A primer pair and method for specifically amplifying a target gene using the OTARMS system

Abstract

The present invention belongs to the field of biotechnology, and discloses a primer pair and method for specifically amplifying a target gene using an OTARMS system. The primer pair includes a first primer and an amplification blocking primer used in pair, the first part of the amplification blocking primer is complementary to the target gene, and the second part is an open end. The amplification blocking primer anneals with the first amplification product as a whole primer from the second amplification cycle to form a completely complementary fragment, and the binding force between the amplification blocking primer and the first amplification product is greater than the binding force between the first part and the target gene. The amplification blocking primer can specifically bind to the target gene to complete the extension amplification, block the amplification of mutant sequences or non-target sequences, and realize efficient and specific amplification of highly similar genes. The introduction of the second part of the amplification blocking primer greatly improves the binding force between the amplification primer and the amplified product, further ensuring the specificity of the amplification.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a gene amplification method, and in particular to a primer pair and method for specifically amplifying a target gene using an OTARMS system. Background Art

[0002] Genes are the basic units of heredity. Nucleic acid sequences that carry genetic information pass on genetic information to the next generation through replication, and control the expression of traits of biological individuals by guiding protein synthesis. Genetic testing technology is a technology that detects DNA or RNA through blood, tissue or other samples carrying nucleic acids. It is a technology that amplifies the nucleic acids in the tested samples and displays the nucleic acid information through specific methods or specific equipment. In practical applications, it is often necessary to perform base identification or differential amplification of nucleic acids at a certain site (such as SNP sites). If it is necessary to identify or differentially amplify the target sequence, but there are sequences similar to or even highly similar to the sequence to be tested in the tested sample, it will bring unimaginable challenges to the actual detection, especially when there are only a few or even a few inconsistent sequences, it is even more difficult to distinguish and amplify.

[0003] Therefore, it is necessary to design a detection system that is simple to use, low-cost, and can accurately identify different sequences with single-site differences. Summary of the invention

[0004] The object of the present invention is to overcome at least one disadvantage of the prior art and to provide a primer pair and method for specifically amplifying a target gene using an OTARMS (Open Terminal Amplification Refractory Mutation System) system.

[0005] The technical solution adopted by the present invention is:

[0006] The first aspect of the present invention provides: a primer pair for specifically amplifying a target gene, comprising a first primer and an amplification blocking primer used in pair, wherein the amplification blocking primer consists of a first part and a second part, wherein: the first part is complementary to the target gene and can guide base synthesis and trigger template amplification; the second part is an open end and cannot form a complementary fragment with the target gene, the first part and the second part are annealed with the first amplification product as a whole primer during the second amplification cycle to form a completely complementary fragment, and the binding force between the amplification blocking primer and the first amplification product is greater than the binding force between the first part and the target gene.

[0007] In some examples of primer pairs, the length of the first part of the amplification retardation primer is 13 to 23 bases.

[0008] In some examples of primer pairs, the 3' end of the first part of the amplification retardant primer is set at a position where the bases of the target gene and the non-target gene are inconsistent.

[0009] In some examples of primer pairs, at least one base different from the bases of the target gene and the non-target gene is introduced at the 2nd to 5th base position from the 3' end to the 5' end of the first part of the amplification retardant primer.

[0010] In some examples of primer pairs, the first part of the amplification retardant primer introduces 1 to 3, 1 or 2 bases different from the target gene and non-target gene bases at the 2nd to 5th base positions from the 3' end to the 5' end.

[0011] In some examples of primer pairs, the length of the first part of the amplification blocking primer is 13 to 23 bases, and the 3' end of the first part of the amplification blocking primer is set at a position where the bases of the target gene and the non-target gene are inconsistent.

[0012] In some examples of primer pairs, the base that is different from both the target gene and non-target gene bases is C.

[0013] In some examples of primer pairs, the second portion of the amplification retardation primer has a length of 6 to 15 bases.

[0014] In some examples of primer pairs, the second portion of the amplification retardation primer balances the GC content of the target fragment.

