Application of Gma-miR396c gene editing in improving soybean salt tolerance and yield

Abstract

The invention discloses an application of a Gma-MIR396c gene in improving the salt tolerance and yield of soybeans. A gma-MIR396c-edited (MIR396c-GE) transgenic soybean is created through gene editing. The invention analyzes the effects on the growth and development of transgenic soybeans and the response to salt stress through miR396c precursor overexpression (pre-miR396c-OE) and gma-MIR396c editing (MIR396c-GE) based on CRISPR-Cas9 technology. It is found that the plant height, stem thickness, aboveground dry weight, number of pods, number of grains, single-row yield and 100-grain weight of MIR396c-GE are significantly increased, and the salt tolerance is improved; while pre-miR396c-OE is the opposite, and its plant height, stem thickness, aboveground dry weight, number of pods and number of grains are reduced, and the single-row yield and 100-grain weight are reduced, and the salt tolerance is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of the Gma-MIR396c gene in regulating the salt tolerance and yield of soybean. Background Art

[0002] MicroRNA (miRNA) is a non-coding small RNA widely found in eukaryotes, usually 20-24 nt, which regulates post-transcriptional gene expression through sequence complementarity. miR396 plays an important role in plant growth and development, and can regulate the development of plant leaves, roots, flowers, etc., as well as the size of fruits or grains. For example, in terms of leaf development, miR396 accumulates during the development of Arabidopsis leaves, inhibits GRF activity, regulates the number of cells in the leaves, and affects the size of the leaves. Studies have found that after Arabidopsis is exposed to solar UV-B radiation, the leaves are reduced, mainly by increasing miR396 activity and reducing GRF expression to inhibit leaf cell proliferation, thereby inhibiting leaf growth. In terms of root development, AtMIR396a is overexpressed in Arabidopsis, reducing the transcription level of GRF target genes, resulting in a significant shortening of root length; and the ATMIR396a mutant, mir396a-1, with reduced miR396a expression obtained by T-DNA insertion, has increased root length compared with wild-type seedlings. In addition, changes in miR396 expression can also cause abnormal development of different tissues of plants. For example, when the ptc-miR396c precursor of Populus trichocarpa is overexpressed in tobacco, some cotyledons of transgenic tobacco are fused and missing, the thallus is changed, the development is slow in the later stage of growth, and most flowers are sterile. In Arabidopsis, miR396 is upregulated to inhibit the expression of GRF genes in flower organs. In Arabidopsis overexpressed with miR396, about 70% of the flowers produce abnormally developed pistils. In tomatoes, the activity of miR396 is inhibited by target mimicking technology, which downregulates both miR396a and miR396b, resulting in significantly larger tomato flowers, sepals and fruits. MiR396 also affects the development of grains. For example, overexpression of OsmiR396c will reduce rice grains, while overexpression of its target gene OsGRF4 will increase rice grains.

[0003] From the above studies, the functional analysis of plant miR396 mostly adopts the method of gene overexpression, and there are also a few studies that inhibit the activity of miR396 through target mimicking technology to analyze the impact on transgenic plants. As for the research on soybean miR396, the function of miR396 in soybean is still unclear. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the above-mentioned problems and provide an application of the soybean gma-MIR396c gene in regulating the salt tolerance and yield of soybean.

[0005] The first object of the present invention is to provide the application of the gma-MIR396c gene.

[0006] The second object of the present invention is to provide a product for regulating and improving the salt tolerance and yield of soybeans.

[0007] The third object of the present invention is to provide a method for regulating and improving the salt tolerance and yield of soybeans.

[0008] The above-mentioned object of the present invention is achieved through the following technical solutions.

[0009] To achieve the above objectives, the present invention adopts the following technical solutions.

[0010] Application of Gma-MIR396c gene in improving soybean salt tolerance and yield.

[0011] Furthermore, through gene overexpression and gene editing, transgenic soybeans with miR396c precursor overexpression (pre-m96c-OE) and gma-MIR396c editing (MIR396c-GE) based on CRISPR-Cas9 were created, and the precursor sequence of Gma-miR396c (Pre-miR396c)

[0012] The mature sequence of Gma-miR396c (miR396c) is shown in SEQ ID No. 1: (CAACAAGUCCUGUUAUGCUUUUCCACAGCUUUCUUGAACUUCUUAUGCCUAGUGCAAUUAUUGAUGUGGCAUAGAAGUUUAAGAAAAAUGUGGAAAAACAUGUCAAAUCUAGGACUU), the oligonucleotide sequence of gDNA targeting Gma-MIR396c is shown in SEQ ID No. 1: (taagaagttcaagaaagctg).

