapters may be the same or different.
[0023] In one embodiment, the adapter for single-strand library construction includes a 5' adapter and a 3' adapter. The 5' adapter includes a P5 adapter from the Illumina sequencing platform, a marker sequence on one side of the first aspect of the present invention connected thereto, a complementary sequence that is complementary to the sequence of the P5 adapter of the Illumina sequencing platform and the marker sequence on that side, and a polynucleotide sequence connected to the complementary sequence. The 3' adapter includes a P7 adapter from the Illumina sequencing platform, a marker sequence on the other side of the first aspect of the present invention connected thereto, a complementary sequence that is complementary to the sequence of the P7 adapter of the Illumina sequencing platform and the marker sequence, and a polynucleotide sequence connected to the complementary sequence.
[0024] In a third aspect, the present invention provides a connector for bi-chain library construction, which includes the marker sequence of the first aspect of the present invention.
[0025] In one embodiment, the adapter for double-stranded library construction includes a 5' end next-generation sequencing adapter, a one-sided marker sequence of the first aspect of the present invention connected thereto, a polyguanine sequence complementary to the marker sequence and connected to the 3' end next-generation sequencing adapter, and a T connected to the end of the marker sequence; or the adapter for double-stranded library construction includes a 3' end next-generation sequencing adapter, a one-sided marker sequence of the first aspect of the present invention connected thereto, a polyguanine sequence complementary to the marker sequence and connected to the 5' end next-generation sequencing adapter, and a T connected to the end of the polyguanine sequence.
[0026] In one embodiment, the adapter for double-stranded library construction includes a P5 end adapter of the Illumina sequencing platform, a one-sided marker sequence of the first aspect of the present invention connected thereto, a polyguanine sequence complementary to the marker sequence and connected to the P7 end adapter of the Illumina sequencing platform, and a T connected to the end of the marker sequence; or the adapter for double-stranded library construction includes a P7 end sequencing adapter of the Illumina sequencing platform, a one-sided marker sequence of the first aspect of the present invention connected thereto, a polyguanine sequence complementary to the marker sequence and connected to the P5 end adapter of the Illumina sequencing platform, and a T connected to the end of the polyguanine sequence.
[0027] In a fourth aspect, the present invention provides a kit comprising a marker sequence of the first aspect of the present invention, a adapter for single-strand library construction of the second aspect, or an adapter for double-strand library construction of the third aspect.
[0028] In a fifth aspect, the present invention provides a methylation sequencing method using a adapter for single-stranded library construction according to the second aspect of the present invention or a kit according to the fourth aspect, comprising ligating an insert fragment to an adapter for single-stranded library construction.
[0029] In one embodiment, the ligation process specifically includes mixing the adapter with the insert fragment and ligating the adapter for single-strand library construction with the insert fragment using a DNA ligase (e.g., T4 ligase).
[0030] In one implementation, the methylation sequencing method further includes transforming the established library.
[0031] In one embodiment, the method includes converting the library by enzymatic or bisulfite methods.
[0032] In one embodiment, the methylation sequencing method further includes PCR amplification of the transformed library.
[0033] In one embodiment, the methylation sequencing method further includes sequencing and then data analysis, which includes splitting the read length by indexing and / or tagging sequences.
[0034] In one implementation, the method includes calculating the read length percentage of target samples and / or the read length percentage of non-target samples based on index sequences and / or tag sequences.
[0035] In a sixth aspect, the present invention provides a methylation sequencing method using the adapter for double-stranded library construction of the third aspect of the present invention or the kit of the fourth aspect of the present invention, comprising ligating an insert fragment to an adapter for double-stranded library construction.
[0036] In one embodiment, the ligation process specifically includes adding an A tail to the 3' end of the insert fragment, mixing the adapter with the insert fragment, and using a DNA ligase (e.g., T4 ligase) to ligate the adapter for single-strand library construction with the insert fragment.
[0037] In one embodiment, the method includes converting the library by enzymatic or bisulfite methods.
[0038] In one embodiment, the methylation sequencing method further includes PCR amplification of the transformed library.
