Anti-melanoma s100b nanobody and encoding gene and application thereof

Abstract

The application discloses an anti-melanoma S100B nanobody and an encoding gene and application thereof, and relates to the technical field of biological detection. The anti-melanoma S100B nanobody is screened out from a nanobody phage library after a recombinant S100B protein is incubated with an ELISA plate, has high affinity, high water solubility and conformation stability, strong antigen affinity and excellent tissue penetration capacity, has high affinity with the S100B protein, can efficiently detect melanoma, and can be used for preparing a melanoma detection kit.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, and in particular to an anti-melanoma S100B nanobody, its encoding gene, and its applications. Background Technology

[0002] Melanoma is a malignant tumor originating from melanocytes, commonly found in the skin, mucous membranes, eyes, and central nervous system. While melanoma accounts for a relatively low percentage of skin tumors (approximately 4%), it accounts for about 80% of deaths from skin tumors. This is primarily because melanoma has an insidious onset and a high rate of metastasis, often reaching a high level of malignancy by the time it is discovered. Current research confirms that light-colored skin, UV sensitivity, a family history of melanoma, and the presence of large congenital nevi can all contribute to the formation of melanoma, making it a serious threat to human health. Malignant melanoma primarily develops from superficial epidermal tumors and can be surgically removed before invasive growth, resulting in a relatively good prognosis. Clinically, it can be classified into malignant nevi, acral melanoma, superficial spreading melanoma (approximately 70%), and nodular melanoma (approximately 15%). Once melanoma penetrates the dermis, it may have already reached a "vertical" growth stage and has the potential for metastasis, warranting serious attention. Once melanoma enters its rapid growth phase, the 5-year survival rate for patients is extremely poor, and the mortality rate is high. Common clinical treatments include non-specific immunotherapy, radiotherapy, retinoic acid therapy, and various biological therapies; however, no treatment has been proven to significantly improve the 5-year survival rate of melanoma patients. Therefore, early detection, timely assessment of metastasis, and timely surgical intervention are crucial for improving the survival rate of patients with malignant melanoma.

[0003] Malignant melanoma involves mutations and abnormal expression of various proteins, inducing the activation of related signaling pathways. These pathways, in turn, influence the development and progression of melanoma cells through physiological processes such as cell proliferation, cell survival, and cell invasion and migration. These abnormally expressed proteins or activated signaling pathways may lead to resistance to relevant therapeutic drugs, affecting patient prognosis and treatment. Correspondingly, targeted drugs against these abnormal proteins and pathways often have good therapeutic effects, and monitoring the expression levels of these proteins can provide timely indications of the melanoma development process. Melanoma-inhibiting activity (MIA) is specifically highly expressed in malignant melanoma cells, but is not expressed or is only partially expressed in normal skin cells or benign melanoma cells, and is also generally not expressed in non-melanoma-derived skin tumors. This protein is a soluble protein of approximately 11 kDa. It shows an increasing trend in the serum of patients with stage III and IV melanoma. Elevated serum MIA levels in metastatic melanoma patients indicate a worsening of the disease. Therefore, serum MIA levels can reflect the degree of melanoma metastasis and treatment efficacy to some extent, and can be used to differentiate between benign and malignant melanoma. Tumor-associated antigen 90 immune complex (TA-90IC) was first found in the serum of patients with metastatic malignant melanoma, and has since been discovered in other tumors, such as colon cancer, breast cancer, and lung cancer. TA-90IC has been reported as a highly sensitive antigenic marker for accurately detecting occult melanoma metastasis. In predicting occult melanoma metastasis, its sensitivity and specificity can reach 77% and 76%, respectively, demonstrating good diagnostic value.