[0013] The primers for Pre-miR396c qRT-PCR analysis include Pre-miR396c F / R, and or Gma-miR396c F; the Pre-miR396c F / R forward primer (5′-3′) is: GGTCATGCTTTTCCACAGCTT, and the reverse primer (5′-3′) is: TTGCCATATTCTCCCACAGC; the Gma-miR396c F forward primer (5′-3′) is: TTCCACAGCTTTCTTGAACTT.

[0014] The qRT-PCR internal reference gene primers include Cons15 F / R, wherein the Cons15 F / R forward primer (5′-3′) is: TAAAGAGCACCATGCCTATCC, and the reverse primer (5′-3′) is: TGGTTATGTGAGCAGATGCAA.

[0015] Mutation detection PCR primers include miR396c F / R; the miR396c F / R forward primer (5′-3′) is: ATCCACCCTTTTAGGACACTC, and the reverse primer (5′-3′) is:

[0016] CCTTCCAATTAGACCACCATT.

[0017] A product for regulating the salt tolerance and yield of soybeans, comprising any of the primers, and / or the precursor sequence of Gma-miR396c, and / or the mature sequence of Gma-miR396c.

[0018] A method for regulating and improving the salt tolerance and yield of soybeans, by gene editing the gma-MIR396c gene, creating CRISPR-Cas9-based gma-MIR396c edited (MIR396c-GE) transgenic soybeans. Further, the miR396c mature sequence is edited, thereby improving the salt tolerance and yield of transgenic soybeans. Furthermore, the salt tolerance includes any one or more of the salt tolerance in the seedling stage, the salt tolerance in the flowering stage, and the salt tolerance in the whole growth period.

[0019] The present invention analyzes the effects on the growth and development of transgenic soybean and the response to salt stress by overexpression of miR396c precursor (pre-miR396c-OE) and gma-MIR396c editing (MIR396c-GE) based on CRISPR-Cas9 technology, and finds that the plant height, stem thickness, aboveground dry weight, number of pods, number of grains, single-row yield, and 100-grain weight of MIR396c-GE are significantly increased, and the salt tolerance is improved; while pre-miR396c-OE is the opposite, and its plant height, stem thickness, aboveground dry weight, number of pods, and number of grains are reduced, and the single-row yield and 100-grain weight are reduced, and the salt tolerance is reduced.

[0020] The present invention innovatively discloses transgenic soybeans with overexpression of miR396c precursor (pre-miR396c-OE) and gma-MIR396c editing (MIR396c-GE) based on CRISPR-Cas9. Compared with the empty control, the salt tolerance of MIR396c-GE is improved. Under normal conditions, the plant height, stem thickness, aboveground dry weight, number of pods, number of grains, yield per plant, and 100-grain weight of MIR396c-GE are significantly increased; on the contrary, the salt tolerance of pre-miR396c-OE is reduced. Under normal conditions, the plant height, stem thickness, aboveground dry weight, number of pods, number of grains of pre-miR396c-OE are reduced, and the yield per plant and 100-grain weight are reduced. This indicates that the gma-MIR396c gene has the molecular function of regulating soybean salt tolerance and improving yield traits, providing an important candidate gene for the breeding of high-yield and salt-tolerant soybean varieties. At the same time, the creation of gma-MIR396c gene-edited materials provides important germplasm materials for the breeding of high-yield and salt-tolerant soybean varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 :Overexpression of soybean miR396c and screening of gene editing materials;

[0022] A: pre-miR396c overexpression vector. B: Gma-MIR396c gene editing expression vector. C, D: Relative expression of miR396c in pre-miR396c-OE and MIR396c-GE plants. E: PAT / bar test paper positive plants. F: MIR396c-GE gene editing materials produce various mutation types. Data are the mean ± SD of 3 biological replicates. Different asterisks indicate significant differences in variance analysis (*P<0.05, **P<0.01, ***P<0.001);

[0023] Figure 2 :Identification of salt tolerance of gene-edited material MIR396c-GE at different growth stages;