[0039] In one embodiment, the methylation sequencing method further includes sequencing and then data analysis, which includes splitting the read length by indexing and / or tagging sequences.
[0040] In one implementation, the method includes calculating the read length percentage of target samples and / or the read length percentage of non-target samples based on index sequences and / or tag sequences.
[0041] The adapter of this invention has high ligation efficiency and good consistency in ligation efficiency. Using the marker sequence, adapter, kit, and DNA methylation sequencing method of this invention can further effectively reduce cross-contamination between samples, and this invention can be applied to methylation detection.
[0042] The term "insertion fragment" as used in this invention refers to a smaller fragment of sample DNA that has been broken down, the specific length of which is determined by the read length of the sequencing platform. In this invention, unless otherwise stated, when dealing with single-stranded library construction, "insertion fragment" refers to single-stranded DNA that has not undergone any other processing; when dealing with double-stranded library construction, "insertion fragment" refers to double-stranded DNA whose sequence has been completed and phosphorylated at the 5' end, but has not yet had an A-tail added to the 3' end, and has not undergone any other processing. The description of "both sides / one side" of the insertion fragment in this invention can refer to a position immediately adjacent to the insertion fragment, or a position with a certain distance from the insertion fragment, for example, separated by an A / T tail; "both sides / one side" of the insertion fragment can refer to the 5' and / or 3' ends of the sense and / or negative sense strands on both sides / one side of the insertion fragment, or a position with a certain distance from its 5' and / or 3' ends, for example, separated by an A / T tail.
[0043] The term "second-generation sequencing adapter" as used in this invention can include adapters used in various second-generation sequencing platforms, such as those used in the Illumina sequencing platform, the Ion Torrent sequencing platform, or the MGI sequencing platform. Specifically, it refers to the non-insertion fragment and non-A-tail portion of the sequencing fragment (i.e., various auxiliary sequences required for sequencing, such as index sequences). Unless otherwise stated, the term "second-generation sequencing adapter" as used in this invention can include complete adapters at both the 5' and 3' ends (meaning they contain various auxiliary sequences required for sequencing, such as index sequences), or at least a portion thereof; it is in its complete state during sequencing. Unless otherwise stated, the "P5-end adapter" and "P7-end adapter" as used in this invention refer to the "P5-end adapter" and "P7-end adapter" of the Illumina sequencing platform, which can be complete adapters (meaning they contain various auxiliary sequences required for sequencing, such as index sequences), or at least a portion thereof; it is in its complete state during sequencing.
[0044] The terms "5' adapter" and "3' adapter" used in this invention refer to adapters that are directly connected to the 5' and 3' ends of the DNA strand of the insert fragment, or connected at a certain distance (e.g., separated by an A / T). The terms "5' next-generation sequencing adapter" and "3' next-generation sequencing adapter" used in this invention refer to, in the prior art, next-generation sequencing adapters that are directly connected to the 5' and 3' ends of the DNA strand of the insert fragment, or connected at a certain distance (e.g., separated by an A / T). For example, a 5' next-generation sequencing adapter can refer to the P5 adapter of the Illumina sequencing platform, and a 3' next-generation sequencing adapter can refer to the P7 adapter of the Illumina sequencing platform.
[0045] The term "base" as used in this invention (including adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U)) may refer to the base itself or a compound containing that base (e.g., the corresponding (deoxy)nucleoside or (deoxy)nucleotide) depending on the specific context and convention in the art. Unless otherwise stated, this invention distinguishes various bases and compounds containing various bases only by the base moiety. For example, adenine may refer to the base adenine (A) itself or compounds such as deoxyadenosine triphosphate (dATP) containing that base. As for cytosine, unless otherwise stated, it may include various modified or unmodified cytosines, or compounds containing modified or unmodified cytosines.
[0046] In this invention, "about" refers to a numerical range of the given number ± the given number * 5%, including the endpoints.
[0047] In this invention, all percentage values are approximations of the integer part by rounding. For example, 20% can be any percentage between 19.5% and 20.4%.