[0004] Currently, S100B is a widely used biomarker molecule in malignant melanoma, especially metastatic melanoma. It is a calcium-binding protein with a molecular weight of approximately 10 kDa, highly conserved in mammalian cells, and mainly distributed in central nervous system cells, glial cells, melanocytes, and adipocytes. Significantly elevated serum S100B levels indicate a poor prognosis and also have good predictive value in the clinical staging of malignant melanoma. Studies have reported that the diagnostic sensitivity of S100B for early-stage cutaneous malignant melanoma (stages I and II) is less than 15%, while it can reach 60-85% for stage IV patients and 10-50% for stage III. Since S100B can also be expressed in other cells, elevated serum S100B levels are not specific to malignant melanoma and can also be seen in various inflammatory conditions, infections, and diseases involving liver and kidney damage. Nanobodies (Nb) are naturally occurring heavy chain antibodies (HCAbs) found in camels, lacking the light chain, and approximately 15 kDa in size. Compared to monoclonal antibodies, nanobodies can be expressed on a large scale using prokaryotic systems, are inexpensive, and easy to deploy. Compared to traditional IgG, nanobodies exhibit higher specificity and affinity. Furthermore, nanobodies possess good solubility and strong tissue penetration, making it easier to enter tissue cells and perform their recognition function. Studies have shown that nanobodies can bind to the active site of enzymes, receptor-ligand binding gaps, or other occult epitopes, enabling assays that cannot be performed with conventional antibodies. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides an anti-melanoma S100B nanobody, its encoding gene, and its applications. This nanobody exhibits high affinity for the melanoma S100B protein and can be used to prepare melanoma detection kits.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides a nanobody against melanoma S100B, the nanobody comprising a heavy chain variable region, wherein the heavy chain variable region includes a complementarity-determining region CDR1, a complementarity-determining region CDR2, and a complementarity-determining region CDR3, the amino acid sequences of which are as follows:

[0008] Complementary determinant region CDR1: GFTFSNYA;

[0009] Complementary Determinant Region CDR2: ITTLGSFT;

[0010] Complementary determinant region CDR3: NAPRVRGSTNY.

[0011] Furthermore, the nanobody described in this invention also includes a framework region.

[0012] The framework region FR of the anti-melanoma S100B nanobody includes FR1 shown in SEQ ID No. 6, FR2 shown in SEQ ID No. 7, FR3 shown in SEQ ID No. 8, and FR4 shown in SEQ ID No. 9.

[0013] The amino acid sequence of the variable region of the heavy chain is shown in SEQ ID No. 4.

[0014] The anti-melanoma S100B nanobody includes one of the aforementioned heavy chain variable regions.

[0015] The present invention also provides a gene encoding the aforementioned nanobody.

[0016] Preferably, the nucleotide sequence of the gene is shown in SEQ ID No. 5.

[0017] The present invention also provides a recombinant expression vector comprising the aforementioned gene.

[0018] The present invention also provides a genetically engineered cell, which is obtained by introducing the recombinant expression vector into a host cell.

[0019] Preferably, the host cell is Escherichia coli, yeast, or CHO cell.

[0020] The present invention also provides the application of the aforementioned nanobody in the preparation of a melanoma detection kit.

[0021] The present invention relates to an anti-melanoma S100B nanobody, which is obtained by screening high-affinity nanobodies after incubating a nanobody phage library with the obtained recombinant S100B protein through ELISA. It has high water solubility and conformational stability, strong antigen affinity and excellent tissue penetration ability, and has high affinity for natural S100B protein. It can efficiently detect melanoma and can be used to prepare melanoma detection kits. Attached Figure Description

[0022] Figure 1 The image shows the SDS-PAGE electrophoresis results of the purified recombinant expression of melanoma S100B protein. In the image, 1 and 2 represent the SDS-PAGE electrophoresis results of melanoma S100B protein after expression with different loading amounts.

[0023] Figure 2The results of PCR for anti-melanoma nanobodies are shown. Lane M is the standard DNA Marker DL5000, and lanes 1 to 6 represent 6 nanobodies, with 1 being 104, 2 being 122, 3 being 132, 4 being 163, 5 being 346, and 6 being 379.