[0015] In some examples of primer pairs, the temperature at which the first part of the amplification retardation primer binds to the target gene to initiate template amplification is 56-66°C.

[0016] In some examples of primer pairs, the length of the second part of the amplification blocking primer is 6 to 15 bases, and the second part of the amplification blocking primer balances the GC content of the target fragment.

[0017] In some examples of primer pairs, the length of the second part of the amplification blocking primer is 6 to 15 bases, and the temperature at which the first part of the amplification blocking primer binds to the target gene to initiate template amplification is 56 to 66°C.

[0018] In some examples of primer pairs, the second part of the amplification blocking primer has a length of 6 to 15 bases, the second part of the amplification blocking primer balances the GC content of the target fragment, and the temperature at which the first part of the amplification blocking primer binds to the target gene to initiate template amplification is 56 to 66°C.

[0019] In some examples of primer pairs, the first primer also has the characteristics of the amplification retardant primer.

[0020] The above technical features can be combined arbitrarily without conflict.

[0021] The second aspect of the present invention provides: a method for specifically amplifying a target gene using an open end amplification blocking mutation system, comprising the following steps:

[0022] S1) extracting and obtaining the gene template to be tested;

[0023] S2) adding the primer pair described in the first aspect of the present invention to the template to amplify the target gene.

[0024] The beneficial effects of the present invention are:

[0025] In the primer sets of some examples of the present invention, the amplification blocking primers therein can specifically bind to the target gene to complete the extension amplification, while having the ability to block the amplification of mutant sequences or non-target sequences, thereby achieving efficient and specific amplification of highly similar genes, such as SNPs.

[0026] In the primer sets of some examples of the present invention, the introduction of the second part of the amplification blocking primer (OTARMS primer) greatly enhances the binding force between the amplification primer and the amplified product, and there is a difference of ≥1 or 2 bases between the amplification primer and the mutant gene or the non-target gene. At a higher temperature, the amplification primer and the target product can anneal normally to complement each other and initiate extension, while the possibility of the amplification primer binding to the mutant gene or the non-target gene is greatly reduced, thereby achieving the purpose of further blocking the amplification of the mutant gene or the non-target gene.

[0027] In the primer sets of some examples of the present invention, the open sequence introduced by the amplification blocking primer gradually becomes the main amplification template in the subsequent amplification, and the OTARMS primer can completely match the template containing the open sequence, and the amplification efficiency of the primer that completely matches the template is increased. That is, the system ensures that the early cycles can block the amplification of mutant genes or non-target gene sequences. After ensuring that the specific sequence has an absolute advantage, another set of sequence primers that trigger amplification are activated, so that the target template amplification can be completed with higher efficiency in the subsequent amplification.

[0028] The primer sets of some examples of the present invention have both open sequences and open designs, and thus can be easily applied to different technical platforms, including but not limited to the following platforms and detection methods:

[0029] 1) High-throughput sequencing platform, through the open-end design, sets the sequence to be complementary to the sequencing adapter or universal amplification primer, so there is no need to perform multiple steps such as end repair, adding "A" and adding "adapters". The complete library structure can be constructed by introducing sequencing-related adapters or universal amplification primers only through PCR amplification.

[0030] 2) Used for qualitative detection in QPCR detection platform: Adding fluorescent dye or fluorescent probe into the amplification system can perform real-time fluorescence detection.

[0031] 3) Used for quantitative detection in QPCR detection platform: By adding an internal standard gene amplification system to the amplification system, the ratio of the detection target to the internal standard gene can be used to determine whether the detection target is a single copy or a double copy. The results can be reported by fluorescent dyes or fluorescent probes.

[0032] 4) In the PCR detection method, after the amplification system of the present invention is completed, the result can be reported by agarose gel electrophoresis. When the object to be tested contains the target gene, the agarose gel electrophoresis has a band of corresponding size. If the object to be tested does not contain the target gene, the agarose gel electrophoresis does not have a band of corresponding size. The result can also be reported by Sanger sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is the electrophoresis diagram of the detection result of Example 1.

[0034] Figure 2 It is the electrophoresis diagram of the detection results of Example 2.

