Oral care solution containing recombinant collagen and preparation method and composition thereof

Abstract

The present application relates to the field of oral care, and to an oral care liquid and its preparation method and composition. In terms of mass percentage, the oral care liquid includes: 0.1-0.5% recombinant collagen; 0.3-0.7% laver polysaccharide; 0.1-1% goldenrod extract; 0.5-4% solubilizer; 10-30% moisturizer; and the balance of water. The laver polysaccharide molecules and collagen molecules are compounded, the molecules are entangled with each other, the non-covalent bonds attract each other, the van der Waals force and electrostatic attraction between the molecules increase, the polysaccharide molecules and the collagen molecules will attract each other to form a tighter biofilm, and when the formed biofilm is combined with the oral mucosa, it will adhere tightly to the mucosa. The combination of the two improves the film-forming speed and the film's resistance to flushing, greatly improves the physical isolation effect on the damaged oral mucosa, relieves pain, and improves the long-term sustained-release effect of the biofilm, and improves the bioavailability of the goldenrod extract.

Description

Technical Field

[0001] The present application relates to the field of oral care, and in particular, to an oral care solution containing recombinant collagen and a preparation method and composition thereof. Background Art

[0002] The common oral care solutions on the market are mainly for prevention, and cannot provide targeted repair for existing mucosal damage and wounds. Or they can relieve wound pain to a certain extent, but the effect is relatively limited and has no effect on wound repair.

[0003] For example, an oral care solution has been disclosed, which comprises, by weight: 1%-20% of a medicinal plant extract, Sodium sulfonate 0.005-0.5%, effective ingredients 0.1%-10%, antibacterial agent 0.01%-0.5%, solubilizer 1-15%, sweetener 0.01%-5%, thickener 1-20%, essence 0.01%-0.5%, ethanol 0.1%-5%, water 13%-90%, pH adjuster 0.001%-10%. The oral care solution of the invention contains medicinal plant extracts with good taste acceptance and effective ingredients for protecting mucous membranes. It has a natural and pure taste and is suitable for use when the mouth is uncomfortable and for daily oral care. In terms of efficacy, it has the following functions: cleaning the mouth and teeth, relieving toothache, bleeding gums, oral ulcers, gingivitis, periodontitis, sore throat and other discomfort symptoms, and protecting the health of the oral cavity. The care solution mainly plays a preventive role and cannot provide targeted repair for existing mucosal damage and wounds. It also contains ethanol, which will cause secondary stimulation to the wound and is difficult to persist in using. Consumers generally do not accept this type of product.

[0004] Another oral care solution for relieving pain in oral wounds has been disclosed, comprising the following raw materials by weight: 80-120 parts of recombinant human collagen, 25-35 parts of composite plant extracts, 200-300 parts of PBS buffer, 8-12 parts of saccharin sodium, 10-20 parts of carbomer homopolymer A, and 3-8 parts of glycerol, wherein the composite plant extract is extracted from Patrinia scabra, Paeonia purpurogena, and Pyrus cashew. However, the oral care solution only helps to relieve wound pain, and its effect is relatively limited, and it has no effect on wound repair. Summary of the invention

[0005] The purpose of the embodiments of the present application is to provide an oral care solution containing recombinant collagen and a preparation method and composition thereof.

[0006] In a first aspect, the present application provides an oral care solution, which comprises, by mass percentage:

[0007] The invention comprises 0.1%-0.5% recombinant collagen, 0.3%-0.7% laver polysaccharide, 0.1%-1% solidago extract, 0.5%-4% solubilizer, 10%-30% moisturizer and the balance is water.

[0008] In the above technical scheme, the compounding of laver polysaccharide molecules and collagen molecules can realize mutual entanglement between molecules, mutual attraction of non-covalent bonds, increase of van der Waals force and electrostatic attraction between molecules, polysaccharide molecules and collagen molecules will attract each other to form a tighter biofilm, when the formed biofilm is combined with the oral mucosa, it will adhere tightly to the mucosa, and the combination of the two improves the film-forming speed and the film's resistance to flushing, greatly improves the physical isolation effect of the damaged oral mucosa, relieves pain, and improves the long-term sustained release effect of the biofilm, allowing the active substance to act for a long time, and improves the bioavailability of the Goldenrod extract. The Goldenrod extract can balance the oral microbiome and fight against oral pathogens; the compounding of the three can achieve the effect of long-term sustained release of active substances, so that the oral care solution of the present invention has a long-term antibacterial effect. On the other hand, collagen and polysaccharide molecules have immune properties of anti-inflammatory and cell proliferation promotion, and the formation of a tighter biofilm also promotes the repair of damaged mucosa.

[0009] In other embodiments of the present application, the nucleotide sequence of the above-mentioned recombinant collagen includes the sequence shown in SEQ ID NO: 1;

[0010] The nucleotide sequence shown in SEQ ID NO: 1 is:

[0011] atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctggtcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaacaaggtccctctggagcaagtg gtgaacgtgg tccccctggt cccatgggcc cccctggattggctggaccccctggtgaat ctggacgtga gggggctcct ggtgccgaag gttcccctggacgagacggttctcctggcg ccaagggtga ccgtggtgag accggccccg ctggaccccctggtgctcctggtgctcctg gtgcccctgg ccccgttggc cctgctggca agagtggtgatcgtggtgagactggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggtcctcctggaa agaatggtga aactggacct cagggacccc cagggcctactgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggcttgcctggtacaggtggtcctc caggagaaaa tggaaaacct ggggaaccag gtccaaagggtgatgccggtgcacctggag ctccaggagg caagggtgat gctggtgccc ctggtgaacgtggacctcctggattggcag gggccccagg acttagaggt ggagctggtc cccctggtcccgaaggaggaaagggtgctg ctggtcctcc tgggccacct ggtgctgctg gtactcctggactacaaggaatgcctggcc cgccaggtcc atgctgtgga ggtggataa。

[0012] In other embodiments of the present application, the porphyran is an aqueous extract of laver;

[0013] Optionally, obtaining the porphyran includes:

[0014] After the laver is crushed, water is added for extraction; the extraction time is 3h to 4h, the extraction temperature is 80℃ to 120℃; the mass ratio of laver to water is 1: (50-70);

[0015] Optionally, after extraction, the extract is purified and freeze-dried.