[0024] Figure 3 The phylogenetic tree analysis results of the amino acid sequences of six anti-S100B nanobodies are shown.

[0025] Figure 4 The plasmid map of the prokaryotic expression recombinant vector for the anti-S100B nanobody of clone strain 163.

[0026] Figure 5 The image shows the electrophoresis results of the prokaryotic expression and purification of the anti-S100B nanobody from clone strain 163.

[0027] Figure 6 The image shows the binding results of the anti-S100B nanobody of clone strain 163 with natural melanoma A375 and B16F10WB, where 1 is recombinant S100B, 2 is A375, and 3 is B16F10. Detailed Implementation

[0028] Example 1

[0029] The steps for obtaining the malignant melanoma-specific recombinant protein S100B are as follows:

[0030] (1) Primer design and PCR amplification: Specific primers were designed, and the CDS region of the gene (sequence shown in SEQ ID No. 12) was amplified by LA high-fidelity enzyme PCR. After gel extraction and recovery, it was ligated into the pMD19T-simple vector (Kore Biotech, catalog number: kl-zl-00010). The plasmid was extracted and sent to a sequencing company for sequencing analysis.

[0031] Specific primer sequences:

[0032] Upstream primer: CGCGGATCCATGTCTGAGCTGGAGAAGGCCA

[0033] Downstream primer: TTGCGGCCGCCTCATGTTCAAAGAACTCGTGGCAG;

[0034] (2) Construction of prokaryotic expression plasmids: The CDS fragment of the correctly sequenced plasmid was ligated into the pGEX-4T-1 vector by double enzyme digestion. The plasmid was then double-digested (Bam HI and Not I enzymes) and sequenced for identification. The correctly sequenced prokaryotic expression plasmid was transformed into BL21(DE3) competent cells, and positive bacterial cultures were identified by PCR and sequencing analysis.

[0035] (3) Protein expression and purification: Positive bacterial cultures were expanded, and IPTG was added to induce expression. Samples were collected at 0, 2, 4, 6, and 8 hours after induction. SDS-PAGE was used to detect protein expression. The bacterial culture was collected by centrifugation, and after being lysed with PBS, the lysate was purified by sonication. The lysate was purified using a nickel column and eluted with different concentrations of imidazole. SDS-PAGE was used to verify the expression of recombinant S100B protein. Figure 1 The protein concentration was determined using the Bradford method and stored at -80°C for later use.

[0036] Example 2

[0037] Screening of specific nanobodies. The steps are as follows:

[0038] (1) Dilute the target molecules S100B antigen and GST antigen with carbonate buffer at pH 9.6 to a final concentration of 5 μg / mL, add 100 μL / well to the enzyme label wells, and coat 8 wells with each target molecule (4 wells for the second round of screening, and 2 wells for the third and fourth rounds of screening). Coat overnight at 4℃.

[0039] (2) Discard the coating solution, wash 3 times with PBS, add 300 μL of 3% OVA-PBS blocking solution to each well, and block at 37°C for 1 h;

[0040] (3) Dilute the antigen to 5 μg / ml with 3% OVA-PBS blocking solution, add 100 μl of phage library (constructed by Chengdu Apak Biotechnology Co., Ltd.) for liquid phase screening, and incubate at 37℃ for 1 h;

[0041] (4) Wash 3 times with PBS, add 100 μL of phage library bound to irrelevant GST antigen to each well of the ELISA plate coated with irrelevant GST antigen, perform solid-phase negative screening, and incubate at 37°C for 1 h.

[0042] (5) Wash 3 times with PBS, add 100 μL of phage library bound to irrelevant antigen GST to each well of the ELISA plate coated with S100B antigen, and incubate at 37°C for 1 h.