[0048] In describing sequence information in this invention, unless otherwise specified or according to specific practices in the art, N refers to any nucleotide or base, in sequence from the 5' end to the 3' end.
[0049] In this invention, unless otherwise stated, when specifying the modification state of cytosine, polycytosine means that all cytosines therein are in the same modification state. For example, poly5-methylcytosine means that all cytosines therein are 5-methylcytosines (e.g., a sequence containing 3 5-methylcytosines can be labeled mCmCmC), and polyunmodified cytosine means that all cytosines therein are unmodified cytosines (e.g., a sequence containing 3 unmodified cytosines can be labeled CCC). Conversely, unless otherwise stated, when the modification state of polycytosine is not specified, the cytosine at each site in polycytosine can be independently modified or unmodified. Attached Figure Description
[0050] Figure 1 This is a schematic diagram of a high-throughput sequencing process using the marker sequence of this invention (some steps omitted).
[0051] Figure 2 This study demonstrates the base changes in DNA samples after bisulfite treatment and during PCR.
[0052] OT-original top strand
[0053] CTOT-complementary to original top strand
[0054] OB-original bottom strand
[0055] CTOB - Complementary to original bottom strand
[0056] Figure 3 This is a schematic diagram of single-strand library construction according to the present invention, using the Illumina sequencing platform.
[0057] Figure 4 This is a schematic diagram of double-stranded library construction according to the present invention, using the Illumina sequencing platform.
[0058] Figure 5 This is a schematic diagram of the anti-pollution principle of the present invention (the anti-pollution sequence in the figure is the marker sequence mentioned in this article, and anti-pollution sequence 1 and anti-pollution sequence 2 are two types of marker sequences). Detailed Implementation
[0059] To better understand the present invention, the following embodiments further illustrate the content of the invention, but the content of the invention is not limited to the following embodiments. Unless otherwise specified, the experimental operations described in the following embodiments are routine operations; the reagents and materials described are commercially available unless otherwise specified.
[0060] The sequencing platform used in this section is the Illumina sequencing platform. The settings and specific operations for the sequencing process were performed in accordance with the manufacturer's instructions. Unless otherwise specified, pre-sequencing procedures (e.g., sample preparation and library construction) were performed according to the manufacturer's recommended standard parameters and procedures.
[0061] In this section, the index sequences were all introduced into the sequences to be sequenced via PCR amplification (specifically, through PCR primers, one of the methods recommended by Illumina for ligating index sequences). All index sequences were commercially available products from IDT, catalog number 10005922. Detailed index sequence information is shown in Table 6 below. The primers used in the PCR amplification process were from Illumina. P5 and P7 sequences. See Table 7 for detailed primer sequence information.
[0062] Example 1 Single-chain database building
[0063] Four sets of adapters were designed. Each set of adapters includes a 5' adapter and a 3' adapter. The 5' adapter includes a P5 adapter, a marker sequence attached to it, a complementary sequence that is complementary to both the P5 adapter and the marker sequence, and a polynucleotide sequence attached to the complementary sequence. The 3' adapter includes a P7 adapter, a marker sequence attached to it, a complementary sequence that is complementary to both the P7 adapter and the marker sequence, and another polynucleotide sequence attached to the complementary sequence. The marker sequences at both ends are three-base polycytosine compounds (the modification details of the marker sequences are shown in Table 1), and the polynucleotides at both ends are six-base compounds. The base composition of the polynucleotides at both ends is diverse, with each of the four bases appearing in approximately 25% of each site.
[0064] Each adapter was mixed with a separate DNA sample and ligated using T4 ligase. The libraries were then transformed using the bisulfite method. Following this, each transformed library was subjected to PCR amplification for 11 cycles. Illumina primers were used for the PCR amplification process. For the P5 and P7 sequences (see Table 7), the denaturation temperature in each cycle was 98°C for 20 seconds; the annealing temperature was 60°C for 30 seconds; and the extension temperature was 72°C for 1 minute (the same applies to Examples 2 and 3 and Comparative Examples 1 and 2).
