A PLAG1 gene molecular marker related to buffalo growth traits and its application

Abstract

The present invention discloses a PLAG1 gene molecular marker related to the growth traits of water buffalo and its application. The nucleotide sequence of the SNP molecular marker is SEQ ID NO.1. The SNP molecular marker is located at the 427th base in SEQ ID NO.1, and the base is A or G. The method of the present invention provides for the first time a new site related to the growth traits of water buffalo in the PLAG1 gene of a Chinese water buffalo population through the SNP molecular marker, and clarifies the correlation between the polymorphism of the site and the body height, cross height, body oblique length and chest circumference of the water buffalo; and applies it to the field of water buffalo breeding, performs large-scale screening and diagnosis of water buffalo genes, obtains individuals with dominant alleles, and improves the growth traits of the cattle population.

Description

Technical Field

[0001] The invention relates to the field of cattle breeding, and in particular to a PLAG1 gene molecular marker related to the growth traits of buffalo and an application thereof. Background Art

[0002] Molecular marker-assisted selection breeding is a major research topic in modern animal molecular breeding. It directly selects the genotype of traits at the molecular level. It has the advantages of high genetic diversity, strong stability and little environmental influence. It overcomes the defects of traditional animal breeding methods that are greatly affected by the environment, and at the same time greatly improves the accuracy of selection.

[0003] Single nucleotide polymorphism (SNP) is an important molecular genetic marker. With the development of modern molecular biology, the addition of second-generation sequencing technology and the improvement of whole genome sequencing of species, the molecular genetic marker positioning of SNP has become more accurate and its application has become more extensive. As a type of DNA sequence polymorphism, SNP refers to the sequence polymorphism at the genome level caused by the single base change of the four nucleotide genetic codes on the chromosomes between different individuals of the same species at the nucleotide level. The main form of change is the conversion and transversion of a single base. SNP reflects the most essential difference between individuals. At the same time, the change of a single base is the simplest and most common way of DNA variation.

[0004] The pleomorphic adenoma gene (PLAG) zinc finger protein family mainly acts as a nuclear protein transcriptional regulator to regulate gene expression. The family includes three members: pleomorphic adenoma gene (PLAG1), pleomorphic adenoma gene L1 (PLAGL1) and pleomorphic adenoma gene L2 (PLAGL2). The PLAG1 gene is a proto-oncogene in human pleomorphic adenoma, located on chromosome 8q12.1, plays a role in the IGF-II mitotic signaling pathway, and can encode a nuclear transcription factor protein with seven C2H2-zinc fingers and transcriptional regulatory ability. Studies have found that the PLAG1 gene is considered to be a leukemia oncogene, which helps to diagnose benign tumors and is used to distinguish benign tumors from malignant tissue types. At the same time, the PLAG1 gene can also be used to detect drug resistance in cancer patients. At present, the research on PLAG1 gene polymorphism at home and abroad mainly focuses on the association between PLAG1 gene polymorphism and tumor disease screening, drug resistance detection, etc., and there are no reports on the association between PLAG1 gene polymorphism and buffalo growth traits.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] The purpose of the present invention is to provide a PLAG1 gene molecular marker related to the growth traits of buffalo and its application, aiming to obtain individuals carrying the dominant allele of buffalo to carry out breeding work and improve the growth traits of cattle populations. The breeding method is simple and suitable for large-scale breeding, thereby improving the breeding efficiency of buffalo.

[0007] To achieve the above object, a SNP molecular marker related to the growth trait of buffalo is provided, the SNP molecular marker is located at the 427th base in SEQ ID NO.1, and the base is A or G. The specific details of the SEQ ID NO.1 are as follows:

[0008] .

[0009] Preferably, in the above technical solution, the dominant allele of the 427 bases in cattle growth traits is the G allele; and the dominant genotype is the GG genotype.

[0010] The invention discloses an application of a SNP molecular marker in the detection of growth traits of selected water buffaloes, wherein the growth traits are body height, cross height, body oblique length and chest circumference of the water buffaloes.