[0043] (6) Aspirate unbound phages, wash 6 times with PBST, and wash 2 times with PBS;

[0044] (7) Add 100 μL of Gly-HCl elution buffer and incubate at 37 °C for 8 min to elute the specifically bound phages; transfer the elution buffer to a 1.5 mL sterile centrifuge tube and quickly neutralize with 80 μL of Tris-HCl neutralization buffer;

[0045] (8) Take 10 μL for serial dilution, determine the titer, calculate the panning recovery rate, and mix the remaining eluents for amplification and purification for the next round of affinity panning.

[0046] Table 1 Affinity Selection Criteria

[0047]

[0048] Example 3

[0049] The steps for expanding the library after selection are as follows:

[0050] (1) Mix the washed eluent with 20 mL of E. coli TG1 culture in the early logarithmic growth phase, incubate at 37°C for 30 min, add 1 mL of 20% glucose, and incubate with shaking at 220 rpm for 30 min. Then, add M13KO7 bacteriophage and 4 μL of Escherichia coli (Amp) at a cell:phage ratio of 1:20. + ), 37℃, let stand for 30 min, then add 20 ml of 2YT liquid culture medium, shake at 220 r / min and incubate for 30 min;

[0051] (2) The culture was aliquoted into centrifuge tubes and incubated at 4°C, 5000r / min for 10 min. The cell pellet was resuspended in 50 mL of 2×YT-AK liquid medium and cultured overnight at 30°C with shaking at 250r / min.

[0052] (3) Centrifuge the overnight culture at 4°C and 10,000 r / min for 20 min, transfer the supernatant to a new centrifuge tube, add 1 / 5 volume of PEG-NaCl, mix well and place at 4°C for more than 2 h.

[0053] (4) 4℃, 10000r / min, 20min, remove the supernatant, resuspend the precipitate in 1mL PBS, add 1 / 5 volume of PEG / NaCl, mix well and place at 4℃ for more than 1h.

[0054] (5) 4℃, 12000r / min, 2min, remove the supernatant, suspend the precipitate in 200μL PBS, which is the amplification product. Measure the titer for the next round of screening or analysis.

[0055] Example 4

[0056] The identification and analysis of specific bacteriophage clones follow these steps:

[0057] The rescue of bacteriophage particles.

[0058] (1) From the plates of the eluent titers, 480 clones (numbered NB455-ANTI-S100B-1-480, of which 1-96 are from the second round and 97-480 are from the third round) were randomly selected from the S100B second and third round titer determination plates using sterile toothpicks and inoculated into 300 μl of 2×YT-A and cultured at 37℃ and 230 r / min for 8 h with shaking.

[0059] (2) Take 100 μL of the above culture, add M13K07 bacteriophage at a ratio of 1:20 of cells:bacteriophage, incubate at 37°C for 15 min, and then shake at 220 r / min for 45 min.

[0060] (3) Add 300 μL of 2×YT-AK, incubate at 30°C with vigorous shaking overnight.

[0061] (4) Centrifuge at 12,000 rpm for 2 min on the second day, take the supernatant and use it for monoclonal ELISA identification.

[0062] Identification of positive phage clones.

[0063] (1) Dilute the target molecule S100B antigen with carbonate buffer at pH 9.6 to a final concentration of 2 μg / mL, add 100 μL / well to each enzyme-labeled well, and coat overnight at 4°C;

[0064] (2) Discard the coating solution, wash 3 times with PBST, add 300 μL of 5% skim milk to each well, and block at 37°C for 1 h;

[0065] (3) Wash once with PBST, add 50 μL of phage culture supernatant and 50 μL of 5% skim milk to each well, and incubate at 37°C for 1 h;

[0066] (4) Wash 5 times with PBST, add horseradish peroxidase-labeled anti-M13 antibody (Huaan Biotechnology, catalog number: EM1902-19; ​​diluted with PBS at 1:10000), 100 μL / well, and incubate at 37℃ for 1 h;

[0067] (5) Wash the plate 6 times with PBST. Add TMB colorimetric solution, 100 μL / well, 37℃, 7 min. Add stop solution to stop the reaction, 50 μL / well. Measure the optical density at 450 nm.