[0016] In other embodiments of the present application, the obtained Solidago scabra extract includes:

[0017] The yellow flower was extracted with alcohol under high pressure pulse conditions;

[0018] Optionally, the pulse electric field pressure of the high voltage pulse is 300 MPa to 600 MPa; the holding time is 8 min to 10 min;

[0019] Optionally, the alcohol includes methanol; Optionally, during alcohol extraction, the mass ratio of Goldenrod flos scabra to alcohol is 1 g: (15-30) mL;

[0020] Optionally, the volume fraction of alcohol is 65% to 75%.

[0021] In other embodiments of the present application, the weight ratio of recombinant collagen to laver polysaccharide is (0.1-0.5): (0.3-0.7).

[0022] In other embodiments of the present application, the solubilizer includes at least one of hydrogenated castor oil, poloxamer or Tween.

[0023] In other embodiments of the present application, the humectant includes a polyol;

[0024] Optionally, the moisturizer includes at least one of sorbitol, glycerin, polyethylene glycol, propylene glycol, 1,3-butylene glycol or hexylene glycol.

[0025] In a second aspect, the present application provides a method for preparing an oral care solution, comprising:

[0026] Dispersing the recombinant collagen and laver polysaccharide uniformly to obtain a dispersion;

[0027] Slowly add the dispersion into water and stir at 2000rpm-3000rpm for 3min-10min; then add the Solidago striata extract and moisturizer into water and stir at 1000rpm-1500rpm for 20min-40min to fully dissolve; then add the solubilizer and stir for 20min-40min, and filter the upper liquid.

[0028] In other embodiments of the present application, obtaining laver polysaccharide comprises:

[0029] After the laver is crushed, water is added for extraction; the extraction time is 3h to 4h, and the extraction temperature is 80℃ to 120℃; the mass ratio of the laver to water is 1:(50~70); optionally, the extract is purified and freeze-dried after extraction.

[0030] In other embodiments of the present application, the obtained Solidago scabra extract includes:

[0031] The yellow flower was extracted with alcohol under high pressure pulse conditions;

[0032] Optionally, the pulse electric field pressure of the high voltage pulse is 300 MPa to 600 MPa; the holding time is 8 min to 10 min;

[0033] Optionally, the alcohol includes methanol; Optionally, during alcohol extraction, the mass ratio of Goldenrod flos scabra to alcohol is 1 g: (15-30) mL;

[0034] Optionally, the volume fraction of alcohol is 65% to 75%.

[0035] In a third aspect, the present application provides a composition, comprising: recombinant collagen, laver polysaccharide, and Solidago asiatica extract;

[0036] In other embodiments of the present application, the weight ratio of recombinant collagen to laver polysaccharide is (0.1-0.5): (0.3-0.7).

[0037] In other embodiments of the present application, in the composition, the weight ratio of recombinant collagen, porphyra polysaccharide, and Solidago asiatica extract is: (0.1-0.5): (0.3-0.7): (0.1-1). DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments.

[0039] Therefore, the following detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0040] The present application provides an oral care solution, which comprises, by mass percentage, the following:

[0041] The invention comprises 0.1%-0.5% recombinant collagen, 0.3%-0.7% laver polysaccharide, 0.1%-1% solidago extract, 0.5%-4% solubilizer, 10%-30% moisturizer and the balance is water.

[0042] In the above technical scheme, the present invention adopts the Solidago asiatica extract extracted by high-voltage pulse technology, and combines it with recombinant collagen, laver polysaccharide, etc. to prepare oral care solution. On the one hand, it can form a biofilm that adheres more tightly to the mucosa more quickly, physically shield the damaged tissue, and relieve pain; on the other hand, the biofilm formed by polysaccharide and collagen can release active substances (Solidago asiatica extract) in a long-term sustained-release manner to achieve long-term antibacterial effect. In addition, the biofilm itself (polysaccharide molecules and collagen molecules) can promote cell proliferation and repair, which can promote oral mucosal repair and is safe and non-toxic.

[0043] Further, in some embodiments of the present application, the oral care solution comprises, by mass percentage:

[0044] The invention comprises 0.15%-0.45% recombinant collagen, 0.35%-0.65% laver polysaccharide, 0.15%-0.95% solidagorassis extract, 1%-3% solubilizer, 15%-28% moisturizer and the balance is water.

[0045] For example, in some embodiments of the present application, the oral care solution includes, by weight percentage:

[0046] Recombinant collagen 0.15%, 0.18%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.45% or the range between any two of the foregoing values;

[0047] Porphyra polysaccharide 0.35%, 0.38%, 0.4%, 0.45%, 0.5%, 0.55%, 0.6%, 0.65% or the range between any two of the foregoing values;

[0048] Solidago scabra extract 0.15%, 0.18%, 0.2%, 0.25%, 0.28%, 0.3%, 0.35%, 0.4%, 0.45%, 0.5%, 0.55%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%, 0.9%, 0.95% or the range between any two of the foregoing values;

[0049] Solubilizer 1%, 1.2%, 1.5%, 1.8%, 2%, 2.2%, 2.5%, 2.8%, 3%; or the range between any two of the foregoing values;

[0050] Moisturizer 15%, 16%, 18%, 20%, 22%, 25%, 26%, 28% or the range between any two of the foregoing values;

[0051] and the balance is water.

