Application of sakuranetin in prevention and treatment of plant botrytis cinerea

By applying cherry blossom extract to plants, especially through ultraviolet treatment and spraying, the formation of conidia of Botrytis cinerea is inhibited, solving the problem of insignificant control effects of existing technologies for plant gray mold and achieving green control.

CN117981755BActive Publication Date: 2026-08-04ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Filing Date
2024-01-30
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing technologies are not very effective in controlling gray mold in plants, and the use of traditional pesticides poses food safety and environmental pollution problems, thus limiting the application scope of cherry blossom extract.

Method used

Using cherry blossom extract as the active ingredient, the content of cherry blossom extract in plants is increased through ultraviolet treatment, and it is sprayed on the plant surface or prepared as a control agent to inhibit the formation of conidia of Botrytis cinerea.

Benefits of technology

Cherry blossom extract significantly inhibits the formation of conidia of Botrytis cinerea, effectively preventing and controlling gray mold in plants, which aligns with the concept of green and sustainable development and improves the resistance and quality of fruit and vegetable crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117981755B_ABST
    Figure CN117981755B_ABST
Patent Text Reader

Abstract

The application discloses application of prunol in prevention and treatment of plant botrytis blight, and relates to the technical field of botrytis blight prevention and treatment. The plant includes pea and tomato, and the content of prunol in the plant can be increased by ultraviolet (UV) treatment, so that the resistance to botrytis cinerea is improved. The application also adopts prunol to prepare a plant source bacteriostatic agent for prevention and treatment of botrytis blight. Compared with existing antibacterial agent products on the market, the prunol provided by the application belongs to flavonoids, and is applied to plant disease prevention and treatment, has less residue, and has remarkable effect, meets efficient disease-resistant variety breeding guided by green production, accords with the sustainable development concept of health and high quality, and provides a new idea for plant pathogen prevention and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gray mold control technology, and in particular to the application of cherry blossom extract in the control of plant gray mold. Background Technology

[0002] Gray mold is a common and difficult-to-control fungal disease of both open-field and protected-field crops. It is a disease that thrives in low temperatures and high humidity; the pathogen grows best at temperatures between 20 and 30°C, with peak incidence occurring when temperatures are between 20 and 25°C and humidity remains above 90%. Caused by *Botrytis cinerea*, a fungal disease, gray mold can affect flowers, fruits, leaves, and stems. This ascomycete-induced gray mold severely impacts crop quality and yield. Statistics show that tomatoes and peas are among the most vulnerable crops. Tomato yields can decrease by 30-50% after infection, while pea yields can decrease by 15%-30%. Furthermore, gray mold in these crops can severely damage the appearance of fruits and significantly reduce their internal quality, causing substantial economic losses to my country's tomato and pea industries.

[0003] Currently, the methods for controlling gray mold in production still rely on direct spraying of pesticides and plant-derived pesticides, but the effects are not significant. With increasing public concern about food safety and the ecological environment, exploring new strategies for green and sustainable crop production and disease control is a new requirement to ensure the stable and healthy development of the agricultural industry. Developing new green and pollution-free antibacterial agents aligns with the concepts of healthy and high-quality sustainable development. Phytoprotective agents, possessing both environmental protection and stress resistance functions, can be applied to biological control and show great promise.

[0004] Sakuranetin is an important flavonoid phytoprotective agent, initially isolated by Japanese researchers from leaf lesions in rice infected with *Bacillus oryzae*. It plays a crucial role in plant resistance to biotic stress. More notably, sakuranetin possesses significant antioxidant activity and multiple health benefits for humans. However, its effects on other diseases have not yet been identified, severely limiting its application and necessitating further expansion. Summary of the Invention

[0005] The first objective of this invention is to address the shortcomings of the prior art by providing the application of cherry blossom extract in the prevention and control of gray mold in plants.

[0006] Preferably, the plants include peas and tomatoes.

[0007] As a preferred method, ultraviolet (UV) treatment increases the content of chrysophanol in plants, thereby enhancing their resistance to Botrytis cinerea.

[0008] The second objective of this invention is to provide the application of cherry blossom extract in the preparation of agents for the control of gray mold.

[0009] The third objective of this invention is to provide a botrytis cinerea control agent containing the active ingredient cherry blossom extract.

[0010] As a preferred option, the concentration of cherry blossom extract is 0.1-0.3 mM.

[0011] Preferably, the gray mold control agent also includes other pharmaceutically acceptable carriers.

[0012] The fourth objective of this invention is to provide a method for preventing and controlling gray mold infection in plants, specifically by spraying a 0.1-0.3 mM concentration of cherry blossom extract onto the plant surface.

