Yanye shea amyl alcohol bacteria, bacteria and its application in the repair of petroleum hydrocarbon contaminated water body

Abstract

The application discloses a Sphingobium yanoikuyae, a microbial agent and application of the Sphingobium yanoikuyae in remediation of an oil hydrocarbon contaminated water body, and relates to the technical field of microorganisms. The Sphingobium yanoikuyae is preserved in the China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number is CGMCC NO. 29277. The application also discloses a microbial agent of the strain and application of the microbial agent in in-situ remediation of groundwater. The strain has a remarkable removal effect on oil hydrocarbons in the groundwater, wherein the removal rate of the oil hydrocarbons in the groundwater is more than 70% after the microbial agent is injected for 30 days, and the continuous action time is greater than 30 days. The Sphingobium yanoikuyae and the microbial agent prepared by fermentation of the strain provided by the application have the advantages of greenness, safety, high efficiency, long-acting nature and the like, and have a good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, and relates to a strain of Sphingobium yanookuyae, a microbial agent and application of the strain and the microbial agent in remediation of petroleum hydrocarbon contaminated water. BACKGROUND

[0002] During the process of urbanization and industrialization, groundwater pollution is widespread and increasingly serious. Organic pollution is a difficult problem in the treatment of groundwater pollution, which seriously affects the quality of groundwater. Due to large-scale gathering and the long history of some enterprises, there is a serious problem of groundwater organic pollution around the chemical industry park. Petroleum hydrocarbons (C10-C40) are common organic pollutants in groundwater of petroleum processing and chemical raw material manufacturing enterprises, which include n-alkanes, cycloalkanes, alkenes, arenes, polycyclic aromatic hydrocarbons and other substances. Due to the characteristics of concealment, complexity, difficulty in control and governance, once the groundwater is polluted, it is very difficult to repair and recover, and the repair cost is huge.

[0003] Common groundwater pollution control and remediation technologies mainly include ex-situ extraction treatment technology, permeable reaction grid, in-situ chemical oxidation and reduction, monitoring natural attenuation, in-situ microbial remediation, etc. Among them, microbial remediation has been widely used in marine oil pollution and soil oil pollution, and is the most studied biological remediation technology. At present, more than 200 kinds of microorganisms belonging to more than 100 genera have been found to be able to effectively degrade petroleum hydrocarbons. However, there are still few microorganisms that can be applied to actual in-situ groundwater remediation with significant effect.

[0004] Compared with chemical remediation and physical remediation, biological remediation is more susceptible to external environmental influences, such as petroleum pollution concentration, which affects the survival or degradation activity of microorganisms when the petroleum concentration is too high; external physicochemical factors such as dissolved oxygen level also affect biological growth and reproduction. Therefore, it is necessary to screen degradation bacteria suitable for groundwater environmental conditions. SUMMARY

[0005] In view of the lack of bacterial resources for in-situ remediation of groundwater petroleum hydrocarbons, the present application provides a Sphingobium yanookuyae and a microbial agent, which can be applied to in-situ remediation of petroleum hydrocarbon contaminated groundwater. The strain has a significant removal effect on petroleum hydrocarbons in groundwater.

[0006] The specific technical solutions adopted by the present application are as follows:

[0007] In a first aspect, the present application provides a Sphingobium yanookuyae, which was preserved in the China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number is CGMCC NO.29277.

[0008] As a preferred embodiment of the first aspect, the nucleotide sequence of the 16S rRNA gene of the Yimnapensis sp. is shown in SEQ ID NO. 1.

[0009] In a second aspect, the present application provides a microbial agent for degrading petroleum hydrocarbons, wherein the effective component is the Yimnapensis sp. according to any of the embodiments of the first aspect.

[0010] As a preferred embodiment of the second aspect, the microbial agent is a liquid microbial agent obtained by fermentation culture of the Yimnapensis sp.