[0068] S100B antigen affinity screening.

[0069] The enrichment was screened using the Gly-HCl acid elution method, and the enrichment levels during the screening process are shown in Table 2 below.

[0070] Table 2. Acid elution screening recoveries targeting S100B antigen.

[0071]

[0072] Recovery rate = Recovery amount / Library input amount;

[0073] Enrichment level = Recovery rate of the next round / Recovery rate of the previous round.

[0074] The specific single positive clones were screened using a phage enzyme-linked immunosorbent assay (ELISA) as follows:

[0075] (1) Using S100B antigen as the target molecule, the primary antibody was incubated with a 2-fold diluted phage supernatant. The specific phage was eluted using Gly-HCl acid elution. 480 clones (numbered NB455-ANTI-S100B-1-480, where 1-96 were from the second round and 97-480 were from the third round) were randomly selected from the S100B second and third round titer assay plates using a sterile toothpick. The antibody was then transferred to the antigen-coated ELISA plate.

[0076] (2) Wash away unbound antibodies with PBST, add mouse anti-M13 antibody HRP (Huaan Biotechnology, catalog number: EM1902-19), and incubate at 37℃ for 1h.

[0077] (3) Wash away unbound antibodies with PBST, add TMB colorimetric solution for color development, and read the absorbance value at 450nm wavelength on an ELISA reader.

[0078] (4) When the OD value of the sample well is more than 2.1 times greater than the OD value of the control well, it is judged as a positive clone well (Table 3).

[0079] (5) The bacteria in the positive clone wells were transferred to TB medium containing 100 μg / ml ampicillin, and plasmids were extracted and sequenced.

[0080] Based on the sequencing results, Vector was applied. 11.5 (Invitrogen, USA) and The software analyzes each clone and considers clones with the same CDR1, CDR2, and CDR3 sequences as the same clone, while clones with different sequences are considered different clones.

[0081] The gene sequences of S100B-positive clones were translated into amino acid sequences, and sequence alignment was performed. The gene sequences and amino acid sequences of the positive clones were then compared and analyzed using phylogenetic trees to determine the differences in amino acid composition at key sites among the positive clones, thus preliminarily identifying the similarities and differences in the epitopes targeted by the positive clones. Figure 3 ).

[0082] Table 3

[0083]

[0084]

[0085] According to the phage ELISA results, clones 104, 122, 132, 163, 346, and 379 out of 32 randomly selected positive clones showed good antigen recognition, with clone 163 being the best. The data results are shown in Table 3. The gene sequence of the anti-melanoma S100B nanobody of clone 163 is shown in SEQ ID No. 5, and the amino acid sequence of the VHH chain of the nanobody is shown in SEQ ID No. 4. Each nanobody molecule has two VHH chains. The amino acid sequence of the VHH chain consists of four frame regions (FRs) and three complementarity-determining regions (CDRs). The frame regions (FRs) include FR1 shown in SEQ ID No. 6, FR2 shown in SEQ ID No. 7, FR3 shown in SEQ ID No. 8, and FR4 shown in SEQ ID No. 9. The complementarity-determining regions (CDRs) include CDR1 shown in SEQ ID No. 1, CDR2 shown in SEQ ID No. 2, and CDR3 shown in SEQ ID No. 3.

[0086] Example 5

[0087] The prokaryotic expression of the anti-melanoma S100B nanobody followed these steps:

[0088] 1. Cloning

[0089] (1) Primer design

[0090] Primers were designed based on the gene sequence of the anti-melanoma S100B nanobody from clone 163. The specific sequences of the primers are shown in Table 4.