[0052] Further, in some embodiments of the present application, the nucleotide sequence of the recombinant collagen includes the sequence shown in SEQ ID NO: 1;

[0053] The nucleotide sequence shown in SEQ ID NO: 1 is:

[0054] atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctggtcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaacaaggtccctctggagcaagtg gtgaacgtgg tccccctggt cccatgggcc cccctggattggctggaccccctggtgaat ctggacgtga gggggctcct ggtgccgaag gttcccctggacgagacggttctcctggcg ccaagggtga ccgtggtgag accggccccg ctggaccccctggtgctcctggtgctcctg gtgcccctgg ccccgttggc cctgctggca agagtggtgatcgtggtgagactggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggtcctcctggaa agaatggtga aactggacct cagggacccc cagggcctactgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggcttgcctggtacaggtggtcctc caggagaaaa tggaaaacct ggggaaccag gtccaaagggtgatgccggtgcacctggag ctccaggagg caagggtgat gctggtgccc ctggtgaacgtggacctcctggattggcag gggccccagg acttagaggt ggagctggtc cccctggtcccgaaggaggaaagggtgctg ctggtcctcc tgggccacct ggtgctgctg gtactcctggactacaaggaatgcctggcc cgccaggtcc atgctgtgga ggtggataa。

[0055] Furthermore, in some embodiments of the present application, the outer side of the collagen molecule contains a large number of hydrophilic groups, such as carboxyl and hydroxyl groups, and has good film-forming properties. Secondly, because the above-mentioned recombinant collagen has an amino acid sequence similar to / same as human collagen, it has good biocompatibility, biodegradability and biological activity, such as low immunogenicity, easy absorption by the human body, can promote cell proliferation, promote platelet aggregation, participate in cell migration, adhesion, etc., and can be applied to gargle products.

[0056] When collagen is used in mouthwash products, such as for oral mucosal repair, it is impossible for collagen to act on the area to be repaired for a long time due to factors such as oral saliva secretion and drinking water. In other words, the time that collagen can act on the area to be repaired is limited.

[0057] In order to improve the effect of collagen mouthwash products, the oral care solution of the present application compounds the above-mentioned recombinant collagen with other ingredients such as laver polysaccharide, which can effectively increase the action time of collagen in the oral cavity and improve the repair effect.

[0058] Porphyra polysaccharides contain polysaccharides, and because a large number of polar groups such as hydroxyl, carboxyl and aldehyde groups are evenly distributed in their molecular structure, the various van der Waals forces, hydrogen bonds and electrostatic forces between polysaccharide molecules lay the foundation for the formation of the membrane. Compounding it with recombinant collagen can effectively increase the action time of collagen in the oral cavity and improve the repair effect.

[0059] Furthermore, the above-mentioned laver polysaccharide has good anti-inflammatory and repairing effects. Compounding it in the oral care solution of the present application is beneficial to improving the anti-inflammatory and repairing effects of the oral care solution.

[0060] Furthermore, the Solidago virga-aurea extract is an extract of the whole herb or the whole herb with roots of the Asteraceae plant Solidago virga-aurea L. var. leiocarpa (Benth.) A. Gray, which contains flavonoids, saponins and other compounds; and has the effects of dispelling wind and heat, detoxifying and reducing swelling.

[0061] In some embodiments of the present application, the Solidago asiatica extract can be used as an active ingredient in oral care liquid. Compounding the Solidago asiatica extract with other ingredients can further enhance the long-lasting antibacterial effect of the oral care liquid, thereby facilitating enhancing the effect on wound repair.

[0062] The oral care liquid of the present application, on the one hand, can form a biofilm that adheres more closely to the mucosa more quickly, physically shield damaged tissues, and relieve pain; on the other hand, the biofilm formed by laver polysaccharides and recombinant collagen can release active substances (Solidago asiatica extract) in a long-term sustained manner to achieve long-term antibacterial effect. In addition, the biofilm itself (laver polysaccharides and recombinant collagen) can promote cell proliferation and repair, which can promote the repair of oral mucosa and is safe and non-toxic.

[0063] Furthermore, in some embodiments of the present application, the laver polysaccharide is a water extract of laver.

[0064] Further, in some embodiments of the present application, obtaining laver polysaccharide includes:

[0065] After the laver is crushed, water is added for extraction; the extraction time is 3h to 4h, the extraction temperature is 80℃ to 120℃; the mass ratio of the laver to water is 1:(50~70).

[0066] Exemplarily, in some embodiments of the present application, obtaining laver polysaccharide comprises:

[0067] After the laver is crushed, water is added for extraction; the extraction time is 3h, 3.1h, 3.2h, 3.3h, 3.4h, 3.5h, 3.6h, 3.7h, 3.8h, 3.9h or 4h, and the extraction temperature is 80℃, 85℃, 90℃, 95℃, 100℃, 105℃, 110℃, 115℃ or 120℃; the mass ratio of laver to water is 1:50, 1:55, 1:60, 1:65 or 1:70.

[0068] Furthermore, in some embodiments of the present application, the extract is purified and freeze-dried after extraction.

[0069] In the above technical scheme, laver polysaccharide prepared by water extraction is added to the oral care solution, and laver polysaccharide is used in oral care products for the first time. The laver polysaccharide prepared by this method is safe and economical, has high extraction efficiency, good film-forming effect, has a good physical isolation effect on mucosal damage, and reduces inflammatory response and promotes mucosal repair. Because laver polysaccharide contains a large number of polar groups, such as hydroxyl, carboxyl and aldehyde groups, which are evenly distributed in its molecular structure, the various van der Waals forces, hydrogen bonds and electrostatic attraction between polysaccharide molecules lay the foundation for the formation of the film. The outside of the collagen molecule also contains a large number of hydrophilic groups, such as carboxyl and hydroxyl groups, and also has good film-forming properties. When the laver polysaccharide molecules and collagen molecules are dispersed and hydrated at high speed, the molecules are entangled with each other, the non-covalent bonds attract each other, the van der Waals force and electrostatic attraction between the molecules increase, and the polysaccharide molecules and collagen molecules attract each other to form a tighter biofilm. When the formed biofilm combines with the oral mucosa, it will adhere tightly to the mucosa. The combination of the two improves the film-forming speed and the film's resistance to flushing, greatly improving the physical isolation effect of damaged oral mucosa, relieving pain, and improving the long-term sustained release effect of the biofilm, allowing the active substances to act for a long time, and improving the bioavailability of the Goldenrod extract. On the other hand, collagen and polysaccharide molecules have immune properties that are anti-inflammatory and promote cell proliferation. The formation of a tighter biofilm also promotes the repair of damaged mucosa.

[0070] Further, in some embodiments of the present application, the Solidago scabra extract obtained includes:

[0071] The product was obtained by alcohol extraction of a yellow flower under high pressure pulse conditions.