[0013] The fourth objective of this invention is to provide a method for preventing and controlling gray mold infection in plants, wherein the plants contain cherry blossom extract, and the method specifically involves irradiating the plants under ultraviolet light for 20-25 minutes.

[0014] The fifth objective of this invention is to provide the application of safflower extract in inhibiting the formation of conidia in Botrytis cinerea.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] This invention provides the application of cherry blossom extract in the control of gray mold in plants. After application, cherry blossom extract inhibits the formation of conidia of Botrytis cinerea, thereby controlling gray mold. This invention utilizes cherry blossom extract to prepare antifungal agents for tomatoes and other fruits and vegetables, used for the control of gray mold. Compared to existing antifungal products on the market, cherry blossom extract belongs to the flavonoid compound category. Its use in the control of diseases in tomatoes and other fruits and vegetables not only meets the requirements of green production-oriented breeding of highly effective disease-resistant varieties but also aligns with the concept of healthy and high-quality sustainable development, providing a new approach to the control of plant viruses. Attached Figure Description

[0017] Figure 1 The study investigated the effects of different concentrations of chloretin on the growth of *Botrytis cinerea*. Specifically: A) the growth status of *Botrytis cinerea* on media containing (0, 0.05, 0.1, 0.3 mM) chloretin; B) statistical analysis of *Botrytis cinerea* plaque diameters on media containing (0, 0.05, 0.1, 0.3 mM) chloretin; and C) the effect of different concentrations (0, 0.05, 0.1, 0.3 mM) chloretin on the spore formation rate of *Botrytis cinerea*. ("**" indicates a p-value less than 0.01; "*" indicates a p-value less than 0.5; different letters indicate significant differences with p < 0.05.)

[0018] Figure 2This study investigated the effects of different concentrations of sakura extract on the occurrence of gray mold in tomato. Specifically: A) Phenotypic characteristics of gray mold on tomato fruits after using different concentrations (0, 0.05, 0.1, 0.3 mM) of sakura extract; B) Statistical analysis of the gray mold index on tomato fruits after using different concentrations (0, 0.05, 0.1, 0.3 mM) of sakura extract; C) Statistical analysis of the necrotic area of ​​tomato fruits due to gray mold after using different concentrations (0, 0.05, 0.1, 0.3 mM) of sakura extract. (Different letters indicate significant differences (P < 0.05).)

[0019] Figure 3 Ultraviolet (UV) treatment improved the content of sucrosein in peas and their resistance to gray mold. The study included: A) determination of sucrosein content in peas after UV and gray mold treatments; B) phenotypic characteristics of gray mold disease in pea pods after UV treatment; C) statistical analysis of gray mold lesion length in pea pods after UV treatment; and D) statistical analysis of gray mold index in pea pods after UV treatment. (Different letters indicate significant differences (P < 0.05); "**" indicates P < 0.01; "*" indicates P < 0.5) Detailed Implementation

[0020] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments and accompanying drawings, but they should not be construed as limiting the scope of protection of the present invention.

[0021] Example 1

[0022] The inhibitory effect of cherry blossom extract on botrytis cinerea was identified. Figure 1 ).

[0023] PDA plates containing different concentrations (0.05, 0.1, 0.3 mM) of cherry blossom extract were prepared, with a solid medium without cherry blossom extract serving as a control. Exogenous bacterial blocks with a diameter of 0.5 cM were obtained using a punch and placed on PDA plates containing different concentrations of cherry blossom extract, with each treatment repeated five times. After incubation at 25°C for 6 days, the colony diameter was measured using the "cross-cross method".

[0024] Compared with the control, different concentrations (0.05, 0.1, 0.3 mM) of chrysophanol significantly inhibited the growth of *Botrytis cinerea*, with significantly smaller mycelial block diameters. Czapek's liquid medium (50 mL) containing different concentrations (0.05, 0.1, 0.3 mM) of chrysophanol was prepared, with a chrysophanol-free liquid medium serving as a control. Mycelial blocks with a diameter of 1 cM were obtained from exogenous colonies using a punch and placed in in vivo medium containing different concentrations of chrysophanol. Each treatment was repeated three times. After culturing on a shaker at 25°C for 3 days, spore counts were performed using a hemocytometer. Statistical analysis showed that different concentrations (0.05, 0.1, 0.3 mM) of chrysophanol inhibited the spore formation rate of *Botrytis cinerea*, with significant inhibitory effects observed at concentrations of 0.1-0.3 mM.

[0025] Example 2

[0026] The efficacy of safflower extract in controlling tomato gray mold was determined by spraying different concentrations (0, 0.05, 0.1, 0.3 mM) of safflower extract.