[0024] A: Phenotypes of MIR396c-GE and empty control VC-GE soybeans treated with salt stress at the seedling stage (GE1, 2, and 3 are used in the figure to represent the three gene-edited strains). B: Electrolyte exudation rate. C: Malondialdehyde content. D: DAB and NBT staining. E: Phenotypes of MIR396c-GE and VC-GE treated with salt stress at the flowering stage. F: Catalase content. G: Glutathione content. H: Grain weight of a single row of MIR396c-GE and VC-GE planted in a saline-alkali pond. I: Phenotypes of MIR396c-GE and VC-GE treated with salt stress during the entire growth period. Data are the mean ± SD of 3 biological replicates. Different asterisks indicate the significant difference level of variance analysis (*P<0.05; **P<0.01; ***P<0.001);

[0025] Figure 3 :Identification of salt tolerance of gene overexpression material pre-miR396c-OE at different growth stages;

[0026] A: Phenotypes of pre-miR396c-OE and empty control VC-OE under salt stress treatment at seedling stage (OE1, 2, and 3 are used in the figure to represent three overexpression lines). B: Electrolyte exudation rate. C: Malondialdehyde content. D: DAB and NBT staining results. E: Phenotypes of pre-miR396c-OE and VC-OE soybean under salt stress treatment at flowering stage and salt stress treatment during the whole growth period. F: Catalase content. G: Glutathione content. H: Single-row grain weight under salt stress treatment at flowering stage. I: Single-row grain weight of pre-miR396c-OE and VC-OE planted in saline-alkali ponds. Data are the mean ± SD of three biological replicates. Different asterisks indicate significant differences in variance analysis (*P<0.05, **P<0.01, ***P<0.001);

[0027] Figure 4 :Investigation on yield-related traits of gma-MIR396c edited materials under normal growth conditions;

[0028] A: Compared with the empty control VC-GE, the gene-edited material MIR396c-GE grew vigorously. B, C, D: Plant height, stem thickness, and aboveground dry weight of VC-GE and MIR396c-GE (GE1, 2, and 3 are used in the figure to represent the three strains). E: Harvest plants and grains of VC-GE and MIR396c-GE. F, G, H: Number of pods, single-row grain weight, and 100-grain weight of MIR396c-GE and VC-GE. The data are the mean ± SD of 3 biological replicates. Different asterisks indicate the significant difference level of variance analysis (*P<0.05, **P<0.01, ***P<0.001);

[0029] Figure 5 : Overexpression of pre-miR396c inhibits soybean growth;

[0030] A: Compared with VC-OE, the growth of pre-miR396c-OE was inhibited. B, C, D: Stem diameter, number of pods per plant, and number of grains per plant of potted VC-OE and pre-miR396c-OE (OE1, 2, and 3 are used to represent the three strains in the figure). E: Field growth phenotype of VC-OE and pre-miR396c-OE. F, G, H: Plant height, stem diameter, and aboveground dry weight of VC-OE and pre-miR396c-OE grown in the field. I: Plants and grains of VC-OE and pre-miR396c-OE at harvest. J, K, L: Number of pods per plant, grain weight per row, and 100-grain weight of pre-miR396c-OE and VC-OE. The data are the mean ± SD of 3 biological replicates. Different asterisks indicate significant differences in variance analysis (*P<0.05, **P<0.01, ***P<0.001). DETAILED DESCRIPTION

[0031] The following examples are provided to further illustrate the present invention, but the present invention is not limited thereto.

[0032] Embodiment 1:

[0033] 1. Experimental Materials

[0034] Soybean Jack seeds, vector plasmids pCAMBIA3301, pGmU6-10-sgRNA3.0 and pCambia3301-Cas9 were preserved by the Germplasm Resources Stress Resistance Identification and Evaluation Innovation Group, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences.

[0035] 2. Gma-miR396c overexpression and gene editing vector construction

[0036] The full-length sequence of pre-miR396c ( Table 1 ) was synthesized (Genscript, Nanjing, China) and ligated into the pCAMBIA3301 vector by homologous recombination and driven by the 35S CaMV promoter to construct the pre-miR396c overexpression vector pCAMBIA3301-pre-miR396c.