[0011] A detection primer, the primer is used to detect the molecular marker according to claim 1 or 2, and the nucleotide sequence of the detection primer pair is as follows:

[0012] Forward primer: F 5′-TTAAGGTCACCAGATACCGAA-3′,

[0013] Reverse primer: R 5′-ACCTGTTTAAAATACCGTCT-3′.

[0014] An application of the detection primer in preparing a kit for detecting molecular markers related to growth traits of buffalo.

[0015] An application of the above detection primer in detecting mutation sites of the PLAG1 gene.

[0016] A method for breeding buffaloes, comprising: testing the above-mentioned SNP molecular markers on the buffaloes to be tested, evaluating the reproductive traits of the buffaloes to be tested, and selecting individuals with dominant alleles and genotypes carrying the buffalo growth traits to carry out breeding work.

[0017] Preferably, the above technical solution includes the following steps:

[0018] (1) obtaining blood from a buffalo to be tested, extracting buffalo genomic DNA, and testing the buffalo genomic DNA to obtain a DNA template;

[0019] (2) Design detection primers according to the nucleotide sequence of the SNP molecular marker, the nucleotide sequence of the detection primer pair is as follows:

[0020] Forward primer: F 5′-TTAAGGTCACCAGATACCGAA-3′,

[0021] Reverse primer: R 5′-ACCTGTTTAAAATACCGTCT-3′;

[0022] (3) using the detection primers to perform PCR amplification on the DNA template to obtain a PCR amplification product;

[0023] (4) sequencing the PCR amplification product to obtain a sequenced gene sequence;

[0024] (5) Comparing and analyzing the sequenced gene sequence with the standard gene sequence of the buffalo population, obtaining the mutation site in the buffalo gene to be detected, determining the genotype of the mutation site in the gene, and selecting individuals with the genotype for breeding high-fertility superior varieties.

[0025] Preferably, in the above technical solution, one of the parents used for hybrid breeding has a SNP molecular marker containing the allele G; the individual with the SNP molecular marker GG genotype is used as the dominant individual for the growth traits of buffalo.

[0026] Preferably, in the above technical solution, the growth traits of the buffalo are the body height, cross height, body oblique length and chest circumference of the buffalo.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) For the first time, a new locus in the PLAG1 gene of Chinese buffalo populations that is associated with buffalo growth traits was provided, and the correlation between the polymorphism of this locus and buffalo body height, cross height, body oblique length, and chest circumference was clarified;

[0029] (2) The correlation between the polymorphism of the above-mentioned loci and the body height, cross height, body oblique length and chest circumference of buffaloes is applied to the field of buffalo breeding, and large-scale screening and diagnosis of buffalo genes are carried out to obtain individuals with dominant alleles and improve the growth traits of cattle populations;

[0030] (3) The SNP molecular markers provided by the present invention can be used alone or in combination to identify trait differences related to buffalo weight growth traits, which is conducive to promoting the development and application of buffalo breeding, genetic improvement and molecular marker-assisted selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is an electrophoresis diagram of the PCR amplification product of buffalo PLAG1 gene NC_037341.1 in a certain embodiment of the present invention;

[0032] Figure 2 It is a sequencing peak diagram of AA, AG, and GG genotypes of buffalo PLAG1 gene NC_037341.1 in a certain embodiment of the present invention. DETAILED DESCRIPTION

[0033] The specific implementation modes of the present invention are described in detail below in conjunction with specific embodiments, but it should be understood that the protection scope of the present invention is not limited by the specific implementation modes.

[0034] 1. Extraction of genomic DNA from bovine blood

[0035] The experimental cattle of the present invention are 67 24-month-old buffaloes from the Guangxi Buffalo Research Institute. The TIANGEN blood genome extraction kit is used to extract the bovine genomic DNA according to the kit instructions. The extracted DNA is tested for concentration and quality and stored in a -20°C refrigerator for later use.

