Creation and application of a kind of fragrant fresh corn badh2a / badh2b

Abstract

The present invention discloses a method for efficiently creating fragrant fresh corn using CRISPR / Cas9 technology. <h2 style=";text-align:left;direction:ltr">ZmBADH2a Genes and <h2 style=";text-align:left;direction:ltr"> ZmBADH2b The target was designed in the exon region of the gene and the CRISPR / Cas9 gene editing vector was constructed, and the double gene knockout mutant was obtained through genetic transformation. The experiment proved that the 2-AP content in the grains of the double gene knockout mutant was significantly increased, while no 2-AP was detected in the unedited JR76. Using the amino acid sequence before and after the mutation site, a method for screening <h2 style=";text-align:left;direction:ltr"> badh2a / badh2b The present invention utilizes CRISPR / Cas9 technology to improve the aroma of fresh corn efficiently by breaking through the transformation technology of fresh corn, and develops functional markers in combination with molecular biology technology, providing new breeding materials for the development of fragrant fresh corn varieties, molecular breeding and corn variety selection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and corn breeding, and specifically relates to a method for efficiently creating fragrant fresh-eating corn and selecting molecular markers thereof by utilizing CRISPR / Cas9 technology. Background Art

[0002] Corn is one of the most important food grains in the world. About one-third of the world's population now relies on corn as their main food grain. With the development of corn breeding and supporting processing industries, the edible quality of corn has been continuously improved. Fresh corn and new corn foods such as corn flakes, cornmeal, corn residue, instant corn and other products are very popular in the domestic and foreign markets. However, there are few reports on the cultivation of fragrant fresh corn varieties. Discovering and creating new high-quality fragrant fresh corn germplasm resources is an important way to do this.

[0003] Genome editing technology mainly relies on artificial endonucleases (Sequence-Specific Nucleases, SSNs) and a series of functional modules to perform operations such as deletion, insertion and base substitution of bases or DNA fragments in the target genomic region. As a new generation of gene editing technology, CRISPR / Cas9 nuclease has the advantages of simplicity and high efficiency, and has been rapidly and successfully applied to animals and plants. For example, Zhang Xiang et al. (2021) used CRISPR / Cas9 technology to edit the aroma-related genes of corn Jing 724, which improved the aroma components of this variety and proved that this method can be used for aroma improvement. However, the materials used for corn transformation are currently limited to a few varieties, and there are few reports on fresh corn. Summary of the invention

[0004] The present invention provides a new gene editing type badh2a / badh2b fragrant fresh corn. The mutation produced by the new gene editing induces the production of corn 2-acetyl-pyrroline, so that the fresh corn has fragrant quality.

[0005] The first object of the present invention is to provide a fresh corn mutant gene badh2a / badh2b, wherein the nucleotide sequence of the fresh corn aroma mutant gene badh2a / badh2b is a nucleotide sequence generated by adding, replacing or deleting one or more bases in the nucleotide sequence shown in SEQ ID No.1, 2, and the induced 2-AP can regulate the formation of corn aroma.

[0006] Furthermore, the sequence (CDS) of the fresh corn badh2a / badh2b is a nucleotide sequence generated by adding, replacing or deleting one or more bases in the nucleotide sequence shown in SEQ ID No. 1, 2.

[0007] Furthermore, the nucleotide sequence of the fresh corn badh2a / badh2b mutant gene badh2a is a nucleotide sequence generated by deleting 210 bases from the nucleotide sequence shown in SEQ ID No.1, and the mutant badh2a nucleotide sequence is shown in SEQ ID NO:3;.

[0008] Furthermore, the nucleotide sequence of the fresh corn badh2a / badh2b mutant gene badh2b is a nucleotide sequence generated by deleting 5 bases in the nucleotide sequence shown in SEQ ID No.2, and the mutant badh2b nucleotide sequence is shown in SEQ ID NO:4.

[0009] Furthermore, the fresh corn badh2a / badh2b mutant induces the production of 2-AP aroma substances.