[0037] Find the mature sequence in the gma-MIR396c precursor sequence, obtain the 20bp sequence upstream of the PAM site near the mature sequence, design the target site of CRISPR / Cas9, and synthesize the oligonucleotide sequence (Table 1), i.e. gDNA. The pGmU6-10-sgRNA3.0 vector was double-digested with BstE II and Avr II, and homologous recombination was performed with the oligonucleotide sequence to generate the pGmU6-10-gDNA396c vector. Then, the pGmU6-10-gDNA396c and pCambia3301-Cas9 expression vectors were double-digested with EcoR I and Hind III, and the short and long fragments were recovered respectively and connected with T4 DNA ligase (Fermentas) to obtain the gma-MIR396c gene editing vector pCas9-GmU6-gDNA396c.

[0038] 3. Creation of miR396c overexpression and gene-edited transgenic soybeans

[0039] pCAMBIA3301-miR396c and pCas9-GmU6-gDNA396c were transformed into Agrobacterium EHA105, and soybean was transformed by Agrobacterium-mediated soybean cotyledon transformation method, and the recipient material was Jack. The positive transgenic soybean strains were screened using the QuickStix PAT / bar kit (EnviroLogix, USA), and the gma-MIR396c fragment was amplified by PCR (amplification primers are shown in Table 1) and sequenced to screen the gma-MIR396c homozygous editing mutant material, MIR396c-GE. The miR396c precursor overexpression material pre-miR396c-OE was screened by qRT-PCR analysis (primers are shown in Table 1). The empty-transformed soybeans without 396c precursor sequence or gDNA were set as empty controls (VC-OE, VC-GE) for overexpression and gene editing materials.

[0040] 4. RNA extraction and qRT-PCR analysis

[0041] For qRT-PCR analysis of gma-MIR396c and gma-GRFs, total RNA was extracted from leaves and roots using RNAprep Pure PlantPlus Kit (Tiangen) and miRcute miRNA Isolation Kit (Tiangen), respectively. The first-strand cDNA of Gm-GRFs was synthesized using RevertAid First Strand cDNA synthesis Kit (Thermo Scientific) for qRT-PCR analysis. The first-strand cDNA was synthesized using miRcute Plus miRNA First-strand cDNA Kit (Tiangen, Beijing, China) for qRT-PCR analysis of gma-MIR396c. qRT-PCR was performed on a Real-time PCR system (Applied Biosystems 7500, USA). The qRT-PCR analysis of Gm-GRFs used the Universal SYBR Green qPCR Supermix Kit (Bai Ruiji), and the qRT-PCR analysis of gma-MIR396c used the miRcute Plus miRNA qPCR Kit (SYBR Green) (Tiangen). The qRT-PCR analysis was performed with three independent biological replicates, each of which included three technical replicates. The total volume of each technical replicate was 10 μL, including 2× Universal SYBRGreen qPCR Supermix 5 μL, forward and reverse primers 0.6 μL, cDNA 1 μL, and ddH2O 2.8 μL. The primers used in this study are listed in Table 1.

[0042] 5. Investigation on agronomic characteristics of genetically modified soybeans

[0043] Select the seeds of transgenic materials and empty control that are full and free of sterile spots, and sow them in the normal plots of Shunyi Base of Chinese Academy of Agricultural Sciences, with a row length of 1 meter, 8 seeds per row, 3 rows of each strain for technical replication, corresponding to three rows of controls, and then select three strains for biological replication. After soybeans mature, investigate the agronomic traits such as plant height, stem diameter, grain size, 100-grain weight, and single plant weight of gma-MIR396c overexpression and gene-edited transgenic soybeans.

[0044] 6. Identification of salt tolerance of soybean seedlings

[0045] Five full soybean seeds without sterile spots were selected, and the transgenic materials and control materials were sown in vermiculite in the same pot and grown in an incubator at 28℃ with a light cycle of 16h / darkness of 8h. When the first true leaf unfolded, the soybean seedlings were treated with 150mM NaCl solution. After 14 days of treatment, the first true leaf was taken and observed by diaminobenzidine (3,3'-diaminobenzidine, DAB) and nitro blue tetrazolium (nitro blue tetrazolium, NBT) staining. The experiment was repeated 3 times. The leaves were soaked in 5mg / ml DAB (PH3.8) and 0.5mg / ml NBT (PH7.5) purchased from Biodee Company for 20h in the dark, and then transferred to anhydrous ethanol and soaked at room temperature for four days until completely decolorized. The ethanol solution was changed once a day during this period. After that, it was soaked in sterile water for three days, and the sterile water was changed once a day to observe the staining.