[0011] In a third aspect, the present application provides the use of the Yimnapensis sp. according to any of the embodiments of the first aspect in the remediation of water bodies contaminated with petroleum hydrocarbons.

[0012] As a preferred embodiment of the third aspect, the water body is groundwater.

[0013] In a fourth aspect, the present application provides the use of the microbial agent according to any of the embodiments of the second aspect in the remediation of water bodies contaminated with petroleum hydrocarbons.

[0014] As a preferred embodiment of the fourth aspect, the water body is groundwater.

[0015] In a fifth aspect, the present application provides a method for in-situ remediation of groundwater contaminated with petroleum hydrocarbons, which comprises injecting the microbial agent according to any of the embodiments of the second aspect into the groundwater contaminated with petroleum hydrocarbons, and the final concentration of the microbial agent in the groundwater contaminated with petroleum hydrocarbons reaches the minimum effective concentration required for remediation, and the Yimnapensis sp. in the microbial agent degrades the petroleum hydrocarbons to achieve in-situ remediation of the groundwater contaminated with petroleum hydrocarbons.

[0016] As a preferred embodiment of the fifth aspect, the minimum effective concentration is 10 7 CFU / mL or more.

[0017] The present application provides a Yimnapensis sp. and a microbial agent thereof, which have a significant removal effect on petroleum hydrocarbons in groundwater, with a removal rate of 70% or more in 30 days, and a sustained action time of more than 30 days, and can be used for in-situ microbial remediation of groundwater. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The colony morphology of the Yimnapensis sp. in the present application, wherein the left and right graphs respectively show single colonies on petroleum hydrocarbon inorganic salt plates and LB plates.

[0019] Figure 2 Identification of petroleum hydrocarbon degradation genes of the Yimnapensis sp. in the present application (identified to be positive for genes xylE and akbD).

[0020] Figure 3The degradation curve of the Yano sphingan alcohol bacteria fermentation liquid bacteria agent on petroleum hydrocarbon in the application.

[0021] Figure 4 The actual groundwater area 1 (upstream) in the application, the concentration of petroleum hydrocarbon and the concentration of Yano sphingan alcohol bacteria; wherein MW04, MW05, MW06 are downstream monitoring well points of injected bacteria, and MW03 is a bacteria injection well.

[0022] Figure 5 The actual groundwater area 1 (downstream) in the application, the concentration of petroleum hydrocarbon and the concentration of Yano sphingan alcohol bacteria; wherein Z31 is a downstream monitoring well point without injecting bacteria, Z06 and Z08 are bacteria injection wells, and Z24, Z25, Z27 are downstream monitoring well points of injected bacteria.

[0023] Biological preservation

[0024] Yano sphingan alcohol bacteria (Sphingobium yanoikuyae) was preserved in the China General Microbiological Culture Collection Center on December 11, 2023, at address: No. 1, Beichen West Road, No. 3, Chaoyang District, Beijing, Postcode: 100101, and the preservation number is CGMCC NO. 29277. DETAILED DESCRIPTION

[0025] The application will be further described in detail below with reference to the accompanying drawings, which are an explanation of the application rather than a limitation. In the following examples, the methods used are conventional methods unless otherwise specified, and the reagents used are commercially available products unless otherwise specified.

[0026] The above Yano sphingan alcohol bacteria and petroleum hydrocarbon degradation microbial bacteria agent of the application will be demonstrated below through examples.