[0072] In the above technical scheme, high-voltage pulse technology is used to extract the active ingredients of the goldenrod. The goldenrod extract prepared by this method is not heated, and the active ingredients can be retained without being destroyed. In addition, the production process is simple, which greatly shortens the preparation time. Secondly, the goldenrod extract prepared by this method can balance the oral microbial community and fight against oral pathogens. The film-forming carrier formed by the combination of collagen and laver polysaccharide can achieve the effect of long-term sustained release of active ingredients, so that the oral care solution of the present invention has a long-term antibacterial effect.

[0073] Furthermore, in some embodiments of the present application, the pulse electric field pressure of the high voltage pulse is 300 MPa to 600 MPa; and the holding time is 8 min to 10 min.

[0074] Illustratively, in some embodiments of the present application, the pulse electric field pressure of the high voltage pulse is 300 MPa, 350 MPa, 400 MPa, 450 MPa, 480 MPa, 500 MPa, 520 MPa, 550 MPa, 580 MPa or 600 MPa; and the holding time is 8 min, 9 min or 10 min.

[0075] Further, in some embodiments of the present application, the alcohol includes methanol.

[0076] Further optionally, in some embodiments of the present application, during alcohol extraction, the mass ratio of Goldenrod flos citratus to alcohol is 1 g: (15-30) mL.

[0077] Illustratively, in some embodiments of the present application, during alcohol extraction, the mass ratio of Goldenseal lily to alcohol is 1g:15mL, 1g:16mL, 1g:18mL, 1g:20mL, 1g:22mL, 1g:25mL, 1g:28mL or 1g:30mL.

[0078] Furthermore, in some embodiments of the present application, the volume fraction of alcohol is 65% to 75%.

[0079] Illustratively, in some embodiments of the present application, the volume fraction of the above-mentioned alcohol is 65%, 66%, 68%, 70%, 72%, 73% or 75%.

[0080] Furthermore, in some embodiments of the present application, the weight ratio of recombinant collagen to laver polysaccharide is (0.1-0.5): (0.3-0.7).

[0081] In the above technical scheme, by controlling the weight ratio of recombinant collagen to laver polysaccharide to (0.1-0.5): (0.3-0.7), the film-forming speed and the film's resistance to washing can be effectively improved, the physical isolation effect on the damaged oral mucosa is greatly improved, the pain is relieved, and the long-term sustained release effect of the biofilm is improved, allowing the active substance to act for a long time. Within this ratio range, the oral care solution prepared by the present invention has a short film-forming time, strong film resistance to washing, and a good effect of promoting mucosal repair.

[0082] Further optionally, in some embodiments of the present application, the weight ratio of the above-mentioned recombinant collagen to laver polysaccharide is (0.2-0.4): (0.4-0.6).

[0083] Illustratively, in some embodiments of the present application, the weight ratio of the above-mentioned recombinant collagen to laver polysaccharide is 0.2:0.4, 0.1:0.3, 0.3:0.5, 0.4:0.6, 0.5:0.7, 0.1:0.7, 0.2:0.6, 0.3:0.5 or 0.4:0.4.

[0084] Furthermore, the solubilizing agent includes at least one of hydrogenated castor oil, poloxamer or Tween.

[0085] For example, in some embodiments of the present application, the solubilizer is selected from any one of hydrogenated castor oil, poloxamer or Tween. Or in some embodiments of the present application, the solubilizer is selected from a mixture of hydrogenated castor oil and poloxamer; the components in the mixture can be mixed in any proportion; or a mixture of hydrogenated castor oil, poloxamer and Tween is selected, and the components in the mixture can be mixed in any proportion.

[0086] Further, in some embodiments of the present application, the humectant includes a polyol.

[0087] Furthermore, in some embodiments of the present application, the above-mentioned moisturizer includes: at least one of sorbitol, glycerin, polyethylene glycol, propylene glycol, 1,3-butylene glycol or hexylene glycol.

[0088] For example, in some embodiments of the present application, the above-mentioned moisturizing agent is selected from any one of sorbitol, glycerol, polyethylene glycol, propylene glycol, 1,3-butylene glycol or hexylene glycol. Alternatively, in some embodiments of the present application, the above-mentioned moisturizing agent is selected from a mixture of sorbitol, glycerol, and polyethylene glycol; or a mixture of polyethylene glycol, propylene glycol, and 1,3-butylene glycol; the components in the above-mentioned mixtures can be mixed in any proportion.

[0089] Furthermore, in some embodiments of the present application, the above-mentioned oral care solution also includes: a preservative, a flavoring agent, and a pH adjuster.

[0090] Further optionally, in some embodiments of the present application, the above-mentioned oral care solution includes, by mass percentage: 0.1%-0.5% recombinant collagen; 0.3%-0.7% laver polysaccharide; 0.1%-1% goldenrod extract; 0.5%-4% solubilizer; 10%-30% moisturizer; 0.1%-2% preservative; 0.01%-1% flavoring agent; 0.05%-1% pH adjuster; and the balance is water.

[0091] For example, in some embodiments of the present application, the oral care solution includes, by mass percentage: 0.1%, 0.2%, 0.3%, 0.4% or 0.5% recombinant collagen; 0.3%, 0.4%, 0.5%, 0.6% or 0.7% laver polysaccharide; 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or 1% solidagorass extract; 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or 1% solubilizer; .8%, 1%, 2%, 3% or 4%; humectant 10%, 15%, 18%, 20%, 25%, 28% or 30%; preservative 0.1%, 0.5%, 0.8%, 1%, 1.5% or 2%; flavoring agent 0.01%, 0.02%, 0.05%, 0.08%, 0.1%, 0.5%, 0.8% or 1%; pH adjuster 0.05%, 0.08%, 0.1%, 0.5% or 0.8% or 1%; and the balance is water.

[0092] Furthermore, some embodiments of the present application provide a method for preparing an oral care solution, comprising:

[0093] Dispersing the recombinant collagen and laver polysaccharide uniformly to obtain a dispersion;

[0094] Slowly add the dispersion into water and stir at 2000rpm-3000rpm for 3min-10min; then add the Solidago striata extract and moisturizer into water and stir at 1000rpm-1500rpm for 20min-40min to fully dissolve; then add the solubilizer and stir for 20min-40min, and filter the upper liquid.

