Application of OsCRK31 gene in controlling drought resistance of rice

Abstract

The application belongs to the technical field of plant genetic engineering, and discloses OsCRK31 Application of a gene in controlling drought resistance of rice, the application separates, clones and obtains an OsCRK31 gene capable of improving drought tolerance of rice through function verification, the nucleotide sequence of the OsCRK31 gene is shown as SEQ ID NO.1, and the protein sequence coded by the gene is shown as SEQ ID.2. The application clones a drought response gene OsCRK31 of rice, and identifies a CRISPR mutant phenotype of the candidate gene, and the drought stress phenotype identification in the seedling stage and the adult stage shows that the drought stress tolerance of rice is reduced when the gene fragment is deleted, and the function and application approach of the gene are confirmed.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the isolation, cloning, and functional verification of a rice OsCRK31 gene capable of improving drought tolerance, and its application in the genetic improvement of rice drought resistance. This invention employs a candidate gene screening method to clone the rice drought-resistant gene OsCRK31. Using CRISPR technology, an oscrk31 mutant was constructed. Co-segregation analysis showed that the oscrk31 mutant is closely associated with the drought-sensitive phenotype, confirming the function and application pathway of this gene. Background Technology

[0002] Plants are affected by numerous environmental factors during their growth. Drought, cold damage, and high temperatures can lead to large-scale crop yield reductions, posing a bottleneck to agricultural development in many regions. Developing stress-resistant crop varieties has always been a major goal of agricultural science and technology research. To resist or adapt to these adverse factors, plants sense changes in extracellular environmental conditions and transmit these changes into cells through various pathways. This induces the expression of response genes and the production of functional proteins and osmotic regulators that protect cells from stresses such as drought, high salinity, and low temperatures, thus adapting to unfavorable growth environments (Xiong et al., Cell signaling during cold, drought, and salt stress. Plant Cell. 14(suppl), S165–S183, 2002). The proper expression of these functional genes in response to environmental stress is finely regulated by regulatory factors. Transcription factors, as regulatory genes, can regulate the expression of a series of downstream genes when organisms experience abiotic stress, thereby enhancing the plant's tolerance to stress and achieving resistance to adverse environmental conditions. Most types of transcription factors are involved in abiotic stress responses in plants, including AP2 / EREBP, bZip, HD-ZIP, MYB, MYC, NAC, and Zinc finger transcription factors (Yamaguch i-Shinozaki K, Shinozaki K. Transcriptional regulatory networks in cellular responses and tolerance to hydration and cold stresses. Annu Rev Plant Biol, 2006, 57:781-803). Through genetic engineering, some stress-response transcription factors have been successfully applied to rice stress resistance breeding. Transgenic rice plants bred using SNAC1 showed an approximately 30% increase in seed setting rate under drought conditions in the field, while yield remained unaffected and no other phenotypic changes occurred under normal conditions. Transgenic plants also showed significantly enhanced resistance to drought and high salt during the vegetative growth stage (Hu et al. Overexpressing a NAM,ATAF, and CUC(NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci USA, 2006, 103: 12987-12992). These antiretroviral transcription factors function by regulating the expression of a large number of downstream genes.These downstream genes often contain regulatory proteins involved in signal transduction and gene expression, which further form secondary regulatory networks. These downstream genes can also be used for genetic improvement of crop stress resistance. In Arabidopsis, the downstream gene HsfA3 of the heat-shock transcription factor DREB2A can also improve the heat resistance of transgenic overexpressing plants (Yoshida et al. Functional analysis of an Arabidopsis heat-shock transcription factor HsfA3 in the transcriptional cascade downstream of the DREB2A stress-regulatory system. Biochem Biophys Res Comm un, 2008, 368:515-21).