[0027] Example 1:

[0028] In this embodiment, the separation and identification process of the Yano sphingan alcohol bacteria strain involved in the application is mainly demonstrated, which is as follows:

[0029] (1) Single cell separation culture

[0030] Under sterile conditions, 20 mL of actual petroleum hydrocarbon contaminated groundwater sample was taken, and the cell screen with a pore size of 40 μm was used to remove impurities and suspended solids, and the concentration of the diluted bacteria solution was 10 2CFU / mL. The diluted bacterial solution was outputted in the form of single droplet by a droplet output device, and the single droplet was added into a 96-well plate, 100 μL of inorganic salt medium was added into each well plate, and the petroleum hydrocarbon concentration in each well was 20 mg / L. The droplet output device comprises a syringe, a micro-injection pump and a needle, the syringe is installed on the micro-injection pump, and the syringe and the needle are connected by a PFA hose; the syringe is used to suck the diluted bacterial solution. The 96-well plate was placed in a microplate shaker, and incubated at 30°C with constant temperature shaking at 180 r / min. The OD value at 600 nm of each well of the bacterial microplate was determined by a full-wavelength microplate reader to obtain the growth of the bacteria in each well.

[0031] The inorganic salt medium comprises KH2PO4 1 g, K2HPO4·3H2O 3 g, MgSO4 0.2 g, FeSO4·7H2O 0.02 g, NaCl 1 g, (NH4)2SO4 0.5 g, CaCl2 0.01 g, trace salt solution 1 mL, and distilled water 1000 mL; the pH of the inorganic salt medium is 7.3, and the inorganic salt medium is sterilized at 121°C for 20 min before use.

[0032] (2) Isolation and purification

[0033] The OD value of the 96-well plate was selected 600 The highest and >0.5 bacterial suspension was selected, and 50 μL of the bacterial suspension was used for isolation and purification. The bacterial suspension was spread on a petroleum hydrocarbon inorganic salt plate, and colonies were cultured at 30°C. A single colony on the plate was picked and purified on a LB plate by multiple "Z" type streaking, and no impurity bacteria were observed. The single colony was picked to obtain a purified strain.

[0034] (3) Strain identification

[0035] The strains screened above were identified by combining the physiological and biochemical characteristics of bacteria and 16S rRNA sequences. Colony PCR primers were as follows: 27F (5'-AGAGTTTGATCCTGGCTCAG-3'), 1492R (5'-GGTTACCTTGTTACGACTT-3') and were used for colony PCR, and the strains were preliminarily identified by BLAST sequence comparison of NCBI. In this embodiment, the strain was identified as Yanocephalothrips sp., and the obtained single colony was as shown in Figure 1The physiological and biochemical identification results show that the strain can utilize ortho-nitrophenyl-beta-d-galactopyranoside (ONPG), arginine, lysine, ornithine, urease, gelatin, and arabinose. The above-mentioned Sphingobium yanookuyae was preserved in the China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number is CGMCC NO. 29277.

[0036] In addition, the culture of Sphingobium yanookuyae, the extraction of genomic DNA, and the degradation gene identification method are as follows:

[0037] The single colony on the plate was inoculated into LB medium, and cultured at 30°C, 180 rpm for 48h to the late logarithmic phase (OD 600 = 1). The genomic DNA extraction kit for gram-negative bacteria was used for DNA extraction, and the extracted DNA solution was stored at -20°C. The PCR primers are as follows:

[0038] bphA3-F AACAAGGAGATTTCGATGTCGAACAAATTGCGCCTT

[0039] bphA3-R CTACGTCTCCTTCTATCAGGCGCTCTCTTTCGGTT

[0040] bphA4-F AGGAGATATACATAGTGCGCTCGATTGCGATTG

[0041] bphA4-R TCGAAATCTCCTTGTTGTCACAGGCCAGACACTTTTCG

[0042] bphC-F GGTAAGCCCGACTACAACACAA

[0043] bphC-R GGAGGCATGCAACACGATGC

[0044] xylE-F GGCACTGACCGGTGTACTTCG

[0045] xylE-R CGACCTTGAAGGCCATCC

[0046] almA-F GACATGTGTATTGTCAAATTTGTGC

[0047] almA-R CCAATGAGATCATGGAAGAAC

[0048] akbD1-F ATGGCAAAAGTGACCGAA

[0049] akbD1-R CTATGCCGCGCGGAAATG

[0050] In this embodiment, according to the colony sequencing result of Yano sphingan bacteria, the nucleotide sequence of 16S rRNA gene of Yano sphingan bacteria is shown as SEQ ID NO. 1, and the specific PCR sequencing data of the nucleotide sequence is as follows:

[0051]

[0052] The complete gene fragments xylE and akbD were obtained by PCR using the strain Yarrowia lipolytica genome as a template, and the obtained degradation gene PCR is shown in Figure 2 .

