COL1A1 gene polymorphism as a genetic marker for semen quality traits in duroc pigs and application
By detecting G/C allele mutations in the COL1A1 gene of Duroc pigs and performing PCR-BsmAI-RFLP detection using BsmAI restriction site polymorphism, the genetic markers of pigs in existing technologies have been solved, enabling efficient screening of semen quality traits in Duroc pigs. This has improved semen volume and sperm motility, and reduced production costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2024-02-28
- Publication Date
- 2026-06-26
Smart Images

Figure BDA0004717698100000051 
Figure HDA0004717698110000011 
Figure HDA0004717698110000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of porcine genetic marker screening and application technology, specifically involving the application of SNP genetic markers in the assisted selection of semen quality traits in Duroc pigs, including a method for detecting and analyzing mutation sites in the porcine COL1A1 gene. Background Technology
[0002] The quality of boar semen directly affects sow litter size and conception rate during estrus, thus impacting farm productivity. Key boar semen quality traits include semen volume, sperm density, sperm motility, and sperm abnormality rate. These traits are influenced by various factors, such as genetic improvement, disease prevention and control, feeding and management practices, and the production environment, with genetic improvement playing a dominant role. Poor boar semen quality is prevalent in pig production. Furthermore, the heritability of semen quality traits is relatively low, and progress through conventional selection is slow. Therefore, it is necessary to utilize marker-assisted selection to improve boar semen quality.
[0003] The COL1A1 gene encodes the type I collagen α1 chain and is highly conserved in humans, pigs, sheep, and mice (Xiang et al., 2022). The α1 chain encoded by COL1A1 has been reported to not only provide essential structural support for connective tissue but also play a crucial role in cellular functions such as cell anchoring, differentiation, and adhesion (Kim and Kim, 2022). COL1A1 is expressed in the seminiferous tubules of immature and adult mice and regulates the adhesion of spermatogonia and pre-lepidocrophyllin spermatocytes to the basement membrane (He et al., 2005). COL1A1 deficiency leads to suppressed accelerated differentiation and self-renewal of spermatogonia (Chen et al., 2012). Ge et al., using iTRAQ proteomics analysis of melatonin-treated sheep epididymal epithelial cells, found that COL1A1 expression was upregulated in the treated group and speculated that COL1A1 may be involved in sperm maturation in the epididymis (Ge et al., 2022). Furthermore, reports indicate that COL1A1 is downregulated in poor-quality bull semen (Elango et al., 2023). These studies suggest that the COL1A1 gene influences spermatogenesis. Therefore, this invention uses population trait association analysis to identify the correlation between SNP molecular markers and Duroc boar semen quality traits, laying the foundation for molecular improvement of Duroc boar semen quality traits. Summary of the Invention
[0004] The purpose of this invention is to obtain a genetic marker associated with the semen quality traits of Duroc pigs, to find the COL1A1 gene mutation site based on sequencing results, to detect COL1A1 gene polymorphism, to provide a new genetic marker for marker-assisted selection in Duroc pigs, as well as genotyping and a new selection method.
[0005] Specifically, the technical solution of the present invention is as follows:
[0006] This invention provides a genetic marker for bovine semen quality traits, based on the results of RNA sequencing of Duroc bovine testicular tissue. In the sequencing results, the applicant discovered a polymorphic site in the COL1A1 gene, specifically a G / C allele mutation (313 bp) in exon 40 (this exon 40 refers to the full sequence of the COL1A1 gene; the applicant designed primers to amplify and sequence a fragment containing exon 40, obtaining a 527 bp fragment). This mutation can lead to PCR-BsmAI-RFLP polymorphism.
[0007] Specifically, the present invention provides an SNP marker related to the quality traits of Duroc boar semen, the nucleotide sequence of which is as described in SEQ ID NO:1 (the specific sequence and mutation site are shown below), and there is a base mutation G at position 313 of the sequence (here, base G refers to the mutated base of Duroc boar individual 1), or the nucleotide sequence of which is as described in SEQ ID NO:1 (the specific sequence and mutation site are shown below), and there is an allele mutation at position 313 of the sequence, namely base mutation C (here, base C refers to the mutated base of Duroc boar individual 2), causing polymorphism of the BsmAI restriction site.