[0003] Plants respond promptly and precisely to their external environment. Besides transcription factors, many other regulatory factors participate in the perception and transmission of stress signals. Reversible phosphorylation of proteins mediated by protein kinases and protein phosphatases is one of the important events in signal transduction. In phosphorylation, protein kinases add a phosphate group to the substrate; while protein kinases remove a phosphate group from the substrate to perform the opposite function. Adding or removing a phosphate group to an enzyme generally leads to its activation or inactivation. It is through this mechanism that protein kinases and protein phosphatases play a crucial role in regulating enzyme activity, thereby regulating the biological processes involved. Receptor-like protein kinases (RLKs) are located on the cell membrane and are transmembrane proteins containing an N-terminal extracellular domain and a C-terminal intracellular kinase domain. They bind signal molecules through their extracellular domain and activate the intracellular kinase domain, thus completing signal transduction. The extracellular domains of cysteine-rich receptor kinases (CRKs) contain one or two DUF26 domains and three conserved cysteine ​​residues C-X8-C-X2-C. Arabidopsis thaliana contains 46 CRKs, which play important roles in the regulation of plant growth and development, stomatal response, hormone response, pathogen defense, and biotic and abiotic stress. The OsCRK31 gene involved in this invention belongs to the rice CRK family; currently, no rice CRKs associated with abiotic stress responses have been reported.

[0004] Rice is an important food crop and model plant. In today's world of frequent extreme weather conditions, breeding rice varieties with enhanced stress resistance is of great significance. Given that the OsCRK31 gene is a cysteine-rich receptor-like kinase, its ability to improve rice stress resistance has not yet been reported. Therefore, isolating the OsCRK31 gene from rice and identifying its function in enhancing rice stress resistance will be of great importance for breeding new stress-resistant rice varieties. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the OsCRK31 gene in rice in controlling the drought resistance of rice, wherein the protein encoded by the OsCRK31 gene is shown in SEQ ID NO.2.

[0006] Another object of the present invention is to provide the application of the OsCRK31 gene in rice in the creation of drought-resistant rice, wherein the protein encoded by the OsCRK31 gene is shown in SEQ ID NO.2.

[0007] To achieve the above objectives, the present invention adopts the following technical measures:

[0008] Using a candidate gene screening method, the applicant cloned the OsCRK31 gene, which controls drought resistance in rice and belongs to the CRKs protein family. Loss of function of this gene leads to reduced drought resistance in rice under drought conditions. The protein encoded by this gene is shown in SEQ ID NO.2, and one of the genes encoding this protein is shown in SEQ ID NO.1.

[0009] The scope of protection of this invention includes:

[0010] Application of the OsCRK31 gene in rice in controlling drought resistance, wherein the protein encoded by the OsCRK31 gene is shown in SEQ ID NO.2;

[0011] The applications described above are specifically as follows:

[0012] Increasing the expression level of the OsCRK31 gene in rice can improve the drought resistance of rice.

[0013] Reduce the expression level of the OsCRK31 gene in rice to weaken its drought resistance;

[0014] Knocking out, suppressing, or silencing the OsCRK31 gene in rice can reduce the drought resistance of rice.

[0015] In the above-described applications, preferably, the knockout is performed using the CRISPR / Cas9 system, in which the target sites of the gRNA are target site 1: CGCCACCGTCCCTACCTCGA and target site 2: GTCTCCGGCCATGTACGCCA.

[0016] In the applications described above, the drought-resistant rice edited by the CRISPR / Cas9 system has polynucleotides as shown in SEQ ID NO.3 or SEQ ID NO.4.

[0017] The application of the OsCRK31 gene in rice in the creation of drought-resistant rice, specifically: introducing substances that increase the expression level of the OsCRK31 gene in rice;

[0018] In the above-described applications, preferably, the substance is a nucleic acid molecule containing the OsCRK31 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0019] The OsCRK31 gene is shown in SEQ ID NO.1.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] The applicant disclosed for the first time that the OsCRK31 gene of rice is related to the drought resistance of rice. This gene can be transformed into a variety of plants, including rice, for the purpose of breeding new drought-resistant plant varieties. Attached Figure Description

[0022] Figure 1 The status of gene editing in the rice oscrk31 CRISPR mutant;

[0023] oscrk31-6 and oscrk31-16 are two homozygous Cas9-free families of oscrk31 CRISPR mutants.

