A DNA-intercalating fluorescence quenching compound, its preparation method and application

Abstract

This invention belongs to the field of compound technology and provides a DNA-intercalating fluorescent quenching compound, its preparation method, and its application. This invention provides a DNA-intercalating fluorescent quenching compound that exhibits absorption in the visible light region and certain DNA sequence selectivity. The DNA-intercalating fluorescent quenching compound provided by this invention can be further used to design fluorescence analysis systems for restriction endonuclease EcoRV and DNases. The DNA-intercalating quenching compound can achieve relevant fluorescence analysis by combining with fluorescent molecules in a covalent-free manner, reducing the need for chemical labeling steps, thereby improving efficiency and reducing detection costs, and showing good application prospects in related analyses.

Description

Technical Field

[0001] This invention relates to the field of compound technology, and more specifically, to a DNA-intercalating fluorescence quenching compound, its preparation method, and its application. Background Technology

[0002] Fluorescence quenching compounds are a class of compounds containing groups that reduce the luminescence intensity of fluorescent molecules. Currently, the working principle of widely used small-molecule fluorescence quenching compounds is mainly through fluorescence resonance energy transfer (FRET) to quench neighboring fluorescent molecules. Specifically, the quenching group accepts energy from the excited state of the fluorescent molecule and then releases this energy in a non-radiative form, thereby reducing the efficiency of fluorescence emission. The fluorescence quenching effect based on the FRET mechanism has been widely used in fluorescence imaging, fluorescence analysis, and other fields, such as quantitative PCR (qPCR) based on oligonucleotide fluorescent probes (TaqMan probes). Common fluorescence quenching groups include the BHQ series (BHQ-1 / 2 / 3) molecules, the Eclipse quenching group, and a few others such as Dabcyl (azobenzoic acid) quenchers that can quench blue fluorescence. It is evident that the variety and quantity of fluorescence quenching compounds are currently limited, making it difficult to meet the needs of fluorescence analysis. Furthermore, quenching compounds used in quantitative PCR do not have DNA intercalation capabilities; these quenching compounds and their corresponding fluorescent molecules need to be covalently coupled with oligonucleotides to form FRET-based nucleic acid probes before they can be used for fluorescence analysis.

[0003] Therefore, there is an urgent need to develop a fluorescence quenching compound with DNA intercalation capability that can be used to construct probes with sequence identification ability and excellent flexibility for fluorescence analysis without covalent labeling. Summary of the Invention

[0004] This invention aims to solve at least one of the technical problems existing in the prior art. To this end, this invention proposes a DNA-intercalating fluorescence quenching compound, its preparation method, and its application. The DNA-intercalating fluorescence quenching compound provided by this invention exhibits absorption in the visible light region, possesses a certain degree of DNA sequence selectivity, and can form FRET with fluorescent dyes for fluorescence analysis without chemical labeling, thereby improving detection efficiency and reducing costs.

[0005] A first aspect of the present invention provides a DNA-intercalating fluorescence quenching compound.

[0006] Specifically, a DNA-intercalating fluorescence quenching compound has any one of the structural formulas shown in Formulas I-IV:

[0007]

[0008] The fluorescent quenching compounds (Quinoline-based Quenchers, abbreviated as QQ-1, QQ-2, QQ-3, and QQ-4, corresponding to compounds of formulas I-IV, respectively) provided by this invention use an N-methylquinoline group as an electron acceptor, which is connected to a charged N,N-dimethyl aromatic ring via a double bond to form a conjugated system with a quinoline backbone structure. These fluorescent quenching compounds have absorption in the visible light region but lack fluorescence properties, and all exhibit certain DNA sequence selectivity. When the fluorescent quenching compound binds to AT DNA double strands, the absorption spectrum shows a significant red shift, and the solution changes from reddish-purple to blue. The fluorescent quenching compounds provided by this invention have DNA intercalation capabilities. These compounds can not only be used as fluorescent quenching reagents for nucleic acid PCR detection, but also have DNA binding ability, which can stabilize the DNA double strands formed by the primer and the amplification template, thereby enhancing the melting temperature (Tm value) of the probe. This binding ability makes these quenching groups function similarly to the minor groove binding group (MGB) of DNA double strands, thus enabling shorter probe designs and providing better sequence identification and flexibility. Furthermore, DNA-intercalating quenching compounds can be paired with fluorescent molecules in a covalent-free manner to achieve related fluorescence analysis. This design can reduce the steps of chemical labeling, thereby improving efficiency and reducing detection costs.