[0091] Table 4

[0092] Primers Sequence (5'-3') VHHF <![CDATA[AA ctgcag GAGGTGCAGGTGGTGGAGTC (underlined is the Pst I restriction site) VHHR <![CDATA[ATTT gcggccgc TGAGGAGACGGTGACCTGGG (underlined is the Not I restriction site)

[0093] (2) Amplification

[0094] Using the above-obtained positive clone of the anti-melanoma S100B nanobody as a template, the target fragment of the nanobody was amplified using VHHF and VHHR primers, yielding a 300bp gene sequence. Figure 2 As shown in Figure 4), the reaction program was: 95℃ for 5 min; 95℃ for 50 s, 64℃ for 45 s, 72℃ for 1 min; 72℃ for 10 min. The target fragment was purified and recovered using a gel extraction kit, ligated into the cloning vector pMD19T-simple, and then sent to a sequencing company for sequencing.

[0095] (3) The target fragment (pMD19T-simple plasmid containing the correctly sequenced fragment) and the pMECS prokaryotic expression vector were double-digested with enzymes. The target fragment and the linearized pMECS vector were then ligated to construct the VHH-pMECS recombinant vector, as shown in the diagram. Figure 4 As shown in the figure (marked as pMECS-S100B-163-VHH).

[0096] 2. Transformation

[0097] (1) Take the competent cells WK6 stored at -70℃, place them on ice to dissolve, add the recombinant vector in a clean bench, mix well, and then incubate on ice for 25 minutes.

[0098] (2) Turn on the electric shock device, set it to Manual, adjust the voltage to 2.1KV, and perform the electric shock.

[0099] (3) Add 1 ml of non-resistant LB liquid culture medium to the ultra-clean workbench and shake and culture on a shaker at 37°C for 1 h;

[0100] (4) Centrifuge at 5000 rpm for 5 min; discard the supernatant, resuspend the bacterial culture by pipetting, and spread it onto a plate containing Amp. + Incubate overnight at 37°C on resistant LB plates;

[0101] 3. Cultivate expression

[0102] (1) Expand the culture of the positive colonies with correct sequencing and inoculate them at a concentration of 1:100 into 200 ml of solution containing Amp. + In liquid LB medium, it was cultured with shaking on a shaker at 37°C;

[0103] (2) When the bacterial culture reaches an OD600 of 0.6, take out 1 ml of bacterial culture and mark it as 0h. Add 100 mM IPTG to 200 ml of culture medium at a ratio of 1:100 and continue culturing;

[0104] (3) Every 2 hours, take 1 ml from 200 ml of bacterial culture, repeat 4 times, and label them as 2, 4, 6, and 8 respectively;

[0105] (4) Centrifuge at 12000 rpm for 1 min, discard the supernatant, add 15 μL of 1×SDS loading buffer, mix the sample thoroughly, boil in a water bath for 10 min, then in an ice bath for 2 min, centrifuge at 12000 rpm for 5 min, and store at -20℃.

[0106] 4. Expression detection

[0107] (1) Prepare an SDS-PAGE electrophoresis gel with a separating gel of 12% and a stacking gel of 5%;

[0108] (2) Add 1× electrophoresis buffer to the electrophoresis tank, place the prepared gel into the electrophoresis tank, and add the sample and protein marker. The initial voltage is 80V. When the upper stacking gel presses the sample into a straight line, adjust the voltage to 120V. Stop electrophoresis when the bromophenol blue dye migrates to the bottom of the gel.

[0109] (3) Take out the gel and place it in a glass petri dish. Add enough Coomassie brilliant blue staining solution to cover the gel and stain on a shaker at 70 rpm for 1-2 hours.

[0110] (4) Discard the Coomassie brilliant blue staining solution, add decolorizing solution and decolorize on a shaker;

[0111] (5) Place the decolorized protein gel under a gel imaging system to observe protein expression and take pictures;

[0112] (6) The results are as follows Figure 5 As shown, lane 1 represents the result before purification, lane 2 represents the result after purification, and the arrows indicate that the target protein was expressed.