[0024] Figure 2 The seedling drought stress phenotype of rice oscrk31 CRISPR mutant;

[0025] oscrk31-6 and oscrk31-16 are two homozygous oscrk31 CRISPR mutant families without Cas9, with Zhonghua 11 (ZH11) serving as a control.

[0026] Figures A and B show the growth status of the oscrk31-6 family before drought treatment and after drought rehydration; Figures C and D show the growth status of the oscrk31-16 family before drought treatment and after drought rehydration.

[0027] Figure 3Statistics on the survival rate of rice oscrk31 CRISPR mutant seedlings under drought stress;

[0028] oscrk31-6 and oscrk31-16 are two homozygous oscrk31 CRISPR mutant families without Cas9, with Zhonghua 11 (ZH11) serving as a control.

[0029] Figure A shows the survival rate of seedlings under drought stress in the oscrk31-6 family; Figure B shows the survival rate of seedlings under drought stress in the oscrk31-16 family.

[0030] Figure 4 This describes the drought stress phenotype of the rice oscrk31 CRISPR mutant at the adult stage.

[0031] oscrk31-6 and oscrk31-16 are two homozygous oscrk31 CRISPR mutant families without Cas9, with Zhonghua 11 (ZH11) serving as a control.

[0032] Figures A and B show the growth status of the control families ZH11 and oscrk31-6 before and after drought treatment; Figures C and D show the growth status of the control families ZH11 and oscrk31-16 before and after drought treatment.

[0033] Figure 5 Statistics on seed setting rate of rice oscrk36 CRISPR mutant under drought stress at the adult stage;

[0034] oscrk31-6 and oscrk31-16 are two homozygous oscrk31 CRISPR mutant families without Cas9, with Zhonghua 11 (ZH11) serving as a control.

[0035] Figure A shows the seed setting rate statistics of the control ZH11 and oscrk31-6 families after drought treatment; Figure B shows the seed setting rate statistics of the control ZH11 and oscrk31-16 families after drought treatment. Detailed Implementation

[0036] The following embodiments define the present invention and describe the methods for constructing oscrk31 CRISPR mutants, cloning DNA fragments containing the complete coding region of the OsCRK31 gene, and verifying the function of the OsCRK31 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.

[0037] Example 1: Isolation and Cloning of the OsCRK31 Gene

[0038] Primers OsCRK31-FL-F (5'-ATGCG CCGCCACCGTCCCTA-3') and OsCRK31-FL-R (5'-TCATCTCGGCACAAGCTCTG-3') were designed based on the Rice Data gene database (http: / / www.ricedata.cn / gene / ). Using cDNA from the rice cultivar Nipponbare (a well-known and widely used rice cultivar) as a template, the CDS sequence encoding the OsCRK31 gene was amplified using primers OsCRK31-FL-F and OsCRK31-FL-R.

[0039] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, for 33 cycles. The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega) using the TA cloning method. Positive clones were screened and confirmed by sequencing to obtain the CDS sequence of OsCRK31 (the sequence is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2).

[0040] The applicant named the clone pGEM OsCRK31 plasmid, from which a DNA fragment of the complete coding region of the OsCRK31 gene can be obtained.

[0041] Example 2: Construction of OsCRK31 gene overexpression vector

[0042] The positive clone pGEM-OsCRK31 obtained in Example 1 was amplified using primers OsCRK31-OE-F (5'-tacgaacgatagccggtacc ATGCGCCGCCACCGTCCCTA-3') and OsCRK31-OE-R (5'-ttgcggactctagaggatcc TCATCTCGGCACAAGC TCTG-3') to produce a DNA fragment containing the complete coding region of the OsCRK31 gene. The PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, for 30 cycles. The obtained PCR product was ligated into the pU1301 vector digested with restriction endonucleases KpnI and BamHI using the Gibson Assembly method. The vector was sequenced for confirmation, and finally, an OsCRK31 gene overexpression vector suitable for genetic transformation was obtained.