[0035] Figure 3 It is the electrophoresis diagram of the detection results of Example 3. DETAILED DESCRIPTION

[0036] An Open Terminal Amplification Refractory Mutation System (OTARMS) is used to amplify and detect target genes. The OTARMS system mainly includes specially designed OTARMS primers that can block mutant sequences or non-target sequences. There are three combinations to implement the system: ① forward OTARMS primer + common reverse primer; ② forward OTARMS primer + reverse OTARMS primer; ③ forward common primer + reverse OTARMS primer.

[0037] The structure of OTARMS primers consists of two parts: the amplification part (the first part) and the open end (the second part).

[0038] The amplification part of the OTARMS primer is the complementary binding part with the target gene, and the length is 13 to 23 bases. This part can guide base synthesis at the initiation temperature and initiate template amplification. Further, the 3' end of the amplification part is set at a position where the bases of the target gene and the mutant gene or the non-target gene are inconsistent, which is conducive to further improving the specificity of amplification and reducing non-specific amplification; further, at least one base different from the bases of the target gene and the mutant gene or the non-target gene is introduced at the position of the 2nd to 5th bases in the direction of the 3' end of the amplification part to the 5' end (such as the target gene and the mutant gene are point mutations A→T, and the bases different from the bases of the target gene and the mutant gene or the non-target gene can be C or G), and the preferred base is C. By introducing at least one, preferably 1 to 3, and more preferably 1 to 2 bases different from the bases of the target gene and the non-target gene, greater steric resistance is introduced to achieve a better blocking effect. C base has greater steric hindrance than other A, C, and T bases, and is a better choice.

[0039] The open end of the OTARMS primer is 6 to 15 bases in length. This fragment cannot form a complementary fragment with the target gene, and there are no special requirements for the sequence.

[0040] The first and second parts of the OTARMS primer can be used as a whole primer to anneal and complement with the product of the first round in the second cycle, thus forming a completely complementary fragment. The mutual binding force between the OTARMS primer and the first round amplification product is greater than the binding force between the first part of the OTARMS primer and the target genome. Therefore, starting from the third cycle of the amplification reaction, the amplification initiated by the OTARMS primer as a whole primer is the dominant amplification, and the second part as part of the amplified fragment, the product located at the most external source of the product will become the dominant product. Using this product as a template, the difference between the product and the original mutant sequence or non-target sequence is ≥1 or 2 bases, and the primer is completely matched with the product. At a higher annealing temperature, it is more likely to block the amplification of the mutant sequence or non-target sequence. At the same time, the sequence of the second part can also balance the GC content of the target fragment, and its advantage is more obvious in fragments with too high or too low GC content; it is beneficial to reduce the nonspecific amplification of complex target fragments, especially repetitive region fragments, and improve their amplification efficiency; during amplification, the second part, as part of the amplified fragment, is located at the outermost part of the product to avoid the influence of the ultra-long genome on the amplification process.

[0041] The first part and the second part of the OTARMS primer can be directly connected or connected using a Spacer commonly used in the art. Commonly used Spacers include straight carbon chains or ethylene glycol (C3 or C6).

[0042] Combination No. ①: forward OTARMS primer + common reverse primer. The forward OTARMS primer contains two parts: a forward amplification part and an open end. The amplification part is complementary to the annealing of the target fragment to initiate amplification; the common reverse primer is a primer that can anneal to the complementary fragment of the target fragment to initiate synthesis.

[0043] Combination No. ②: forward OTARMS primer + reverse OTARMS primer. The forward OTARMS primer contains two parts, the forward amplification part and the open end: the amplification part is annealed and complementary to the target fragment to initiate amplification; the reverse OTARMS primer contains two parts, the reverse amplification part and the open end: the reverse amplification part is able to anneal and complement with the complementary fragment of the target fragment to initiate synthesis.

[0044] Combination No. ③: forward common primer + reverse OTARMS primer. The forward common primer is a primer that anneals with the target fragment to complement and initiate synthesis; the reverse OTARMS primer contains two parts: a reverse amplification part and an open end. The reverse amplification part can anneal with the complementary fragment of the target fragment to complement and initiate synthesis.