[0010] The second object of the present invention is to provide an application of a fresh-eating corn badh2a / badh2b mutant gene in cultivating fragrant plant varieties, characterized in that the corn badh2a / badh2b mutant gene is any mutant gene of the above-mentioned BADH2a / BADH2b, the plant is fresh-eating corn, and the quality is fragrance.

[0011] The inventors of the present application used CRISPR-Cas9 technology to edit the two genes BADH2a / BADH2b of fresh sweet corn JR76 to obtain corn badh2a / badh2b mutants, which induce the production of the aroma substance 2-AP.

[0012] In the badh2a / badh2b mutant, the expression level of BADH2a / BADH2b was severely affected, and the content of 2-AP in the mutant was significantly increased.

[0013] The genomic nucleotide sequences of BADH2a / BADH2b in maize are shown in SEQ ID No. 1 and 2. In the badh2a / badh2b mutant, the nucleotide sequences are shown in SEQ ID No. 3 and 4.

[0014] Molecular biological techniques were used to design primers based on the sequences before and after the mutation sites of SEQ ID No. 3, 4 in the badh2a / badh2b mutants to obtain BH1, 2. This marker can identify the two mutant genes and can be used in molecular marker-assisted breeding.

[0015] The beneficial effects of the present invention are as follows: the present invention provides a new gene editing method for breeding fragrant fresh corn, combined with a breakthrough in the transformation technology of fresh corn, and finds that the mutation of the BADH2a / BADH2b gene causes the fresh sweet corn JR76 to produce fragrance, providing a new germplasm resource for breeding fresh fragrant sweet corn by genetic engineering means. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 qPCR was used to identify the expression of BADH2a / BADH2b genes in badh2a / badh2b mutants.

[0017] FIG2 shows the determination of 2-AP.

[0018] Figure 3 Developed for badh2a / badh2b mutation gene marker. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0020] Example 1: BADH2a / BADH2b mutation vector construction and transformation

[0021] To avoid using incomplete gRNA, we determined the fragments of each ZmBADH2-1 and ZmBADH2 gene from fresh sweet corn JR76. The CRISPR-GE online tool (http: / / skl.scau.edu.cn / ) was used for target design, and two targets were designed for each gene. The recognition target sequences (sgRNAs) were CCGCCTCCCCGTCGTCAACC and GCGGCGCTCAAGAGGAACCGTGG. The target sequences were annealed and complementary using forward and reverse primers, and the codon-optimized SpCas9 was driven by the maize ubiquitin promoter and ligated to the knockout backbone vector digested with BsaⅠ using T4 ligase to obtain the final CRISPR / Cas9 knockout vector, which was used for maize genetic transformation after sequencing verification. The binary vector was introduced into Agrobacterium (Agrobacterium tumefaciens) strain EHA105. Agrobacterium-mediated transformation was performed using immature zygotic embryos collected at 10-15 DAP (Frame et al., 2011).

[0022] We amplified and sequenced the upstream and downstream regions of two targets on ZmBADH2a and ZmBADH2b, and the results showed that in T0 plants, 10 ZmBADH2a and 13 ZmBADH2b had mutations. Among these mutants, both target sites of 9 ZmBADH2a and 6 ZmBADH2b were edited. Further analysis of the sequencing results showed that the target regions of ZmBADH2a and ZmBADH2b of the 9 mutants had double or multiple target mutations, and the mutation types included base deletion, base insertion and base substitution. All these mutations may lead to changes such as premature termination or amino acid deletion of ZmBADH2a and ZmBADH2b protein sequences.