[0043] Example 3: Construction of oscrk31 CRISPR mutant

[0044] The OsCRK31 gene sequence was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). Two target sites were selected using CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Vector construction for CRISPR mutant lines can be referenced in relevant literature (He Yubing et al., Programmed self-elimination of the CRISPR / Cas9 construct greatly accelerates the isolation of edited and transgene-free rice plants. Mol. Plant. 2018, 05.005.), and will not be described further in this manual due to space limitations. The target sites selected from the CRISPR-P v2.0 website are as follows:

[0045] Target site 1: CGCCACCGTCCCTACCTCGA, Target site 2: GTCTCCGGCCATGTACGCCA.

[0046] The constructed CRISPR vector OsCRK31-CRISPR was transferred into the rice variety “Zhonghua 11” (a conventional rice variety from the Rice Research Institute of the Chinese Academy of Agricultural Sciences) using an Agrobacterium-mediated rice genetic transformation method (specific steps described below). After pre-culture, infection, co-culture, screening for hygromycin-resistant calluses, differentiation, rooting, hardening-off, and transplanting, transgenic plants were obtained. The above Agrobacterium-mediated rice (Zhonghua 11) genetic transformation method (system) was improved based on the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994) (see transformation steps below).

[0047] The specific genetic transformation steps in this embodiment are as follows:

[0048] (1) Electroporation: The final CRISPR target vector OsCRK31-CRISPR was electroporated into Agrobacterium EHA105 strain at 1800V. The resulting cells were plated onto LA medium with corresponding resistance selection, and positive clones were screened for use in the following callus transformation.

[0049] (2) Callus induction: Remove the husk from mature rice seeds of variety 11, then treat them with 70% ethanol for 1 minute, and then disinfect the seed surface with 0.15% mercuric chloride (HgCl2) for 15 minutes; wash the seeds with sterile water 4-5 times; place the disinfected seeds on the induction medium; and incubate the inoculated callus induction medium in the dark for 4 weeks at a temperature of 25±1℃.

[0050] (3) Callus subculture: Select bright yellow, firm and relatively dry embryogenic callus, place it on subculture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0051] (4) Pre-culture: Select firm and relatively dry embryogenic callus, place it on pre-culture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0052] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the CRISPR vector OsCRK31-CRISPR of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28°C; the Agrobacterium was then transferred to suspension medium and cultured on a shaker at 28°C for 2-3 hours.

[0053] (6) Agrobacterium infection: Transfer the pre-cultured callus to a sterilized bottle; adjust the Agrobacterium suspension to OD. 600 0.8-1.0; Soak the callus in Agrobacterium suspension for 30 minutes; Transfer the callus to sterilized filter paper and blot dry; Then place it on co-culture medium and incubate for 3 days at a temperature of 19-20℃.

[0054] (7) Callus washing and selection culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterile filter paper and blot dry; transfer the callus to selection medium and select 2-3 times, each time for 2 weeks (the concentration of carbenicillin for the first screening is 400 ppm, and the concentration of hygromycin is 250 ppm for the second and subsequent screenings).

[0055] (8) Differentiation: Transfer the resistant callus to the pre-differentiation medium and culture it in the dark for 5-7 weeks; transfer the pre-differentiated callus to the differentiation medium and culture it under light at a temperature of 26℃.

[0056] (9) Rooting: Cut off the roots that are produced during differentiation; then transfer them to a rooting medium and culture them under light for 2-3 weeks at a temperature of 26℃.

[0057] (10) Transplanting: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems to the greenhouse, while keeping them moist for the first few days.