[0045] The technical solution of the present invention is further explained below in conjunction with examples.

[0046] Example 1: Detection of KRAS gene G12A mutation

[0047] The OTARMS primer amplification system was designed for the KRAS gene to detect the mutation site G12A.

[0048] 1. Sample DNA extraction and concentration determination:

[0049] For the FFPE samples to be tested, the genomic DNA of KRAS G12A positive and negative samples was extracted using a genome extraction kit, and the concentration and purity were measured using an ultraviolet spectrophotometer to ensure that the extracted DNA was of qualified quality.

[0050] 2. Selection of gene detection sites and OTARMS primer design:

[0051] Obtain the KRAS gene, select the 500bp sequence upstream and downstream of the G12A mutation site, design amplification primers for the mutation site, select the upstream primer to design the OTARMS primer, the end of which completely matches the genome of the mutation site. At the same time, add a mismatched base at the 4th position from the 3' end, design the second part to 6bp, and connect the first and second parts with a spacer. The specific primer sequences are as follows:

[0052] G12A-OTARMS forward primer: GGACTC-Spacer-GCACTCTTGCCTACGCCAC (SEQ ID NO.: 1)

[0053] G12A-OTARMS reverse primer: GTACAGTTCATTACGATACACGTCT (SEQ ID NO.: 2).

[0054] 3. Amplification reaction system:

[0055] Prepare the system according to the following table

[0056]

[0057] 4. Amplification reaction conditions:

[0058] Denature at 95°C for 5 min, then perform 40 cycles of 95°C for 15 s and 60°C for 30 s.

[0059] 5. Result judgment:

[0060] Amplification products can be determined by agarose gel electrophoresis

[0061] When the sample to be tested has a band consistent with the positive sample, it is judged that the sample to be tested carries the G12A mutation, but when the sample to be tested does not have a band consistent with the positive sample, it is judged that the sample to be tested does not carry the G12A mutation. In addition, during the experiment, the negative sample cannot have a band consistent with the positive sample. Each positive and negative template is double-welled, with 1-2 wells for KRASG12A negative samples and 3-4 wells for KRAS G12A negative samples. The electrophoresis results are as follows Figure 1 shown.

[0062] Example 2: Detection of KRAS gene G13D mutation

[0063] The OTARMS primer amplification system was designed for the KRAS gene to detect the mutation site G13D.

[0064] 1. Sample DNA extraction and concentration determination:

[0065] For the FFPE samples to be tested, the genomic DNA of KRAS G13D positive and negative samples was extracted using a genome extraction kit, and the concentration and purity were measured using an ultraviolet spectrophotometer to determine whether the extracted DNA was of qualified quality.

[0066] 2. Selection of gene detection sites and OTARMS primer design:

[0067] Obtain the KRAS gene, select the 500bp sequence upstream and downstream of the G13D mutation site, design amplification primers for the mutation site, select the upstream primer to design the OTARMS primer, the end of which completely matches the genome of the mutation site. At the same time, add a mismatched base at the 4th position from the 3' end, design the second part to 6bp, and connect the first and second parts with a spacer. The specific primer sequences are as follows:

[0068] G13D-OTARMS forward primer: CCTAGA-Spacer-TTGTTGGATCATATTCCTC (SEQ ID NO.: 3)

[0069] G13D-OTARMS reverse primer: TAGCTC-Spacer-ATACACGTCTGCAGTCAACTG (SEQ ID NO.: 4).

[0070] 3. Amplification reaction system:

[0071] Prepare the system according to the following table

[0072]

[0073] 4. Amplification reaction conditions:

[0074] Denature at 95°C for 5 min, then perform 40 cycles of 95°C for 15 s and 60°C for 30 s.

[0075] 5. Result judgment:

[0076] Amplification products can be determined by agarose gel electrophoresis

[0077] When the sample to be tested has a band consistent with the positive sample, it is judged that the sample to be tested carries the G13D mutation, but when the sample to be tested does not have a band consistent with the positive sample, it is judged that the sample to be tested does not carry the G13D mutation. In addition, during the experiment, the negative sample cannot have a band consistent with the positive sample. Two duplicate wells are made for each positive and negative template. Wells 1 and 3 are KRASG13D positive samples, and wells 2 and 4 are KRAS G13D negative samples. The electrophoresis results are as follows: Figure 2 shown.