[0065] To evaluate the ligation efficiency of various adapters, all samples used in each group were synthetic 150nt oligonucleotides, with each replicate in each group consisting of 2ng. The specific sequence information of the oligonucleotide is as follows (Sequence 1): NNNNNNNNNNNNNNNNATTGTTGGATCATATTCGTGACTTGCCTACGCCACCAGCTACAGTCATTTTCAGCAGGCCGGCAAGTTCTGAGGGCATTGGGTGGCCTTGGGAAGATATTTATGCAGTTTAGAACCTGNNNNNNNNNNNNNNNNN.
[0066] Table 1. Library yield using single-chain library construction with 4 different sets of connectors.
[0067]
[0068]
[0069] The calculated mean yield of each group of libraries was 502.5 ng, with a coefficient of variation (CV) of 9.30%. The CV < 10% indicates that the connection efficiency of each group of connectors was consistent.
[0070] Comparative Example 1 Standard Illumina single-chain library construction
[0071] Using the same sample as in Example 1, library construction was performed using the standard Illumina library construction procedure (without using the marker sequences from Example 1, only Illumina's recommended adapters and index sequences were used), with 11 cycles and 2 ng input for both replicates. The library yields for the two replicates were 396 and 366 ng, respectively.
[0072] Comparing the data of Example 1 and Comparative Example 1, it can be seen that using the connector with the marker sequence in Example 1 during the single-chain library construction process does not affect the connection efficiency.
[0073] Example 2 One of the dual-chain database construction methods
[0074] Four sets of adapters were designed. Each set of adapters includes a P5 adapter, a marker sequence attached to one side thereto, a polyguanine sequence complementary to the marker sequence and attached to the P7 adapter, and a T attached to the end of the marker sequence; or it includes a P7 sequencing adapter, a marker sequence attached to one side thereto, a polyguanine sequence complementary to the marker sequence and attached to the P5 adapter, and a T attached to the end of the polyguanine sequence. The modification details of the marker sequences are shown in Table 2.
[0075] DNA samples were treated with A-tailing at the 3' end. Each adapter was mixed with a separate DNA sample and ligated using T4 ligase. The libraries were then transformed using the bisulfite method. Finally, each transformed library was subjected to PCR amplification for 15 cycles.
[0076] To evaluate the ligation efficiency of various adapters, all samples used in each group were products of PCR amplification of Lambda DNA, with an input amount of 5.4 ng. The specific sequence information of Lambda DNA is as follows (Sequence 2): TGGCAGCGACATGGTTTGTTGTTATATGGCCTTCAGCTATTGCCTCTCGGAATGCATCGCTCAGTGTTGATCTGATTAACTTGGCTGACGCCGCCTTGCCCTCGTCTATGTATCCATTGAGCATTGCCGCAATTTCTTTTGTGGTGATGTCTT.
[0077] Table 2 shows one of the library yields using double-chain library construction with four different sets of connectors.
[0078]
[0079] The mean yield of each group of libraries was calculated to be 1980.0 ng, with a coefficient of variation (CV) of 8.00%. The CV < 10% indicates that the connection efficiency of each group of connectors is consistent.
[0080] Comparative Example 2 Standard Illumina double-strand library construction
[0081] Using the same sample as in Example 2, library construction was performed using the standard Illumina library construction procedure (without using the marker sequences from Example 2, only Illumina's recommended adapters and index sequences), with 15 cycles and an input of 5.4 ng. The resulting library yield was 1875.42 ng.
[0082] Comparing the data from Example 2 and Comparative Example 2, it can be seen that using the connector with the marker sequence in Example 2 during the dual-chain library construction process did not affect the connection efficiency.
[0083] Example 3 Part Two of Dual-Chain Database Building
[0084] Repeat the above adapter and process once, with 6 cycles for each group. The sample is a sonicated fragment of gDNA extracted from NA12878 cell clumps (fragment length approximately 200 bp), and the input amount is 100 ng.