[0095] By adopting the above-mentioned preparation method, an oral care liquid can be prepared which has good film-forming effect, good physical isolation effect on mucosal damage, and long-lasting antibacterial effect.

[0096] Furthermore, in some embodiments of the present application, the method for preparing the oral care solution comprises:

[0097] Step S1, preparing laver polysaccharide.

[0098] Further, in some embodiments of the present application, obtaining laver polysaccharide includes:

[0099] The laver is crushed and then extracted by adding water.

[0100] Furthermore, in some embodiments of the present application, the extraction time is 3h to 4h, and the extraction temperature is 80°C to 120°C.

[0101] Furthermore, in some embodiments of the present application, the mass ratio of laver to water is 1:(50-70).

[0102] Illustratively, in some embodiments of the present application, obtaining laver polysaccharide comprises:

[0103] After the laver is crushed, water is added for extraction; the extraction time is 3h, 3.1h, 3.2h, 3.3h, 3.4h, 3.5h, 3.6h, 3.7h, 3.8h, 3.9h or 4h, and the extraction temperature is 80℃, 85℃, 90℃, 95℃, 100℃, 105℃, 110℃, 115℃ or 120℃; the mass ratio of laver to water is 1:50, 1:55, 1:60, 1:65 or 1:70.

[0104] Furthermore, in some embodiments of the present application, the extract is purified and freeze-dried after extraction.

[0105] Step S2, preparing a Solidago scabra extract.

[0106] Further, in some embodiments of the present application, the Solidago scabra extract obtained includes:

[0107] The product was obtained by alcohol extraction of a yellow flower under high pressure pulse conditions.

[0108] Furthermore, in some embodiments of the present application, the pulse electric field pressure of the high voltage pulse is 300 MPa to 600 MPa; and the holding time is 8 min to 10 min.

[0109] Illustratively, in some embodiments of the present application, the pulse electric field pressure of the high voltage pulse is 300 MPa, 350 MPa, 400 MPa, 450 MPa, 480 MPa, 500 MPa, 520 MPa, 550 MPa, 580 MPa or 600 MPa; and the holding time is 8 min, 9 min or 10 min.

[0110] Further, in some embodiments of the present application, the alcohol includes methanol.

[0111] Furthermore, in some embodiments of the present application, during alcohol extraction, the mass ratio of Goldenrod flos citratus to alcohol is 1 g: (15-30) mL.

[0112] Furthermore, in some embodiments of the present application, the volume fraction of alcohol is 65% to 75%.

[0113] Illustratively, in some embodiments of the present application, during alcohol extraction, the mass ratio of Goldenseal lily to alcohol is 1g:15mL, 1g:16mL, 1g:18mL, 1g:20mL, 1g:22mL, 1g:25mL, 1g:28mL or 1g:30mL.

[0114] Step S3, uniformly dispersing the recombinant collagen and laver polysaccharide to obtain a dispersion.

[0115] Further optionally, in some embodiments of the present application, the recombinant collagen and the laver polysaccharide obtained in step S1 are pre-dispersed evenly in glycerol to obtain a dispersion.

[0116] Step S1, slowly add the dispersion into water, and stir at 2000rpm-3000rpm for 3min-10min; then add the Solidago striata extract and moisturizer obtained in step S2 into water, and stir at 1000rpm-1500rpm for 20min-40min to fully dissolve; then add a solubilizer, stir for 20min-40min, and filter the upper liquid.

[0117] Under the above-mentioned process conditions, an oral care liquid can be obtained which has good film-forming effect, good physical isolation effect on mucosal damage, and long-lasting antibacterial effect.

[0118] Further optionally, in some embodiments of the present application, the dispersion is slowly added to water at 2000rpm, 2100rpm, 2200rpm, 2500rpm, 2800rpm or 3000rpm; stirred for 3min, 4min, 5min, 6min, 7min, 8min, 9min or 10min; then the Solidago striata extract and moisturizer are added to the water, stirred at 1000rpm, 1100rpm, 1200rpm, 1300rpm, 1400rpm or 1500rpm for 20min, 25min, 30min, 35min or 40min to fully dissolve; then the solubilizer is added, stirred for 20min, 25min, 30min, 35min or 40min, and the upper liquid is filtered.

[0119] Further optionally, in some embodiments of the present application, the recombinant collagen and the laver polysaccharide obtained in step S1 are pre-dispersed uniformly in a moisturizer in advance, and stirred at 1000rpm-1500rpm for 10min-20min to prevent agglomeration, and then the dispersion is slowly added to water and stirred at 2000-3000rpm for 10min-20min; then, moisturizers, preservatives, flavoring agents (sweeteners), pH adjusters, etc. are added to water, stirred at 1000-1500rpm for 20-30min to fully dissolve; then the chrysanthemum extract, solubilizer, and flavoring agent (flavor) obtained in step S2 are added, stirred for 30min, filtered, filled, sealed, and sterilized to obtain the target product.

[0120] Some embodiments of the present application provide a composition, which comprises: recombinant collagen, porphyra polysaccharide, and Solidago asiatica extract;

[0121] In some embodiments of the present application, the weight ratio of recombinant collagen to laver polysaccharide is (0.1-0.5): (0.3-0.7).

[0122] Further optionally, in some embodiments of the present application, the weight ratio of recombinant collagen to laver polysaccharide is (0.15-0.45): (0.35-0.65).

[0123] Illustratively, in some embodiments of the present application, the weight ratio of the above-mentioned recombinant collagen to laver polysaccharide is 0.2:0.4, 0.1:0.3, 0.3:0.5, 0.4:0.6, 0.5:0.7, 0.1:0.7, 0.2:0.6, 0.3:0.5 or 0.4:0.4.

[0124] In some embodiments of the present application, in the composition, the weight ratio of recombinant collagen, porphyra polysaccharide, and Solidago asiatica extract is: (0.1-0.5): (0.3-0.7): (0.1-1).