[0009] A second aspect of the present invention provides a method for preparing a DNA-intercalating fluorescence quenching compound.

[0010] A method for preparing a DNA-intercalating fluorescence quenching compound includes the following steps:

[0011] The DNA-intercalating fluorescence quenching compound was prepared by condensing an aromatic aldehyde compound with N-methylquinoline under alkaline conditions.

[0012] Preferably, the aromatic aldehyde compound has any one of the following structural formulas:

[0013]

[0014] Preferably, the condensation reaction occurs under alkaline conditions with a pH value ≥ 10.

[0015] Preferably, the aromatic aldehyde compound and N-methylquinoline are dissolved in a solvent, an organic base is added to bring the pH value to ≥10, and then a condensation reaction is carried out to obtain the DNA intercalation fluorescent quenching compound.

[0016] Preferably, the temperature of the condensation reaction is 40-60°C, and / or the time of the condensation reaction is 1-10 hours.

[0017] Preferably, the solvent is at least one of acetonitrile, toluene, and N,N-dimethylformamide (DMF).

[0018] Preferably, the organic base is at least one of pyrrolidine, piperidine, and methylpiperazine.

[0019] Preferably, after the condensation reaction is completed, the mixture is further cooled to room temperature, the solvent is removed, and the mixture is purified by chromatography to obtain the DNA-intercalated fluorescence quenching compound.

[0020] Preferably, a rotary evaporator is used to remove the solvent.

[0021] Preferably, the chromatographic purification uses a mixture of methanol and dichloromethane as the eluent and is performed by silica gel column chromatography to obtain the DNA-intercalating fluorescence quenching compound.

[0022] A third aspect of the present invention provides an application of a DNA-intercalating fluorescence quenching compound.

[0023] Application of a DNA-intercalating fluorescence quenching compound in label-free fluorescence analysis and nuclease fluorescence analysis.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] This invention provides a DNA-intercalating fluorescent quenching compound having any one of the structural formulas shown in Formulas I-IV. It exhibits absorption in the visible light region and a certain degree of DNA sequence selectivity. When the fluorescent quenching group binds to the AT DNA double strand, its absorption spectrum shows a significant red shift, and the solution changes from reddish-purple to blue. The DNA-intercalating fluorescent quenching compound provided by this invention can be further used to design fluorescence analysis systems for restriction endonuclease EcoRV and DNase. The DNA-intercalating quenching compound can achieve relevant fluorescence analysis by combining with fluorescent molecules in a covalent-free manner. It can form FRET with fluorescent dyes for fluorescence analysis without chemical labeling, reducing the chemical labeling steps, thereby improving efficiency and reducing detection costs. It has good application prospects in related analyses. Attached Figure Description

[0026] Figure 1 QQ-1 of Example 1 1 1H-NMR (H-NMR) spectrum;

[0027] Figure 2 QQ-1 of Example 1 13 C-NMR (carbon nuclear magnetic resonance) spectrum;

[0028] Figure 3 For example, QQ-2 of Example 2 1H-NMR spectrum;

[0029] Figure 4 For example, QQ-2 of Example 2 13 C-NMR spectrum;

[0030] Figure 5 For example, QQ-3 of Example 3 1 H-NMR spectrum;

[0031] Figure 6 For example, QQ-4 of Example 4 1 H-NMR spectrum;

[0032] Figure 7 For example, QQ-4 of Example 4 13 C-NMR spectrum;

[0033] Figure 8 For Comparative Example 1, PQ-1 1 H-NMR spectrum;

[0034] Figure 9 The diagram shows the results of QQ-1, QQ-2, QQ-3, QQ-4, and PQ-1 binding with different DNA molecules.

[0035] Figure 10 Schematic diagram and results of a label-free fluorescence analysis method using DNA-intercalating fluorescence quenching compounds;

[0036] Figure 11 A schematic diagram and results are shown for the design of a fluorescence analysis system for nucleases using DNA-intercalating fluorescent quenching compounds. Detailed Implementation

[0037] To enable those skilled in the art to more clearly understand the technical solutions described in this invention, the following embodiments are provided for illustration. It should be noted that the following embodiments do not constitute a limitation on the scope of protection claimed by this invention.