[0085] Table 3. Library output using 4 different sets of connectors in a dual-chain library construction (Part 2)
[0086]
[0087]
[0088] The calculated mean yield of each group of libraries was 790.2 ng, with a coefficient of variation (CV) of 2.48%. The CV < 10% indicates that the connection efficiency of each group of connectors was consistent.
[0089] The libraries obtained in Examples 1 and 2 were sequenced. Examples 4 and 5 below describe the data analysis of the sequencing results. The analysis software used included FastQC (v0.12.1), fastp (fastp 0.23.4), and Python (3.10.12). Unless otherwise specified, all parameters and procedures used are those recommended by the software manual, the software author, or Illumina.
[0090] Example 4 Sequencing data analysis of single-stranded libraries
[0091] Sequencing data from the library of Example 1 (replicates were selected for each group) were analyzed. Read lengths were first split using index sequences in the P5 and P7 adapters, and then further split using marker sequences. The proportion of target read lengths was statistically analyzed based on the index and marker sequences.
[0092] Table 4 Sequencing data analysis of single-stranded libraries
[0093]
[0094]
[0095] As can be seen, in the process of building a single-chain library, the connector in this embodiment can reduce the pollution introduced in the experimental steps before linking the index sequences.
[0096] Example 5 Sequencing data analysis of double-stranded libraries
[0097] The sequencing data from the library in Example 2 were analyzed. First, the read lengths were split using index sequences from the P5 and P7 adapters, and then further split using marker sequences. The percentage of target read lengths was statistically analyzed based on the index and marker sequences.
[0098] Table 5 Sequencing data analysis of double-stranded libraries
[0099]
[0100] As can be seen, in the process of building a dual-chain library, the connector in this embodiment can reduce the contamination introduced in the experimental steps before linking the index sequences.
[0101] Table 6 Index Sequence Information
[0102]
[0103] Table 7 Primer sequences used for library construction and PCR amplification
[0104]
Claims
1. A connector for single-chain library construction, comprising a tag sequence, in, The marker sequence includes polycytosine sequences located on one or both sides of the insert fragment, wherein the cytosine on each side exists in two states: modified or unmodified, wherein the modified cytosine is 5-methylcytosine. The length of the polycytosine sequence on each side of the insert fragment is independently 3 bases; The adapters are the P5 and P7 end adapters of the Illumina sequencing platform. The adapters used for single-strand library construction include a 5' adapter and a 3' adapter. The 5' adapter includes a 5' end next-generation sequencing adapter, a marker sequence on one side connected to it, a complementary sequence that is complementary to the sequence of the 5' end next-generation sequencing adapter and the marker sequence on that side, and a polynucleotide (PolyN) sequence connected to the complementary sequence. The 3' adapter includes a 3' end next-generation sequencing adapter, a marker sequence on the other side connected to it, a complementary sequence that is complementary to the sequence of the 3' end next-generation sequencing adapter and the marker sequence on that side, and another polynucleotide sequence connected to the complementary sequence on that side.
2. The connector for single-chain database construction according to claim 1, wherein, The adapters used for single-stranded library construction are mixtures containing multiple polynucleotide sequence motifs, at least one of which can be complementary to the end of the insert fragment.
3. The connector for single-chain database construction according to any one of claims 1-2, wherein, The length of the polynucleotide sequence in the 5' and 3' end adapters is independently at least 1 base.
4. The connector for single-chain database construction according to claim 3, wherein, Each base in the polynucleotide sequence accounts for 20%-30%.
5. The connector for single-chain database construction according to claim 4, wherein, The adapters used for single-strand library construction include a 5' adapter and a 3' adapter. The 5' adapter includes the Illumina sequencing platform's P5 adapter, a marker sequence on one side connected to it, a complementary sequence that is complementary to the sequence of the Illumina sequencing platform's P5 adapter and the marker sequence on that side, and a polynucleotide sequence connected to the complementary sequence. The 3' adapter includes the Illumina sequencing platform's P7 adapter, a marker sequence on the other side connected to it, a complementary sequence that is complementary to the sequence of the Illumina sequencing platform's P7 adapter and the marker sequence, and a polynucleotide sequence connected to the complementary sequence.