[0027] First, select healthy, disease-free, undamaged tomato fruits of uniform ripeness and spray them with different concentrations of cherry blossom extract (0, 0.05, 0.1, 0.3 mM), with each treatment repeated 5 times. Then, puncture the tomato fruits with a sterilized blade and spray with a 10% concentration of cherry blossom extract. 7 Infected tomato fruits were inoculated with a spore suspension of spores / mL. Disease progression and severity were observed 5 days post-inoculation. Statistical analysis revealed that, compared to the control, different concentrations (0.1 and 0.3 mM) of safflower extract significantly reduced the lesion area of ​​gray mold. Furthermore, the incidence of tomato gray mold was not significantly different after using 0.1 mM safflower extract compared to 0.3 mM. Based on the results of safflower extract's effect on gray mold growth, the optimal concentration range for safflower extract's control of gray mold was determined to be 0.1-0.3 mM, with the optimal concentration further identified as 0.1 mM.

[0028] Determination of *Botrytis cinerea* content in tomatoes. Five days after *Botrytis cinerea* inoculation, necrotic tissue samples were collected from tomatoes. DNA was extracted according to the Plant DNAzol (QIAGEN) instructions, and Real-time qPCR was performed according to the CHamQ SYBR qPCR Master Mix kit (Vazyme) instructions using a QuantStudio™ 6Flex Real-Time PCR System (Applied Biosystems). The reaction volume was 20 ng DNA / 10 μl. p ≤ 0.05 was considered statistically significant. Each sample was repeated five times. SlActin was used as an internal control gene.

[0029] The primer sequences used for the quantitative detection of the above-mentioned related gene expression levels are shown in Table 1 below:

[0030] Table 1 Primer sequences for quantitative detection of related gene expression levels in Example 2 (Table 1)

[0031] 1 SlActin-F GCTCCACCAGAGAGGAAATACAGT 2 SlActin-R CATACTCTGCCTTTGCAATCCA 3 Bc-ITS-F TCGAATCTTTGAACGCACATTGCGC 4 Bc-ITS-R TGGCAGAAGCACACCGAGAACCTG

[0032] Example 3

[0033] The effect of safflower extract on the control of gray mold in peas was determined by ultraviolet treatment.

[0034] First, select healthy, disease-free, undamaged pea pods of uniform maturity and treat them with ultraviolet light for 20 minutes, repeating each treatment 5 times. Then, puncture the pea pods with a sterilized needle and apply a 10% concentration of UV light. 7 Wounded pea pods were inoculated with a spore suspension of spores / mL, and the disease course and severity were observed 5 days after inoculation. Statistical analysis revealed that, compared to the control, the UV-treated pea pods showed a significant increase in spore content and a significant reduction in lesion area. This result indicates that UV treatment increases spore content in peas, thereby enhancing their resistance to Botrytis cinerea.

[0035] Determination of *Botrytis cinerea* content in peas. Five days after inoculation with *Botrytis cinerea*, samples of necrotic pea tissue were collected. The *Botrytis cinerea* content was detected using the same method as in Example 2 above. The reaction system consisted of 20 ng DNA / 10 μl. Pea-18S-rDNA was used as an internal control gene.

[0036] The primer sequences used for the quantitative detection of the above-mentioned related gene expression levels are shown in Table 2 below:

[0037] Table 2 Primer sequences for quantitative detection of related gene expression levels in Example 3 (Table 2)

[0038]

[0039]

[0040] As can be seen from the above embodiments, this invention provides the application of cherry blossom extract in the control of gray mold. The antifungal agent prepared using cherry blossom extract is used for the control of gray mold in tomatoes and peas. Compared with existing antifungal agents on the market, the product of this invention belongs to the flavonoid compound category, and its application in the control of gray mold in tomatoes and peas results in less residue and significant efficacy.

[0041] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of cherry blossom extract in the control of gray mold in plants.

2. The application according to claim 1, characterized in that, The plants include peas and tomatoes.

3. The application according to claim 1, characterized in that, Ultraviolet (UV) treatment increases the content of chrysophanol in plants, thereby enhancing their resistance to Botrytis cinerea.

4. Application of cherry blossom extract in the preparation of agents for the control of gray mold.

5. A method for preventing and controlling plant infection with gray mold, characterized in that, The method specifically involves spraying cherry blossom extract at a concentration of 0.1-0.3 mM onto the surface of the plant.

6. A method for preventing and controlling gray mold infection in plants, characterized in that, The plant contains cherry blossom extract, and the method specifically involves irradiating the plant under ultraviolet light for 20-25 minutes.

7. Application of cherry blossom extract in inhibiting the formation of conidia of Botrytis cinerea.