[0046] The electrolyte exudation rate and malondialdehyde content of soybean seedlings treated with 150mM NaCl solution for 16 days were measured. 0.5g of leaves were taken and placed in 10ml of deionized water. They were placed at room temperature for 45min and the conductivity Ci was measured. They were boiled in boiling water for 10min, brought to room temperature, and the conductivity Cmax was measured.

[0047] Electrolyte leakage rate = (Ci / Cmax) × 100

[0048] The excess samples were stored in a -80 degree refrigerator for subsequent malondialdehyde treatment. Take 0.5g of leaves, add 5ml of 10% trichloroacetic acid (TCA) to grind into a homogenate, and centrifuge at 10000rpm for 10min. Transfer the supernatant to a new tube and dilute to 10ml with 10% TCA; take 2.0ml of the supernatant in a stoppered test tube, add 2.0ml of 10% TCA containing 0.5% thiobarbituric acid (TBA), mix well, and place in a 95℃ water bath for 30min (start timing when small bubbles appear in the solution). Place in an ice field and cool rapidly at 10000rpm

[0049] Centrifuge for 10 min. Measure the OD value of the supernatant at 532 nm, 600 nm and 450 nm. For control, replace the extract with 2.0 ml of water.

[0050] MDA concentration C (μmol / L) = 6.45 × (A532-A600) - 0.56 × A450

[0051] MDA content (μmol / g) = C×V×10-3 / W = C×10×10-3 / 0.5

[0052] 7. Identification of salt tolerance of soybean during flowering period

[0053] Select full, sterile transgenic and empty control soybean seeds and culture them in vermiculite for 14 days. Then transplant five seedlings into a large pot with a length of 70 cm × width of 40 cm × height of 20 cm. Put soil in the pot: vermiculite = 1:1 and place it in the natural environment (May 2023, Beijing). After 30 days of growth, soybeans begin to bloom and begin to be treated with 0.6% NaCl solution. Water and salt solution are alternately irrigated every three days. Recovery treatment was carried out 3 days after the fifth salt treatment, and watering was continued until soybeans matured. The experiment was repeated 3 times. Samples were taken and stored in a -80 degree refrigerator during the fifth salt treatment. The catalase content and glutathione content were determined using a catalase (CAT) activity detection kit (Solarbio) and a reduced glutathione (GSH) content detection kit (Solarbio), respectively.

[0054] 8. Identification of salt tolerance of soybeans during the entire growth period

[0055] The transgenic and empty-loaded control soybean seeds were sown in the saline-alkali pond of the Salt Tolerance Identification Base of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Caofeidian, Hebei Province. In order to ensure the consistency of saline-alkali stress conditions as much as possible and reduce the error caused by uneven soil salinity, the transgenic and empty-loaded control soybean seeds were sown adjacent to each other and drip irrigation was used to control the soil salt content at about 0.4%. There were 6 replicates, and the single-row grain weight was investigated after the soybeans matured, and the differences between the transgenic soybeans and the empty-loaded control were compared.

[0056] 9. Data Analysis

[0057] All data are mean ± standard deviation. SPSS25.0 software was used for statistical analysis of statistical differences. To find significant differences, one-way analysis of variance (ANOVA) was used to compare multiple data sets, and the variance analysis was performed with LSD post hoc test; Student's t test was used to compare two data sets.

[0058] Example 2: Creation of transgenic soybean material

[0059] The pre-miR396c overexpression vector ( Figure 1 A) and gene editing expression vector ( Figure 1 B) Transformed soybean, positive plants were detected using QuickStix kit (ENVIROLOGIX) ( Figure 1 E), the overexpressed and gene-edited soybean materials were labeled as pre-miR396c-OE and MIR396c-GE, respectively. The expression of miR396c in positive transgenic soybeans was detected by qRT-PCR, and it was found that the expression of miR396c precursor in pre-miR396c-OE was significantly increased ( Figure 1C), while the expression of miR396c in MIR396c-GE material was decreased ( Figure 1 D). The gma-MIR396c sequence was further amplified by PCR using primers (Appendix 1) and sequenced. It was found that gma-MIR396c had different types of mutations. All mutations occurred within the mature sequence of gma-MIR396c and in the pairing region of the target gene GRF ( Figure 1 F). This indicates that the miR396c overexpression and gene editing transgenic soybean materials were successfully created.