6. The connector for single-chain database construction according to claim 1, wherein, One end of the polycytosine sequence is directly linked to the insert fragment or spaced A / T, and the other end is directly linked to the next-generation sequencing adapter.
7. The connector for single-chain database construction according to claim 1, wherein, The cytosine in the second-generation sequencing adapter has been modified so that it does not transform during the library construction process of methylation sequencing.
8. The connector for single-chain database construction according to claim 3, wherein, The lengths of the polynucleotide sequences in the 5' and 3' end adapters are each independently 3-8 bases.
9. The connector for single-chain database construction according to claim 7, wherein, The cytosine in the second-generation sequencing adapters is all 5-methylcytosine.
10. A connector for bichain library construction, comprising a tag sequence, in, The marker sequence includes polycytosine sequences located on one or both sides of the insert fragment, wherein the cytosine on each side exists in two states: modified or unmodified, wherein the modified cytosine is 5-methylcytosine; The length of the polycytosine sequence on each side of the insert fragment is independently 3 bases; The adapters are the P5 and P7 end adapters of the Illumina sequencing platform. The adapter used for double-stranded library construction includes a 3' end next-generation sequencing adapter, a marker sequence attached to one side thereto, a polyguanine sequence that is complementary to the marker sequence and attached to the 5' end next-generation sequencing adapter, and a T attached to the end of the polyguanine sequence.
11. The connector for dual-chain database construction according to claim 10, wherein, The adapters used for double-stranded library construction include the P7 end sequencing adapter of the Illumina sequencing platform, a single-sided marker sequence attached thereto, a polyguanine sequence complementary to the marker sequence and attached to the P5 end adapter of the Illumina sequencing platform, and a T attached to the end of the polyguanine sequence.
12. The connector for dual-chain database construction according to any one of claims 10-11, wherein, The cytosine in the second-generation sequencing adapter has been modified so that it does not transform during the library construction process of methylation sequencing.
13. The connector for dual-chain database construction according to claim 12, wherein, The cytosine in the second-generation sequencing adapters is all 5-methylcytosine.
14. A kit comprising a connector for single-strand library construction as described in any one of claims 1-9 or a connector for double-strand library construction as described in any one of claims 10-13.
15. A methylation sequencing method using the adapter for single-stranded library preparation according to any one of claims 1-9 or the kit of claim 14, comprising ligating an insert fragment to the adapter for single-stranded library preparation.
16. The methylation sequencing method according to claim 15, wherein the ligation process specifically includes mixing the adapter with the insert fragment and using DNA ligase to ligate the adapter for single-strand library construction with the insert fragment.
17. The methylation sequencing method according to any one of claims 15-16, wherein, The method includes converting an existing library.
18. The methylation sequencing method according to claim 17, wherein, The method includes sequencing and then data analysis, which includes splitting reads by indexing and / or tagging sequences.
19. The methylation sequencing method according to claim 18, wherein, This includes calculating the read length percentage of target samples and / or the read length percentage of non-target samples based on the index sequence and / or tag sequence.
20. The methylation sequencing method according to claim 17, wherein, The method includes transforming the library using enzymatic or bisulfite methods.
21. A methylation sequencing method using the adapter for double-stranded library construction according to any one of claims 10-13 or the kit of claim 14, comprising ligating an insert fragment to the adapter for double-stranded library construction.
22. The methylation sequencing method according to claim 21, wherein, The ligation process specifically includes adding an A tail to the 3' end of the insert fragment, mixing the adapter with the insert fragment, and using DNA ligase to ligate the adapter for double-stranded library construction with the insert fragment.
23. The methylation sequencing method according to any one of claims 21-22, wherein, This includes library transformation via enzymatic or bisulfite methods.
24. The methylation sequencing method according to claim 23, wherein, The method includes sequencing and then data analysis, which includes splitting reads by indexing and / or tagging sequences.
25. The methylation sequencing method according to claim 24, wherein, The method includes calculating the read length percentage of target samples and / or the read length percentage of non-target samples based on the index sequence and / or the tag sequence.