[0036] 2. Obtaining the SNP genetic marker detection fragment of buffalo PLAG1 gene

[0037] (1) PCR amplification

[0038] A pair of primers was designed based on the SNP genetic marker detection sequence (shown in SEQ ID NO.1) in the genomic sequence of the bovine PLAG1 gene (GenBank ID: NC_037341.1) to amplify the fragment of the polymorphic site. The primers are as follows:

[0039] Forward primer: F 5′-TTAAGGTCACCAGATACCGAA-3′

[0040] Reverse primer: R 5′-ACCTGTTTAAAATACCGTCT-3′

[0041] PCR amplification was performed using the above primers and genomic DNA from the blood of 24-month-old buffalo as a template;

[0042] The PCR reaction system is:

[0043]

[0044] The PCR reaction conditions were:

[0045]

[0046] The PCR products were detected by 1.5% agarose gel electrophoresis. Figure 1 As shown, lane M is DL1000 Marker, lanes 1-3 are amplified fragments of cattle, and the amplified fragment size is 665bp. The sequence of the amplified product is as follows:

[0047] TTAAGGTCACCAGATACCGAAGCACGAGCACGGAAGGATACTGAC

[0048] ACTATAAGCAATATTCTCCGCGGATGGACCCAAACATCACCTTGATAGC

[0049] TACTGGTCACTGCTACAACGTGCATCTTAAAACCCCTGTTACCGAGTTCC

[0050] GTTGTTCATGTCCTGACTGATACGCGCTACTCCTTGTGCAGCTTGTTAAT

[0051] TTCATGTAGGTGTTTCTTCCAAACTATGTATTTTTGCCGATGTGTTGCTT

[0052] GTGTTTCATTCTTCTTAGTCACTTGTGCAACATAGTGATATATTGTGTTG

[0053] ATTTGGACAGTAGCGGTTTTTAAAAACCATATACTGACTGAAAACATG

[0054] AGCCAGAGCTGACTGCTTTATTAAGCTAATAATGAATGTTAAAGAGTA

[0055] CATATTTTCAGGATTATTCATCTAGTAAGCAATACACATATATAGGCCA

[0056] ATATTTTTTTAAAAAATAGAGCTTGGTCAACCTCTATACTACACATATT

[0057] ACAAGATATAGCACTTTCAAAACGAATCTAAACTTTACAGAAAAACT

[0058] TTCTTATAGGTTATGCCTTTTATTTTAAGACTTATTATAATTTGTTTCAA

[0059] GTGCCATTAGAGGATAGATATATAGGCCTTTGATGTATAATGCTTTGTG

[0060] TTCAAGAATGGTAGACGGTATTTTAAACAGG.

[0061] (2) PCR product purification

[0062] The PCR amplification product was purified using the Gel Extraction Kit from Shanghai Shenggong Biotechnology Co., Ltd. For specific steps, see the kit instructions.

[0063] 3. Detection of molecular markers using direct sequencing of PCR products

[0064] The PCR purified product obtained above was directly sent to Qingke Bio for sequencing. The genotype of the locus in the test population was determined based on the sequencing results. The Chromas software was used for analysis. The results are shown in the attached figure. Figure 2 As shown, an A>G allele mutation was found at 427bp in the sequence, which caused the polymorphism of the PLAG1 gene.

[0065] (1) Detection of polymorphic distribution of molecular markers of PLAG1 gene in buffalo population

[0066] This molecular marker was used to detect the polymorphism distribution pattern of the 427 base A>G site of the PLAG1 gene in a population of 67 buffaloes. The detection results are shown in Table 1.

[0067] Table 1 Genotype frequency and allele frequency of PLAG1 gene in buffalo

[0068]

[0069] Note: The numbers outside the brackets in Table 1 are the number of individuals, and the numbers inside the brackets are the genotype frequencies.

[0070] According to the data obtained in Table 1, among the alleles A and G in the buffalo PLAG1 gene, the frequency of the A allele is significantly greater than that of the G allele.

[0071] Table 2 Association analysis between the polymorphism of the 427th base of the PLAG1 gene in buffalo and growth traits

[0072]

[0073] Note: The values ​​in the table are mean ± standard error. In the same row, a and b are marked, indicating significant differences at the P<0.05; the values ​​in the table are mean ± standard error. In the same row, A and B are marked, indicating extremely significant differences at the P<0.01.