[0058] Based on the aforementioned gene editing target sites, primers were designed to detect the editing status of the OsCRK31 gene in the mutant. Specific PCR amplification of the OsCRK31 gene was performed using primers (OsCRK31-CR-F: 5'-AACAAATGATGTGCCTAAACCACTTTC-3' and OsCRK31-CR-R: 5'-GGAGCTGG CAGAGGTCGTAGAAGA-3'). The amplified PCR products were sequenced, and the presence of Cas9 was detected. Sequencing results showed that in the oscrk31-6 CRISPR homozygous Cas9-free mutant family (SEQ ID NO.3), the OsCRK31 gene had a 3-base deletion at target site 1 and a 1-base deletion at target site 2; in the oscrk31-16 CRISPR homozygous Cas9-free mutant family (SEQ ID NO.4), the OsCRK31 gene had a 1-base deletion at target site 1 and a 1-base deletion at target site 2, meaning that the OsCRK31 gene was mutated in both mutant families.

[0059] Example 4: Identification of drought stress phenotype in oscrk31 CRISPR mutant seedlings

[0060] Homozygous mutants (oscrk31) (including oscrk31-6 and oscrk31-16) with identified genotypes and the control wild-type (i.e., non-GMO, the same below) rice variety Zhonghua 11 (ZH11) were directly sown into small cylindrical containers after germination. One half of the containers was planted with the mutant material, and the other half with the control wild-type rice variety Zhonghua 11, with 12 plants in each half. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand at a volume ratio of 2:3. An equal volume of water was added to each container, allowing the water to seep out to ensure consistent soil compaction. The experiment was repeated three times. Healthy rice plants at the 4-leaf stage were subjected to drought stress for 7 days, followed by a 7-day recovery period after rehydration. Photographs were taken, and the survival rate of the plants was investigated.

[0061] The results showed that, compared with the ZH11 control, the CRISPR homozygous mutant plants exhibited a drought-sensitive phenotype. Figure 2 After drought and rehydration, the average survival rates of the oscrk31-6 mutant and the control ZH11 in the small cylindrical tanks were 37% and 70.4%, respectively, while the average survival rates of the oscrk31-16 mutant and the control ZH11 were 33.3% and 70.4%, respectively. Statistical results indicate that the survival rate of the oscrk31 mutant after drought and rehydration was significantly lower than that of the wild-type control ZH11. Figure 3 ).

[0062] Example 5: Identification of drought stress phenotype in adult oscrk31 CRISPR mutants

[0063] To identify the phenotype of the mutants at the adult stage, the mutants (including oscrk31-6 and oscrk31-16) and their control (ZH11) were planted in sandy fields with movable rain shelters. The soil was a mixture of southern paddy soil and coarse sand at a volume ratio of 1:2. Ten plants were planted per row and two rows were planted per family. The experiment was conducted with three biological replicates to carry out the severe drought stress experiment.

[0064] Drought stress involved withholding water for 20 days from healthy, mature plants (with portable rain shelters in place during rainy days), followed by rehydration. Compared to the ZH11 control, the homozygous mutants oscrk31-6 and oscrk31-16 exhibited a drought-sensitive phenotype. Figure 4 After drought and rehydration, the average seed set rate per plant of the surviving oscrk31-6 mutant and the control ZH11 was 9% and 24.4%, respectively, while the average seed set rate per plant of the surviving oscrk31-16 mutant and the control ZH11 was 8.7% and 28%, respectively. Statistical results indicate that the seed set rate of the oscrk31 mutant after drought and rehydration was significantly lower than that of the wild-type control ZH11. Figure 5 ).

Claims

1. In rice OsCRK31 The application of genes in controlling drought resistance in rice, as described OsCRK31 The gene encodes the protein shown in SEQ ID NO.2, and the control described is to increase the content of rice. OsCRK31 The expression level of genes can be used to improve the drought resistance of rice.

2. In rice OsCRK31 The application of genes in the creation of drought-resistant rice, as described OsCRK31 The gene encodes the protein shown in SEQ ID NO.2, and its application process includes increasing the content of protein in rice. OsCRK31 The substance that increases gene expression levels is introduced into rice; the substance contains... OsCRK31 Nucleic acid molecules of genes, or their expression cassettes, recombinant vectors, and recombinant microorganisms.

3. The application according to claim 1 or 2, wherein... OsCRK31 The gene is shown in SEQ ID NO.1.

Images