[0113] Example 6

[0114] The binding steps of the anti-melanoma S100B nanobody to natural melanoma A375 and B16F10WB are as follows:

[0115] (1) Prepare an SDS-PAGE electrophoresis gel with a separating gel of 12% and a stacking gel of 5%;

[0116] (2) Add 1× electrophoresis buffer to the electrophoresis tank, place the prepared gel into the electrophoresis tank, and add the sample and protein marker. The initial voltage is 80V. When the upper stacking gel presses the sample into a straight line, adjust the voltage to 120V. Stop electrophoresis when the bromophenol blue dye migrates to the bottom of the gel.

[0117] (3) Cut the PVDF membrane to the size of the gel, then activate it with methanol for more than 10 seconds. Immerse the clamping plate, sponge, filter paper, and membrane in the transfer solution, with the black clamping plate at the bottom, two layers of filter paper → gel → membrane → two layers of filter paper. Install the transfer apparatus and add transfer solution until full. Adjust the current to 180mA and transfer for 30 minutes (constant current). Fill the container with ice. When all the strips on the gel have been transferred to the membrane and the gel is colorless, the transfer is successful.

[0118] (4) Prepare 5% skim milk powder, take out the membrane and put it into the above sealing solution and slowly shake it at room temperature for 2 hours. After 2 hours, discard the sealing solution and wash it 3 times with 1×TBST for 10 minutes each time.

[0119] (5) Prepare the primary antibody (anti-melanoma S100B nanobody diluted 1:100) with 1×TBST, incubate at room temperature with slow shaking for 2h, and then recover the primary antibody and wash it 3 times with 1×TBST for 10min each time.

[0120] (6) Prepare secondary antibody with 1×TBST, dilute Anti-6×His antibody 1:5000, incubate slowly at room temperature for 2h, and after 2h, recover the secondary antibody and wash 3 times with 1×TBST for 10min each time.

[0121] (7) Prepare the developing solution, develop and expose the product, and the result is shown in the figure. Figure 6 ). Figure 6 The image shows the Western blotting (WB) results of the anti-S100B nanobody from clone 163 binding to natural melanoma A375 and B16F10 cells. In the image, 1 represents recombinant S100B, 2 represents A375, and 3 represents B16F10. This indicates that the nanobody screened for recombinant S100B protein in melanoma exhibits high affinity for natural melanoma A375 and B16F10 cells and can be used to prepare melanoma detection kits.

[0122] This invention has been described in conjunction with the preferred embodiments. However, after reading the above description of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A nanobody against melanoma S100B, characterized in that, The nanobody includes a heavy chain variable region, which comprises a complementarity-determining region (CDR1), a complementarity-determining region (CDR2), and a complementarity-determining region (CDR3), with the following amino acid sequences: Complementary determinant region CDR1: GFTFSNYA; Complementary Determinant Region CDR2: ITTLGSFT; Complementary determinant region CDR3: NAPRVRGSTNY.

2. The anti-melanoma S100B nanobody according to claim 1, characterized in that, The amino acid sequence of the heavy chain variable region is shown in SEQ ID No.

4.

3. The anti-melanoma S100B nanobody according to claim 1, characterized in that, This includes one of the aforementioned heavy chain variable regions.

4. A gene characterized in that, The nanobody as described in any one of claims 1 to 3 is encoded.

5. The gene according to claim 4, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No.

5.

6. A recombinant expression vector, characterized in that, It contains the gene described in claim 4.

7. A genetically engineered cell, characterized in that, It is obtained by introducing the recombinant expression vector of claim 6 into a host cell.

8. The genetically engineered cell according to claim 7, characterized in that, The host cell is Escherichia coli, yeast, or CHO cell.

9. The use of the nanobody according to any one of claims 1 to 3 in the preparation of a melanoma detection kit.

Images