[0125] Further optionally, in some embodiments of the present application, in the composition, the weight ratio of recombinant collagen, porphyra polysaccharide, and Solidago asiatica extract is: (0.11-0.49): (0.31-0.69): (0.11-0.98).

[0126] Illustratively, in some embodiments of the present application, the weight ratio of the above-mentioned recombinant collagen to laver polysaccharide is 0.2:0.4:0.3, 0.1:0.3:0.2, 0.3:0.5:0.3, 0.4:0.6:0.4, 0.5:0.7:0.5, 0.1:0.7:0.6, 0.2:0.6:0.7, 0.3:0.5:0.8 or 0.4:0.4:0.9.

[0127] The features and performance of the present application are further described in detail below in conjunction with the embodiments:

[0128] Example 1

[0129] An oral care solution is provided, which is prepared according to the following steps:

[0130] 1. The dried laver was crushed into 80 meshes, the extraction time was 3.5 hours, the extraction temperature was 100°C, the solid-liquid ratio was 1:60, after extraction, it was purified, freeze-dried, and crushed into 100 meshes to obtain laver polysaccharide.

[0131] 2. The extract of the goldenrod was extracted using high-voltage pulse technology (PEF). The technical parameters were: pulse electric field pressure of 500 MPa, solid-liquid ratio of 1:20 (g:mL), volume fraction of 70% methanol extract, holding time of 9 minutes, and centrifugal drying after extraction to obtain the goldenrod extract.

[0132] 3. Pre-disperse the recombinant collagen and laver polysaccharide (prepared in step 1) in glycerol, stir at 1000 rpm for 15 min, then slowly add the dispersion into water and stir at 2000-3000 rpm for 15 min;

[0133] 4. Then add sucralose, citric acid and sodium citrate to the dispersion in step 3, and stir at 1000-1500 rpm for 30 min until fully dissolved;

[0134] 5. Add the goldenrod extract (prepared in step 2), essence and Tween 80 to propylene glycol and stir until clear.

[0135] 6. Add the propylene glycol dispersion in step 5 to step 4 and stir for 30 minutes, filter, fill, seal and sterilize to obtain the target product.

[0136] The specific composition and proportion of the oral care solution are shown in Table 1.

[0137] Example 2

[0138] The difference between this embodiment and embodiment 1 is that the ratio of recombinant collagen is changed to 0.1wt%, and the ratio of laver polysaccharide is changed to 0.7; see Table 1 for details.

[0139] Example 3

[0140] The difference between this embodiment and embodiment 1 is that the ratio of recombinant collagen is changed to 0.5, and the ratio of laver polysaccharide is changed to 0.3wt%; see Table 1 for details.

[0141] Example 4

[0142] The difference between this embodiment and embodiment 1 is that the proportion of recombinant collagen is changed to 0.09wt%, and the proportion of laver polysaccharide is changed to 0.72wt%; see Table 1 for details.

[0143] Example 5

[0144] The difference between this embodiment and embodiment 1 is that the proportion of recombinant collagen is changed to 0.52wt%, and the proportion of laver polysaccharide is changed to 0.26wt%; see Table 1 for details.

[0145] Comparative Example 1

[0146] The difference from Example 1 is that the ratio of recombinant collagen is changed to 0, and the ratio of laver polysaccharide is changed to 0.8wt%; see Table 1 for details.

[0147] Comparative Example 2

[0148] The difference from Example 1 is that the ratio of recombinant collagen is changed to 0.8wt%, and the ratio of laver polysaccharide is changed to 0; see Table 1 for details.

[0149] Comparative Example 3

[0150] The difference from Example 1 is that the ratio of Goldenrod flos extract is changed to 0; see Table 1 for details.

[0151] Comparative Example 4

[0152] The difference from Example 1 is that the laver polysaccharide component is replaced with carbomer homopolymer type A with a ratio of 0.5wt%, and a neutralizing agent sodium hydroxide is added with a ratio of 0.1wt%; see Table 1 for details.

[0153] Table 1 (wt%)

[0154]

[0155]

[0156] The properties of the oral care liquids prepared in various embodiments or comparative examples were tested.

[0157] 1. Physical shielding - film forming and adhesion

[0158] (I) Film-forming property test

[0159] Film formation time: Take a culture dish with an inner diameter of 10 cm and place it in a constant temperature box at 37±1°C, take 1 ml of the oral care solution prepared in Examples 1-5 or Comparative Examples 1-4, and evenly apply it on the inner surface of the culture dish. Put the culture dish containing the mouthwash into the constant temperature box, observe it every 10 seconds to see whether a film is formed on the surface of the culture dish, and record the film formation time in Table 2.

[0160] Anti-scouring time: 0.5 ml of the oral care solution of each embodiment or comparative example was evenly applied on a glass slide, and placed in a 37±1°C constant temperature box for 3 min. After the care solution on the glass slide was completely filmed, the film-formed glass slide was vertically placed in a beaker and fixed, with the film-formed surface facing the middle of the beaker, and 100 ml of water was added to cover the glass slide. Stirring was started at 10 rpm to simulate saliva, and observation was made every 1 min until the film was completely washed away. The time when the film was completely washed away was recorded, that is, the anti-scouring time in Table 2.

[0161] The test results are shown in Table 2.

[0162] Table 2

[0163]

[0164] As can be seen from the results in Table 2, the film-forming time of Example 1 is the shortest, and it can quickly play a role of physical shielding, and the scouring resistance time is the longest, which can play a role of physical isolation for a long time, and promote the long-term sustained release of active ingredients. Secondly, Example 4 relative to Example 2, Example 5 relative to Example 3, the film-forming time is longer, and more resistant to scouring, so the optimal ratio of recombinant collagen and laver polysaccharide is recombinant collagen (0.1-0.5): (0.3-0.7). Comparative Examples 1 and 2 relative to Example 1, the film-forming time of Comparative Examples 1 and 2 is much longer than that of Example 1, and the scouring resistance performance is not as good as that of Example 1, indicating that the combined use of recombinant collagen and laver polysaccharide enhances the film-forming performance, greatly improves the physical shielding performance and long-term sustained release of the wound.