[0074] The advantages of the present invention are that it provides for the first time a new site existing in the gene of the Chinese buffalo population, and clarifies the correlation between the polymorphism of the site and the growth traits of the buffalo. The detection method of the present invention is simple, low-cost, and the detection result is direct and reliable, which is suitable for large-scale screening and diagnosis of genes.

[0075] As can be seen from Table 2, in 24-month-old buffaloes, the height, cross height and body oblique length of the GG genotype individuals at the 427th base A>G site were significantly higher than those of the AG and AA genotype individuals (P<0.05), the chest circumference of the GG genotype individuals was extremely significantly higher than that of the AA genotype individuals (P<0.01), and the chest circumference of the AG genotype individuals was significantly higher than that of the AA genotype individuals (P<0.01), so the G allele is the dominant allele. Among the 67 experimental cattle, the number of GG individuals is small, and individuals carrying this dominant allele should be retained in breeding, which is conducive to improving the growth traits of the cattle population and can be used as potential genetic markers for breeding.

[0076] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A SNP molecular marker associated with buffalo growth traits, characterized in that: The SNP molecular marker is located at the 427th base in SEQ ID NO.1, and the base is A or G.

2. The SNP molecular marker associated with buffalo growth traits according to claim 1, characterized in that: The dominant allele of the 427th base in the growth trait of buffalo is the G allele; the dominant genotype is the GG genotype.

3. An application of the SNP molecular marker as described in any one of claims 1-2 in the detection of growth traits of breeding buffaloes, wherein the growth traits are body height, cross height, body oblique length and chest circumference of the buffaloes.

4. A detection primer, characterized in that The primers are used to detect the molecular markers as claimed in claim 1 or 2, and the nucleotide sequence of the detection primer pair is as follows: Forward primer: F 5´-TTAAGGTCACCAGATACCGAA-3´, Reverse primer: R 5´-ACCTGTTTAAAATACCGTCT-3´.

5. Use of the detection primer according to claim 4 in preparing a kit for detecting molecular markers related to growth traits of buffalo, characterized in that: The buffalo growth traits include the buffalo's body height, cross height, body oblique length and chest circumference.

6. Use of the detection primer according to claim 4 in detecting mutation sites of the PLAG1 gene.

7. A method for breeding buffalo, characterized in that: By testing the SNP molecular markers as described in claim 1 on the buffalo to be tested, the reproductive traits of the buffalo to be tested are evaluated, and individuals with dominant alleles and genotypes carrying the buffalo growth traits are selected to carry out breeding work, wherein the buffalo growth traits are the buffalo's body height, cross height, body oblique length and chest circumference.

8. The method for breeding buffalo according to claim 7, characterized in that: The following steps are involved: (1) obtaining blood from a buffalo to be tested to extract buffalo genomic DNA, and testing the buffalo genomic DNA to obtain a DNA template; (2) Design detection primers based on the nucleotide sequence of the SNP molecular marker. The nucleotide sequence of the detection primer pair is as follows: Forward primer: F 5´-TTAAGGTCACCAGATACCGAA-3´, Reverse primer: R 5´-ACCTGTTTAAAATACCGTCT-3´; (3) using the detection primers to perform PCR amplification on the DNA template to obtain a PCR amplification product; (4) sequencing the PCR amplification product to obtain a sequenced gene sequence; (5) Comparing and analyzing the sequenced gene sequence with the standard gene sequence of the buffalo population, obtaining the mutation site in the buffalo gene to be detected, determining the genotype of the mutation site in the gene, and selecting individuals with the genotype for breeding high-fertility superior varieties.

9. The method for breeding buffalo according to claim 8, characterized in that: One of the parents used for hybrid breeding has a SNP molecular marker containing the allele G; individuals with the SNP molecular marker GG genotype are regarded as the dominant individuals for the growth traits of buffaloes.

Images