[0053] It should be noted that the LB medium formula used in this embodiment is as follows: 10.0 g of tryptone, 5.0 g of yeast extract, 10.0 g of sodium chloride, dissolved in 1000 mL of distilled water, adjust pH = 7, high temperature and high pressure sterilization. The LB medium formula used in the subsequent examples is the same, and will not be repeated here.

[0054] Example 2:

[0055] The present application provides a kind of for repairing groundwater oil hydrocarbon pollution oil hydrocarbon degradation microbial liquid inoculant, its specific preparation method and application effect are shown below.

[0056] Based on the separated oil hydrocarbon degrading bacteria Yarrowia lipolytica (i.e. the aforementioned preservation number CGMCC NO.29277 Yarrowia lipolytica), through the volume gradient of 5L-50L-500L (i.e. first fermented to 5L, then fermented to 50L, finally fermented to 500L), gradually complete fermentation experiment, and then gradually expand the microbial amount of Yarrowia lipolytica, finally obtain the Yarrowia lipolytica microbial liquid inoculant for repairing groundwater oil hydrocarbon pollution. Parameters in fermentation process are controlled as follows: medium selection LB medium, temperature 30 DEG C, 180 rpm fermentation 48 h.

[0057] In this embodiment, the microbial liquid inoculant obtained by final fermentation is used in simulated oil hydrocarbon contaminated groundwater, and the concentration of oil hydrocarbon in simulated groundwater is 20 mg / L. The final concentration of Yarrowia lipolytica added in simulated groundwater is 10 7 CFU / mL, and a control group without adding Yarrowia lipolytica is set, and the concentration change of oil hydrocarbon in the two groups of simulated groundwater is shown in Figure 3 . From Figure 3 It can be found that Yarrowia lipolytica can degrade 65.1% of oil hydrocarbon in 14 days at a concentration of 10 7 CFU / mL.

[0058] It should be noted that the fermentation method used in the preparation of the microbial agent in the present embodiment is relatively mature, and the fermentation culture is mainly to amplify the biomass of the microorganism to meet the subsequent experimental requirements. However, other fermentation methods in the prior art can also be used to prepare the sphingomonas yanoikuyae microbial agent in the present application. The final prepared microbial agent has sphingomonas yanoikuyae as the effective component, but the viable bacterial content can be different, and the microbial agent can also contain other additional components produced during the fermentation process, which will not inhibit the growth and metabolism of sphingomonas yanoikuyae.

[0059] Example 3

[0060] Based on the microbial liquid agent prepared in Example 2, the present application further provides an in-situ remediation method for treating groundwater petroleum hydrocarbon pollution.

[0061] (1) Survival of sphingomonas yanoikuyae in actual groundwater and degradation characteristics of petroleum hydrocarbons