[0078] Example 3: Detection of EGFR gene L858R mutation

[0079] The OTARMS primer amplification system was designed for the EGFR gene to detect the mutation site L858R.

[0080] 1. Sample DNA extraction and concentration determination:

[0081] For the FFPE samples to be tested, the genomic DNA of EGFR L858R positive and negative samples was extracted using a genome extraction kit, and the concentration and purity were measured using an ultraviolet spectrophotometer to determine whether the extracted DNA was of qualified quality.

[0082] 2. Selection of gene detection sites and OTARMS primer design:

[0083] Obtain the EGFR gene, select the 500bp sequence upstream and downstream of the L858R mutation site, design amplification primers for the mutation site, select the upstream primer to design the OTARMS primer, the end of which completely matches the genome of the mutation site. At the same time, add a mismatched base at the 4th position from the 3' end, design the second part to 6bp, and connect the first and second parts with a spacer. The specific primer sequences are as follows:

[0084] L858R-OTARMS forward primer: CCCTGAATTCGGATGCAGAGC (SEQ ID NO.: 5)

[0085] L858R-OTARMS reverse primer: GTTACT-Spacer-TCCGCACCCAGCAGTTTCGCCA (SEQ ID NO.: 6).

[0086] 3. Amplification reaction system:

[0087] Prepare the system according to the following table

[0088]

[0089] 4. Amplification reaction conditions:

[0090] Denature at 95°C for 5 min, then perform 40 cycles of 95°C for 15 s and 60°C for 30 s.

[0091] 5. Result judgment:

[0092] The amplification product can be determined by agarose gel electrophoresis. When the sample to be tested has a band consistent with the positive sample, it is judged that the sample to be tested carries the L858R mutation, but when the sample to be tested does not have a band consistent with the positive sample, it is judged that the sample to be tested does not carry the L858R mutation. In addition, during the experiment, the negative sample cannot have a band consistent with the positive sample. Two duplicate wells are made for each positive and negative template. Wells 1 and 3 are EGFR L858R positive samples, and wells 2 and 4 are EGFR L858R negative samples. The electrophoresis results are as follows: Figure 3 shown.

[0093] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. A primer pair for specifically amplifying a target gene, comprising a first primer and an amplification blocking primer used in pair, wherein the amplification blocking primer consists of a first part and a second part, the first part and the second part are directly connected or connected using a spacer, wherein: The first part is complementary to the target gene, and this part can guide base synthesis and trigger template amplification. The length of the first part of the amplification blocking primer is 13 to 23 bases. The 3' end of the first part of the amplification blocking primer is set at a position where the bases of the target gene and the non-target gene are inconsistent. At least one base different from the bases of the target gene and the non-target gene is introduced at the position of the 2nd to 5th bases in the direction from the 3' end of the first part of the amplification blocking primer to the 5' end, and the base different from the bases of the target gene and the non-target gene is C. The second part is an open end and cannot form a complementary fragment with the target gene. The second part of the amplification blocking primer balances the GC content of the target fragment. The length of the second part of the amplification blocking primer is 6 to 15 bases. The first part and the second part anneal to the first amplification product as a whole primer in the second amplification cycle to form completely complementary fragments, and the binding force between the amplification blocking primer and the first amplification product is greater than the binding force between the first part and the target gene.

2. The primer pair according to claim 1, characterized in that The temperature at which the first part of the amplification blocking primer binds to the target gene to initiate template amplification is 56-66°C.

3. The primer pair according to claim 1, characterized in that The first primer also has the characteristics of the amplification retardation primer.

4. A method for specifically amplifying a target gene using an open end amplification blocking mutation system, comprising the following steps: S1) extracting and obtaining the gene template to be tested; S2) adding the primer pair according to any one of claims 1 to 3 to the template to amplify the target gene.

Images