[0008] This invention provides an application of SNP genetic markers in the selection-assisted selection of semen quality traits in Duroc pigs, and the specific nucleotide sequence of the SNP genetic markers is as follows:
[0009] TCAGATTTGGGGAGCAGTGGAGGGGAGGCCCCAGGAAGGCATGGAGAAAGGA
[0010] GCAGAAAGGGCAGAGTTGGGGTGTCATAAGCCCAACGGGCAGAAAAGGACTT
[0011] ACCCCCACATGGGTCTTCAAGCAAGTGGACCAAGCTTCCTTTTTTAAAAAGTTA
[0012] TTTATTTATTCTTTTTTTTTTTTTTTTTTTTGGTAAGGTTTGAAATGCACTTTTGGT
[0013] TTTTGGTCATGTTCAGTTGGTCAAAGATTTAAAAACTAAGTTTGAGATGAATGCAAAGGAAAAAAATATTTTCCAAAGTCCATGTGAAATTGTCTR(G / C)CCATTTT TTGGCTTTGGGGGGGTTTCCGTTTGGGGTGTTTGTTTGTTTCCAGGGTCAGGGGCAATTGGGTTGGGTGGGAGGGAGCCAGATTGGGGCGGAGGGAGTTTACAGGAAGCAGACAGGGCTAAGGTCGATGCCGAATTCTTGGTCGGGGGCGCCAACGTCCAAGGGGGCCACATCGATGATGGGCAGGCGGGAGGTCTTGGTGGTTTT,
[0014] There is an allele mutation (R) at base 313 of the above sequence, that is, a mutation from base G to base C. This mutation causes polymorphism at the BsmAI restriction site.
[0015] This invention provides a method for screening SNP genetic markers for bovine semen quality traits, the specific steps of which are as follows:
[0016] Genomic DNA was extracted from bovine semen, logged into the Ensembl database, and the bovine COL1A1 gene sequence was downloaded. SNP sites identified from the sequencing results were located within the sequence, revealing a G / C allele mutation on exon 40 of this gene (e.g., Figure 1 and Figure 2 Specific primers were designed for this SNP site (as shown in the instruction manual); Duroc pig genomic DNA was used as a template for amplification (results are shown in...). Figure 3 Based on the obtained target fragment, it was found that the mutation caused a polymorphism at the BsmAI restriction site (GTCTCN↓). Then, the BsmAI-RFLP (restriction endonuclease fragment length polymorphism) of this G / C mutation was detected, and the results of the SNP detection are shown below. Figure 4 As shown.
[0017] This invention provides an application of a method for identifying BsmAI-RFLP (restriction fragment length polymorphism) genotyping of G / C mutations in the aforementioned sequences. The method involves PCR amplification of porcine genomic DNA, followed by BsmAI digestion and genotyping of the amplified fragments, and subsequent detection. Furthermore, the BsmAI-RFLP method is used to determine the association between different genotypes in Duroc pigs and semen quality traits.
[0018] For more detailed invention solutions, please refer to the "Detailed Description of the Embodiments". Attached Figure Description
[0019] Figure 1 : This is the nucleotide sequence of the target fragment amplified by Duroc pig individual 1. The sequence length is 527 bp, and there is an allele mutation "G" at position 313 of the sequence.
[0020] Figure 2 : is the nucleotide sequence of the target fragment amplified by Duroc pig individual 2, with a sequence length of 527 bp. There is an allele mutation "C" at position 313 of this sequence.
[0021] Figure 3 Agarose gel electrophoresis pattern of the primer amplification fragments used for genotyping of the porcine COL1A1 gene. Figure labeling: Agarose gel concentration 1.2%; Figure 3 Lane descriptions: Lane M is for DNA Marker DL2000; lanes 1-8 contain amplified fragments in Duroc pigs using specific primers, with a fragment size of 527 bp. Results are as follows... Figure 1 and Figure 2 As shown, in Figure 1 The results show that there is a mutation site G (represented by R) at 313 bp in the amplified fragment of Duroc pig individual 1; and another mutation site C (represented by R) at 313 bp in the amplified fragment of Duroc pig individual 2, resulting in PCR-BsmAI-RFLP polymorphism.
[0022] Figure 4 This is an agarose gel electrophoresis pattern of the porcine COL1A1 gene fragment detected by BsmAI-RFLP. Figure label explanation: Agarose gel concentration is 1.2%. Figure 4 Lane descriptions: Lane M is DNA Marker DL2000; Lanes 3 and 4 are GC genotypes with fragment sizes of 527bp, 314bp, and 213bp, respectively; Lanes 5, 7, and 8 are CC genotypes with fragment sizes of 314bp and 213bp, respectively; Lanes 1, 2, and 6 are GG genotypes with a fragment size of 527bp.