[0165] 2. In vitro efficacy verification

[0166] Long-term antibacterial experiment

[0167] In order to verify the long-term antibacterial effect of the finished product formula, this project took the oral care liquid prepared by Examples 1-5 and Comparative Examples 1-4 for long-term antibacterial test, because Candida albicans can easily cause oral mucosal inflammation. Therefore, this project selected the Candida albicans long-term antibacterial model to evaluate the oral care liquid samples (Examples 1-5, Comparative Examples 1-4).

[0168] The test method is:

[0169] Experimental materials: 1. Biofilm growth medium: 6g tryptic soy peptone, 4g sucrose, dissolved in 200g deionized water, sterilized at 121℃ for 20min and cooled. 2 Biofilm inhibition medium: 6g tryptic soy peptone, dissolved in 200g deionized water, sterilized at 121℃ for 20min and cooled. 3 Treatment solution preparation: Oral care solution sample, negative control group is deionized water, positive control group is 0.5% chlorhexidine acetate aqueous solution.

[0170] Experimental protocol:

[0171] 1. Glass rod polishing: Use 240, 320, 400 and 600 mesh silicon carbide sandpaper on a lathe to polish a new glass rod 25 mm from one end. After the initial polishing, use 600 mesh sandpaper to polish again before each experiment. 2. The experiment should set up 3 parallel negative control groups and at least 3 parallel experimental groups.

[0172] 2. Day 1: Candida albicans biofilm culture: Cultivate Candida albicans to the logarithmic growth phase and use culture medium to adjust the bacterial concentration to 1×10 6 ~5×10 6CFU / mL, take 100 μL of the diluted bacterial solution and add it to a sterile 96-well culture plate and culture it at 35°C for 4 h (early biofilm formation).

[0173] 3. The next day: take 5 mL of biofilm growth medium into new polystyrene test tubes, transfer the glass rods from the previous day to each new test tube, soak them at 36°C for 10 h, then take them out of the incubator, soak them in the treatment solution (negative control is deionized water) for 2 min, then soak the glass rods in a test tube of deionized water and wash them for 3S, finally transfer the glass rods to a test tube containing 5 mL of biofilm inhibition medium and keep it at a constant temperature of 36°C (prepare 4 5 mL biofilm inhibition medium polystyrene test tubes without glass rods as blank controls).

[0174] 4 Day 3: After 12 hours of constant temperature at 36℃, take out the glass rod, shake the biofilm inhibition medium thoroughly, and measure the pH of the biofilm inhibition medium with a pH meter. Put the glass rod into a beaker, add 1M HCl, soak, and wash and recycle.

[0175] Efficacy evaluation

[0176] Biofilm inhibition rate % = (mean pH of the experimental group - mean pH of the negative control group) / (mean pH of the blank control group - mean pH of the negative control group) × 100% Values ​​greater than or equal to 60% indicate that the experimental group product has a 12-hour long-term antibacterial effect. The test results are shown in Table 3.

[0177] Table 3

[0178]

[0179] As shown in Table 3, the oral care solution group containing Goldenrod extract has a certain antibacterial effect on the bacterial film formed by Candida albicans after being tested on the long-term antibacterial model (Example 1 and Comparative Example 3), and the better the film-forming effect, the greater the antibacterial effect of Goldenrod (Examples 1-5 relative to Comparative Examples 1-2). When the Goldenrod extract and the film-forming agent (collagen and laver polysaccharide synergistically compounded) act together, it has a long-term antibacterial effect, and the performance is better than the oral care solution with carbomer as the film-forming agent on the market (Example 1 relative to Comparative Example 4). Moreover, there is no significant difference in Example 1 relative to the positive control, indicating that the oral rinse of the present invention has a long-term antibacterial effect, can release the antibacterial components for a long time, achieve a long-term effect on the wound surface, and promote wound repair.

[0180] (III) Clinical trials

[0181] Clinical trial to relieve pain and promote healing of oral ulcers.

[0182] The effects of the oral care solutions of the above embodiments and comparative examples are as follows:

[0183] 1. Basic information: A total of 220 volunteers with oral wounds were collected, including 110 males and 110 females, aged 18 to 55 years old. Among them, 63 patients had oral ulcers, 52 patients had gingivitis, 60 patients had periodontitis, and 45 patients had traumatic stomatitis. They were randomly divided into experimental groups 1 to 10, with 12 cases in each group. There was no statistically significant difference in the indications and pain indexes of each group (P>0.05). The pain index of the subjects was observed and recorded according to the numerical pain rating method (NRS), and the pain intensity was expressed by 0-10 numbers: 0 was painless and 10 was the most severe pain. Patients rated the pain intensity themselves according to the scoring numbers: 1 to 3 points were mild pain, 4 to 6 points were moderate pain and pain affected sleep, and 7 to 10 points were severe pain. The oral wound pain scores of volunteers were collected as 7 to 10 points.

[0184] 2. Test method: Take 10mL of oral care solution (the control group rinses with water), rinse in the mouth for 3 minutes and then spit it out, rinse 5 times a day. Use it for 7 consecutive days. Observe and record the pain symptoms of the subjects every day, score and observe the recovery of the wound.

[0185] 3. Efficacy indicators:

[0186] 1) According to the records of the changes in the subjects' pain sensation before and after the test, the effects of use were divided into 4 levels: clinical control, marked effect, effective, and ineffective. Clinical control: pain disappeared (recorded as 0 points); marked effect: pain changed from severe (7 points to 10 points) to mild (less than 3 points) (recorded as 3 points); effective: pain changed from severe (7 points to 10 points) to moderate (4 points to 6 points) (recorded as 5 points); ineffective: no improvement in pain (7-10 points) (recorded as 7 points).

[0187] 2) Inspect the wound recovery after 7 days of use, evaluation criteria: significant: within 7 days of using the mouthwash of the present invention, the symptoms of oral ulcer are completely eliminated, and there is no recurrence within one month; improved: within 7 days of using the mouthwash of the present invention, the symptoms of oral ulcer are improved, and the ulcer area is reduced; ineffective: within 7 days of using the mouthwash of the present invention, there is no change in the symptoms of oral ulcer.