[0060] Example 3: Improved salt tolerance of Gma-MIR396c gene editing material

[0061] After the gma-MIR396c gene-edited material MIR396c-GE and the empty control VC-GE were subjected to salt stress at the seedling stage, it was found that the salt damage symptoms of MIR396c-GE leaves were lighter, while most leaves of VC-GE turned yellow or died ( Figure 2 A), the electrolyte exudation rate of MIR396c-GE leaves was significantly lower than that of VC-GE ( Figure 2 B), indicating that the cell membrane of the edited material is more complete. Salt stress is often accompanied by oxidative stress. The malondialdehyde content in the leaves of MIR396c-GE was significantly lower than that of VC-GE ( Figure 2 C), and after DAB and NBT staining of leaves, MIR396c-GE had fewer yellow and blue spots ( Figure 2 D), proving that the edited materials had lower H2O2 and O2- contents under salt stress, and had stronger adaptability and regulation to oxidative stress. From the analysis of phenotypic and physiological and biochemical indicators after salt stress at the seedling stage, the salt tolerance of the edited material MIR396c-GE was higher than that of the empty control VC-GE, indicating that the Gma-MIR396c gene editing improved the salt tolerance of transgenic soybean at the seedling stage.

[0062] After salt stress treatment during the flowering period of MIR396c-GE and VC-GE, it was also found that the salt tolerance of Gma-MIR396c gene-edited transgenic soybeans was improved. When salt stress treatment began during the flowering period, the growth of VC-GE was more obviously inhibited. As the stress treatment time prolonged, many leaves of VC-GE fell off or even the whole plant died ( Figure 2 E), the contents of antioxidant substances catalase and glutathione in leaf cells of MIR396c-GE were significantly higher than those in VC-GE ( Figure 2 F, G), indicating that MIR396c-GE had a higher salt tolerance during flowering period than VC-GE.

[0063] The salt tolerance evaluation of transgenic soybeans during the whole growth period was carried out in a natural saline-alkali pool. In order to reduce the error caused by uneven soil salinity, transgenic and empty control soybean seeds were sown adjacent to each other, and drip irrigation was used to control the soil salt content at about 0.4%. It was found that the leaves of the empty control VC-GE began to turn yellow and dry during the soybean grain filling stage, showing symptoms of salt damage, while the leaf phenotype of the gene-edited material MIR396c-GE was normal ( Figure 2 I). When the soybeans matured, the single-row grain weight was investigated and it was found that the single-row grain weight of the gene-edited material MIR396c-GE was significantly higher than that of the empty control VC-GE ( Figure 2 H).

[0064] In contrast to the gene-edited materials, the miR396c overexpression material pre-miR396c-OE had reduced salt tolerance. Under salt stress treatment at the seedling stage, the leaves of the pre-miR396c-OE material were more severely damaged by salt than the empty control VC-OE ( Figure 3 A), the electrical conductivity and malondialdehyde content of the leaves were significantly higher than those of the control ( Figure 3 B, C), and after DAB and NBT staining, the staining color of pre-miR396c-OE leaves was darker ( Figure 3 D), indicating that the pre-miR396c-OE material is more sensitive to salt stress, and pre-miR396c overexpression reduces the salt tolerance of transgenic soybeans. After salt stress treatment during flowering, the growth of pre-miR396c-OE materials was more severely inhibited compared with the empty control. As the stress time prolonged, the leaves of pre-miR396c-OE fell off or the whole plant died ( Figure 3 E), the catalase and glutathione contents in the leaves of pre-miR396c-OE were significantly lower than those in the empty control ( Figure 3 F, G), after water recovery, some individual plants were able to survive and harvest grains, but the grain weight of pre-miR396c-OE was significantly lower than that of the empty control ( Figure 3 H), indicating that the salt tolerance of pre-miR396c-OE materials during flowering period was reduced. Similarly, when pre-miR396c-OE materials and empty control were planted in saline-alkali ponds, fewer plants of pre-miR396c-OE materials survived to obtain grains, and the single-row grain weight was significantly lower than that of VC-OE ( Figure 3 E, I). This once again verified that the soybean gma-MIR396c gene can regulate the molecular function of soybean response to salt stress.