[0023] The method according to the invention can be used to develop rapid diagnostic methods or kits, which can then be used in breeding programs to select pigs carrying favorable alleles, thereby achieving better selection results. Detailed Implementation
[0024] Example 1: Obtaining the COL1A1 gene fragment and establishing a method for polymorphism detection
[0025] Log in to the Ensembl database and download the porcine COL1A1 gene sequence (accession number ENSSSCG00000036135). Identify the selected SNP sites in the sequence and design primers using Primer Premier 5 software. The forward primer sequence is COL1A1-BsmAI-F: TCAGATTTGGGGAGCAGT, and the reverse primer sequence is COL1A1-BsmAI-R: AAAACCACCAAGACCTCC. PCR amplification yields a 527bp target fragment (its nucleotide sequence is as described in SEQ ID NO: 1, and the electrophoresis results are as follows). Figure 3 (As shown). The PCR reaction system consisted of 25 μl, including 1 μl template DNA, 0.5 μl each of forward and reverse primers, 12.5 μl PCR Mix, and finally 10.5 μl deionized water to a total volume of 25 μl. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; then 94℃ denaturation for 30 s, 59℃ annealing for 30 s, and 72℃ extension for 35 s, for a total of 36 cycles; and finally 72℃ extension for 5 min.
[0026] The amplified fragment is 527 bp in length, and the SNP site is a G>C mutation (replacement) located at 313 bp of this fragment (e.g. Figure 1 This mutation caused a polymorphism in the BsmAI restriction site (GTCTCN↓).
[0027] This invention performs BsmAI-RFLP digestion and typing on the PCR-amplified target fragment. The specific steps are as follows: Take 6 μl of PCR product, add 0.4 μl of restriction endonuclease and 1 μl of 10× buffer, then add 2.6 μl of deionized water to make a 10 μl digestion system. Digest at 55℃ for 20 min. Detect the digestion products using 1.2% agarose gel electrophoresis and record the digestion results (e.g., ...). Figure 4 As shown in the figure, the amplified fragment size is 527 bp. When the base at the 313 bp site is C, a BsmAI restriction site will be generated, and two fragments with lengths of 314 bp and 213 bp (C allele) will be obtained by restriction. When this site is G, there is no BsmAI restriction site, and a fragment with a length of 527 bp (G allele) will be obtained by restriction.
[0028] Example 2: Association analysis of bovine semen quality traits using genetic markers screened in this invention.
[0029] To determine whether the PCR-BsmAI-RFLP polymorphism of the porcine COL1A1 gene is related to Duroc boar semen quality, this invention uses the GLM program of SAS statistical software (SAS Institute Inc, Version 9.4, a publicly known and widely used software) for one-marker ANOVA. Simultaneously, the REG program is used to calculate the additive and dominant effects of the gene, and significance tests are performed. The model used is as follows:
[0030] Y ij =μ+G i +F j +e ij
[0031] Y ij Here, μ represents the phenotypic value, and G represents the mean value. i Genotypic effects (including additive and dominant effects; additive effects are represented by 1, 0, and -1 for GG, GC, and CC genotypes, respectively, and dominant effects are represented by 1, -1, and 1 for GG, GC, and CC genotypes, respectively); F j For the comprehensive effect of pig farms; e ij This is due to the residual effect.
[0032] Association analysis between different genotypes and semen quality traits was conducted in Duroc pigs. The statistical analysis results are shown in Table 1.
[0033] Table 1: Statistical Analysis of COL1A1 Gene PCR-BsmAI-RFLP Genotype and Duroc Pig Semen Quality Traits
[0034]
[0035] Note: The values in Table 1 are the least squares mean standard errors; lowercase letters indicate significant differences; positive additive effects indicate that the G allele increases the phenotypic value of the trait. * indicates P < 0.05.
[0036] As shown in Table 1, in Duroc pigs, the semen volume of the GC genotype was 20.61 mL / head higher than that of the CC genotype (P<0.05), and the dominant effect value of semen volume in Duroc pigs was -7.57±3.08 mL / head (P<0.05).
[0037] This invention identified the SNP polymorphism of the COL1A1 gene in Duroc pigs and analyzed its correlation with semen volume, sperm density, sperm motility, and sperm abnormality rate. Specifically, in Duroc pigs, this SNP site was significantly correlated with semen volume, and the GC genotype may be beneficial for increasing semen volume, suggesting that the SNP site at position 313 of this specific nucleotide sequence could serve as a candidate marker for semen volume in pigs. In actual boar breeding, whether a boar carries the GC genotype can be used to determine whether that individual is expected to have a higher semen volume compared to other individuals. Therefore, this invention can be used to guide the early screening of Duroc boars for assisted selection, thereby reducing production costs and improving economic efficiency in pig farming.
Claims
1. The application of a SNP genetic marker in the assisted selection of semen quality traits in Duroc pigs, wherein the semen quality trait is semen volume; characterized in that... The nucleotide sequence of the genetic marker is shown below: The R at position 313 of the above sequence is either G or C. This mutation causes... Bsm AI restriction site polymorphism; The marker was applied to three Duroc pig genotypes: GG, GC, and CC, with the G allele being the dominant allele.