[0188] 4. Calculate the average value and record it in the table. The results are as follows:

[0189] Table 4 Clinical use data

[0190]

[0191]

[0192] From the statistical results of the volunteer trial survey in Table 4, it can be seen that after the vast majority of trial personnel continued to use the oral care solution of Example 15, the oral wound problem was improved to a certain extent, and the total effective rate reached more than 70%, among which the effective rate of Example 1 reached 90%. Whether it is the degree of pain relief or the recovery of the wound, Examples 1-5 are better than Comparative Example 4 (commonly used mouthwash formula on the market), indicating that the oral care solution of the present invention has excellent effects on relieving pain and promoting wound repair; secondly, the efficacy of Examples 1-3 is better than that of Examples 4-5, indicating that the ratio of the present invention is optimal, and finally, Example 1 is better than Comparative Examples 1-2, indicating that the combined use of recombinant collagen and laver polysaccharide is better than that of using them alone, and finally, Example 1 is better than Comparative Example 3, indicating that the extract of a yellow flower has a significant effect on relieving pain and promoting wound repair. During the test, the subjects did not see any adverse reactions, indicating that the oral care solution containing recombinant collagen of the present invention has the effect of alleviating wound pain and promoting wound repair. At the same time, it has safety and applicability, and achieves the expected purpose.

[0193] The embodiments described above are part of the embodiments of the present application, rather than all of the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents the selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

Claims

1. An oral care solution, characterized in that: In terms of mass percentage, the oral care solution comprises: Recombinant collagen 0.1%-0.5%; Laver polysaccharide 0.3%-0.7%; Solidago asiatica extract 0.1%-1%; Solubilizer 0.5%-4%; Moisturizer 10%-30%; and The balance is water; The nucleotide sequence of the recombinant collagen includes the sequence shown in SEQ ID NO: 1; The nucleotide sequence shown in SEQ ID NO: 1 is: atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

2. The oral care solution according to claim 1, characterized in that The laver polysaccharide is a water extract of laver.

3. The oral care solution according to claim 2, characterized in that The method for obtaining the laver polysaccharide comprises: After the laver is crushed, water is added for extraction; the extraction time is 3h~4h, and the extraction temperature is 80℃~120℃; the mass ratio of the laver to water is 1:(50~70).

4. The oral care solution according to claim 3, characterized in that: After extraction, the extract is purified and freeze-dried.

5. The oral care solution according to claim 1, characterized in that: The method for obtaining the Solidago scabra extract comprises: The product was obtained by alcohol extraction of a yellow flower under high pressure pulse conditions.

6. The oral care solution according to claim 5, characterized in that The pulse electric field pressure of the high-voltage pulse is 300 MPa to 600 MPa, and the pressure holding time is 8 min to 10 min.

7. The oral care solution according to claim 5, characterized in that The alcohol includes methanol.

8. The oral care solution according to claim 5, characterized in that During the alcohol extraction, the mass ratio of the goldenrod to the alcohol is 1 g: (15-30) mL.

9. The oral care solution according to claim 5, characterized in that: The volume fraction of the alcohol is 65% to 75%.

10. The oral care solution according to any one of claims 1 to 9, characterized in that: The weight ratio of the recombinant collagen to the laver polysaccharide is (0.1-0.5): (0.3-0.7).

11. The oral care solution according to claim 10, characterized in that: The solubilizing agent includes at least one of hydrogenated castor oil, poloxamer or Tween.

12. The oral care solution according to claim 10, characterized in that: The humectant includes a polyol.

13. The oral care solution according to claim 12, characterized in that The moisturizer includes at least one of sorbitol, glycerol, polyethylene glycol, propylene glycol, 1,3-butylene glycol or hexylene glycol.

14. The method for preparing an oral care solution according to any one of claims 1 to 13, characterized in that: include: Dispersing the recombinant collagen and the laver polysaccharide uniformly to obtain a dispersion; The dispersion is slowly added into water, and stirred at 2000 rpm to 3000 rpm for 3 min to 10 min; then the Solidago striata extract and the moisturizer are added into water, and stirred at 1000 rpm to 1500 rpm for 20 min to 40 min to fully dissolve; then the solubilizer is added, stirred for 20 min to 40 min, and the upper liquid is filtered.

15. The method for preparing an oral care solution according to claim 14, characterized in that: The method for obtaining the laver polysaccharide comprises: After the laver is crushed, water is added for extraction; the extraction time is 3h~4h, and the extraction temperature is 80℃~120℃; the mass ratio of the laver to water is 1:(50~70).

16. The method for preparing an oral care solution according to claim 15, characterized in that: After extraction, the extract is purified and freeze-dried.

17. The method for preparing an oral care solution according to claim 14, characterized in that: The method for obtaining the Solidago sphaerocephala extract comprises: The product was obtained by alcohol extraction of a yellow flower under high pressure pulse conditions.

18. The method for preparing an oral care solution according to claim 17, characterized in that: The pulse electric field pressure of the high-voltage pulse is 300 MPa to 600 MPa, and the pressure holding time is 8 min to 10 min.

19. The method for preparing an oral care solution according to claim 17, characterized in that: The alcohol includes methanol.

20. The method for preparing an oral care solution according to claim 17, characterized in that: During the alcohol extraction, the mass ratio of the goldenrod to the alcohol is 1 g: (15-30) mL.

21. The method for preparing an oral care solution according to claim 17, characterized in that: The volume fraction of the alcohol is 65% to 75%.

22. A composition, characterized in that The composition comprises: recombinant collagen, laver polysaccharide, and Solidago asiatica extract; The nucleotide sequence of the recombinant collagen includes the sequence shown in SEQ ID NO: 1; The nucleotide sequence shown in SEQ ID NO: 1 is: atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

23. The composition according to claim 22, characterized in that The weight ratio of the recombinant collagen to the laver polysaccharide is (0.1-0.5): (0.3-0.7).

24. The composition according to claim 22, characterized in that In the composition, the weight ratio of the recombinant collagen, the laver polysaccharide, and the Solidago asiatica extract is: (0.1-0.5): (0.3-0.7): (0.1-1).

Images