[0023] Example 2: qPCR identification of BADH2a / BADH2b gene expression in badh2a / badh2b mutants

[0024] Total RNA was isolated using RNAprep Pure Plant+ Kit (Tiangen Biotechnology, Beijing). The first-strand cDNA was purified using PrimeScript TM RT reagent kit (Takara, Dalian), 20 μL reaction, 500 ng RNA. TB Green Premix ExTaq TM (Takara, Dalian) was used for quantitative PCR amplification. 96 instrument. The expression level of ZmGAPDH was used as an internal control. After denaturation at 95°C for 30 seconds, a three-step PCR program was used, with a total of 40 cycles of qPCR (95°C, 5s; 55°C, 30 seconds; 72°C, 30 seconds per cycle). The RT-qPCR data of each sample were normalized to the corresponding ZmGAPDH data. Three biological replicates were set for each experiment. The results showed that BADH2a / BADH2b was significantly higher in the wild type and mutant ( Figure 1 , 4, 22, and 23), indicating that the editing site affects the normal expression of the gene.

[0025] Example 3: Determination of the content of aroma substance 2-AP

[0026] Chromatographic column: TG-5MS (30m×0.25mm×0.25μm), column temperature program: first heated to 40℃ and maintained for 1min, then heated at 2℃·min -1 Heating rate: Heat to 65℃, hold for 1min; then heat at 10℃·min -1 Heating rate: heat to 220°C and maintain for 10 min; injection port temperature: 220°C, carrier gas: high-purity (purity > 99.999%) helium.

[0027] 3 g of mature seeds of wild-type control JR76 and gene-edited mutant, 2 g of seeds of rice varieties Nipponbare and Yuzhenxiang, were taken respectively, ground into powder and the content of aroma substance 2-AP was determined. 2,4,6-Trimethylpyridine was used as internal standard, and 3 biological replicates were performed for each material. Referring to the research of SHAN (2015), the details are as follows: powdered sample → steam distillation → ether extraction (3 g powder + 350 mL distilled water in a 500 mL round-bottom flask, add 60 mL ether to another 250 mL round-bottom flask, heat the 250 mL round-bottom flask at 60 ° C in a water bath for 1 h, and extract with a simultaneous distillation extractor) → dry the organic phase with anhydrous sodium sulfate → blow to dryness with nitrogen, and re-dissolve with 200 mL of dichloromethane. The analytical samples prepared by pretreatment were qualitatively identified by GC / MS identification results and NIST library retrieval.

[0028] The results of content determination showed that no 2-AP was detected in the JR76 control, and the 2-AP content of the gene-edited strains was higher than that of the wild-type control. Figure 2a , Figure 2b , Figure 2c The 2-AP contents in the three mutants shown were 2.73–17.53 μg kg -1 Therefore, by using gene editing technology to mutate the maize BADH2a / BADH2b gene, maize germplasm materials with improved aroma traits can be obtained.

[0029] Example 4: Development of badh2-1 / badh2-2 selection markers

[0030] According to the design target of nucleotide sequence SEQ ID No.1,2, primers were designed 100bp upstream and downstream.

[0031] BH1-F1:CGATCCCTAGCGACGAAGTC;

[0032] BH1-R1: GGCGGAGGGAGTAGATACCA;

[0033] BH2-F1: CGGTATCCGTATCGCCAGAG;

[0034] BH2-R1: CACTCCCAAACACCCCCTAC;

[0035] like Figure 3 As shown, the mutant genes badh2a / badh2b can be clearly distinguished by using these two pairs of primers to amplify the wild-type JR76 (control), double mutant (4-1) and their heterozygotes, among which, Figure 3 The left side shows the band amplified using BH2-F1 / BH2-R1. Figure 3The band shown on the right is the band amplified using BH1-F1 / BH1-R1.

[0036] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A double mutant gene for fresh corn <h2 style=";text-align:left;direction:ltr">badh2a / <h2 style=";text-align:left;direction:ltr"> badh2b , characterized in that, The mutant gene <h2 style=";text-align:left;direction:ltr"> badh2a The nucleotide sequence is shown in SEQ ID NO: 3; the mutant gene <h2 style=";text-align:left;direction:ltr"> badh2b The nucleotide sequence is shown in SEQ ID NO:

4.

2. A double mutant gene of fresh corn as claimed in claim 1 <h2 style=";text-align:left;direction:ltr"> badh2a / <h2 style=";text-align:left;direction:ltr"> badh2b Application in breeding fragrant and fresh-eating corn varieties.

Images