[0065] Example 4: Improving soybean yield after Gma-MIR396c editing

[0066] Under normal growth conditions, the gma-MIR396c-edited material MIR396c-GE grew more vigorously than the empty control VC-GE ( Figure 4 A), its plant height, stem diameter and aboveground dry weight increased significantly ( Figure 4 BD). After soybeans matured, the yield traits were investigated and it was found that the number of pods per plant, grain weight per plant and 100-grain weight of MIR396c-GE were significantly higher than those of VC-GE ( Figure 4 EH), indicating that editing gma-MIR396c can promote soybean growth and development and increase yield. Pre-miR396c overexpression soybean pre-miR396c-OE showed dwarf plants regardless of potted plants or normal field growth conditions ( Figure 5 A, E), stem thickness becomes thinner ( Figure 5 B, G), and the aboveground biomass decreased ( Figure 5 H). After soybeans matured, the grain traits were investigated and it was found that the number of pods and grains per plant, and the grain weight and 100-grain weight per plant of the pre-miR396c-OE material were reduced compared with the empty control ( Figure 5 C, D, JL). These results suggest that overexpression of soybean miR396c has a negative regulatory effect on the growth, development and yield traits of soybean.

[0067] In summary, compared with the empty control, the soybean gma-MIR396c gene editing material MIR396c-GE has improved salt tolerance, and the plant height, stem diameter, aboveground dry weight, number of pods per plant, number of grains per plant, grain weight per plant, and 100-grain weight under normal growth conditions are significantly increased; while the gma-MIR396c precursor overexpression material pre-miR396c-OE has reduced salt tolerance, and the plant height, stem diameter, aboveground dry weight, number of pods per plant, number of grains per plant under normal growth conditions are reduced, and the grain weight per plant and 100-grain weight are reduced. This shows that the gma-MIR396c gene has the molecular function of regulating the salt tolerance of soybean and improving the yield traits. The creation of gma-MIR396c gene-edited soybean materials provides important germplasm materials for the breeding of high-yield and salt-tolerant soybean varieties.

[0068] Embodiment 5:

[0069] A product for regulating the salt tolerance of soybean, comprising the mature sequence of Gma-miR396c and the Gma-MIR396c gene.

[0070] Embodiment 6:

[0071] A product for regulating the salt tolerance of soybeans, comprising a mature sequence of Gma-miR396c and a Gma-MIR396c gene; and also comprising primers for Gma-pre-miR396c qRT-PCR analysis, qRT-PCR internal reference gene primers, and mutation detection PCR primers.

[0072] Embodiment 7:

[0073] A product for regulating the salt tolerance of soybean, comprising a precursor of Gma-miR396c, a mature sequence of Gma-miR396c, and a Gma-MIR396c gene.

[0074] Embodiment 8:

[0075] A method for regulating and improving the salt tolerance and yield of soybeans, wherein the gma-MIR396c gene is subjected to gene editing to create gma-MIR396c edited (MIR396c-GE) transgenic soybeans, wherein the salt tolerance includes salt tolerance at the seedling stage, and / or salt tolerance at the flowering stage, and / or salt tolerance during the entire growth period.

Claims

1. Gma-MIR396c The application of the gene in improving the salt tolerance and yield of soybean is characterized in that: Through gene editing, transgenic soybeans edited with Gma-MIR396c based on CRISPR-Cas9 were created, and the oligonucleotide sequence of gDNA targeting Gma-MIR396c is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The invention comprises primers for mutation detection PCR, wherein the primers include miR396c F / R; the miR396c F / R forward primer is: 5'-ATCCACCCTTTTAGGACACTC-3', and the reverse primer is: 5'-CCTTCCAATTAGACCACCATT-3'.

3. A product for regulating the salt tolerance and yield of soybeans, characterized in that: It comprises the gDNA targeting Gma-MIR396c as described in claim 1 and the primers for mutation detection PCR as described in claim 2.

4. A method for regulating and improving the salt tolerance and yield of soybeans, based on the use of claim 1, characterized in that: Through Gma-MIR396c Gene editing, creation Gma-MIR396c Edited by Soybean.

5. The method according to claim 4, characterized in that By editing the mature sequence of miR396c, the salt tolerance and yield of transgenic soybeans were improved.

6. The method according to claim 5, characterized in that The salt tolerance includes any one or more of salt tolerance in the seedling stage, salt tolerance in the flowering stage, and salt tolerance during the entire growth period.

Images