[0062] Taking an actual groundwater remediation site as the research object, the sphingomonas yanoikuyae microbial liquid agent obtained in Example 2 is applied to the groundwater through calculation simulation of the actual pollution area until the final concentration of sphingomonas yanoikuyae in the groundwater reaches 10 7 CFU / mL or more. The concentration of petroleum hydrocarbons is detected by gas chromatography (GC-MS), and the concentration of sphingomonas yanoikuyae is detected by fluorescence quantitative PCR. The changes in the concentration of petroleum hydrocarbons and the concentration of sphingomonas yanoikuyae in different monitoring well points are investigated. In the present embodiment, the results obtained at two points are shown in Figure 4 and Figure 5 It is found from the results at the upstream point that the concentration of petroleum hydrocarbons in the groundwater of the monitoring well rapidly decreases by 96.3% after 3 days of injection of the microbial agent, and the degradation rate still reaches 78% after the second pollution input for 7 days. The number of degrading bacteria at the MW04 point increases by more than one order of magnitude after 3 days of injection of the microbial agent, and the sustained action time is >30 days. It is found from the results at the downstream point that the concentration of petroleum hydrocarbons in the groundwater of the monitoring well does not change without injection of the microbial agent, while the concentration of petroleum hydrocarbons in the groundwater of the monitoring well rapidly decreases after injection of the microbial agent, and decreases by more than 70% after 30 days. The number of degrading bacteria in the groundwater of the monitoring well after injection of the microbial agent increases, and the concentration is maintained for >30 days.

[0063] The above-mentioned sphingomonas yanoikuyae and its microbial agent can improve the efficiency of groundwater petroleum hydrocarbon remediation, which is manifested by a removal rate of more than 70% in 30 days, and still being able to continue to repair after the second pollution impact, with a sustained action time of >30 days.

[0064] It should be noted that the final Yoshinaga sphingan bacteria end concentration in the groundwater can be reasonably optimized according to the actual groundwater pollution situation, if the content of petroleum hydrocarbon in the groundwater is too high, the final Yoshinaga sphingan bacteria end concentration needs to be appropriately increased to avoid the growth stress of Yoshinaga sphingan bacteria, therefore the final Yoshinaga sphingan bacteria end concentration needs to be the minimum effective concentration required for repair. In the actual application, when the petroleum hydrocarbon contaminated groundwater is in-situ remediated, the minimum effective concentration required for repair can be determined through a pre-experiment, then the aforementioned microbial inoculum is injected into the petroleum hydrocarbon contaminated groundwater to be repaired, so that the final concentration of the microbial inoculum in the petroleum hydrocarbon contaminated groundwater reaches the minimum effective concentration required for repair, and then the Yoshinaga sphingan bacteria in the microbial inoculum is used to degrade petroleum hydrocarbon, so as to realize the in-situ remediation of the petroleum hydrocarbon contaminated groundwater.

[0065] In addition, it should be noted that the water body to be repaired in the present application is not limited to groundwater, but also other water bodies such as lakes, rivers, landscape water bodies, etc.

[0066] The above-described embodiments are only a preferred scheme of the present application, and are not intended to limit the present application. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application. Therefore, any technical scheme obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present application.

Claims

1. A type of *Sphingosine monocytogenes* ( Sphingobium yanoikuyae ), characterized in that, The Sphingobium yanoikuyae is preserved in China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number is CGMCC NO. 29277.

2. A microbial agent for degrading petroleum hydrocarbons, characterized by, An effective component is the Sphingobium yanoikuyae in claim 1.

3. The microbial inoculant of claim 2, wherein, The microbial agent is a liquid microbial agent obtained by fermentation culture of the Sphingobium yanoikuyae.

4. Application of the Sphingobium yanoikuyae in claim 1 in the remediation of water bodies contaminated by petroleum hydrocarbons.

5. Use according to claim 4, characterized in that, The water body is groundwater.

6. Application of the microbial agent in claim 2 or 3 in the remediation of water bodies contaminated by petroleum hydrocarbons.

7. Use according to claim 6, characterized in that, The water body is groundwater.

8. A method for in situ remediation of groundwater contaminated with petroleum hydrocarbons, characterized in that, Injecting the microbial inoculum of claim 2 or 3 into the petroleum hydrocarbon contaminated groundwater to be remediated, and the final concentration of the microbial inoculum in the petroleum hydrocarbon contaminated groundwater needs to reach the minimum effective concentration 10 7 CFU / mL required for remediation, using the Yarrowia sp. in the microbial inoculum to degrade petroleum hydrocarbons, to achieve in-situ remediation of the petroleum hydrocarbon contaminated groundwater.

Images