[0038] Unless otherwise specified, the raw materials, reagents or devices used in the following examples are available from conventional commercial sources or can be obtained by existing known methods.

[0039] Example 1

[0040] A DNA-intercalating fluorescence quenching compound (QQ-1) has the following structural formula as shown in Formula I:

[0041]

[0042] The preparation method of the above-mentioned DNA-intercalated fluorescence quenching compound (QQ-1) includes the following steps:

[0043] 0.67 mmol of aromatic aldehyde (compound numbered 1A in the following reaction equation) and 0.67 mmol of N-methylquinoline (compound numbered 2 in the following reaction equation) were dissolved in 5 mL of acetonitrile (MeCN), and then 1.00 mmol of organic base (Base) methylpiperazine was added to obtain the reaction solution. The reaction solution was heated to 50 °C and stirred at this temperature to carry out the condensation reaction for 4 h. After the condensation reaction was completed, the reaction solution was cooled to room temperature, and the organic solvent was removed by rotary evaporation to obtain the crude product. QQ-1 was purified by silica gel column chromatography using a methanol / dichloromethane (v / v) mixture as the eluent. The structural characterization of product QQ-1 is shown in [reference needed]. Figure 1 and Figure 2 (Yield: 87%) 1 H NMR (400MHz, DMSO-d6) δ8.45-8.40(m,2H),8.22-8.16(m,2H),8.04-8.02(m,1H),7.93-7.89(m, 1H),7.67-7.63(m,2H),6.56(d,J=14.4Hz,1H),6.39(d,J=4.6Hz,1H),4.16(s,3H),3.21(s,6H). 13 C10 NMR (100MHz, DMSO-d6) δ 169.30, 155.17, 142.04, 139.78, 139.31, 133.71, 129.86, 126.98, 125.94, 124.87, 119.85, 118.20, 108.00, 105.29, 42.81, 38.06. High-resolution mass spectrometry (HRMS (ESI)) m / z: [M] + Calcd for C18H19N2S + 295.1269; Found 295.1280.

[0044] The synthesis reaction equation for QQ-1 is as follows:

[0045]

[0046] Example 2

[0047] A DNA-intercalating fluorescence quenching compound (abbreviated as QQ-2) has the following structural formula as shown in Formula II:

[0048]

[0049] The preparation method of the above-mentioned DNA-intercalated fluorescence quenching compound (QQ-2) differs from that of Example 1 in that the aromatic aldehyde is replaced with the compound numbered 1B in the following reaction equation. The structural characterization of product QQ-2 is shown in [reference needed]. Figure 3 and Figure 4 (yield 85%) 1 H NMR(400MHz, DMSO-d6)δ8.17(d,J=9.4Hz,1H),8.06-8.02(m,2H),7.90(d,J=7.7Hz,1H),7.84-7.79 (m,2H),7.55-7.51(m,2H),6.45(d,J=14.0Hz,1H),6.11(d,J=4.4Hz,1H),4.04(s,3H),3.22(s,6H). 13 C NMR(100MHz,DMSO-d6)δ166.04,153.94,140.00,137.78,133.21,129.61,126 .14,125.31,119.67,117.59,100.73,96.26,38.60,37.32.HRMS(ESI)m / z:[M] + Calcd for C18H19N2O + 279.1497; Found 279.1503.

[0050] The synthesis reaction equation for QQ-2 is as follows:

[0051]

[0052] Example 3

[0053] A DNA-intercalating fluorescence quenching compound (QQ-3) has the following structural formula (as shown in Formula III):

[0054]

[0055] The preparation method of the above-mentioned DNA-intercalated fluorescence quenching compound (QQ-3) differs from that in Example 1 in that the aromatic aldehyde is replaced with the compound numbered 1C in the following reaction equation. The structural characterization of the product QQ-3 is shown in [link to example]. Figure 5 (yield 81%) 1 H NMR (400MHz, DMSO-d6) δ8.80(d,J=8.9Hz,1H),8.50(d,J=9.2Hz,1H),8.42(d,J=8.9Hz,1H),8.27-8.22(m,2H),8.10-8.0 6(m,1H),7.86-7.82(m,3H),7.54(d,J=15.4Hz,1H),6.80(d,J=8.8Hz,2H),4.44(s,3H),3.07(s,6H).HRMS(ESI)m / z:[M] +Calcd for C20H21N2 + 289.1705; Found 289.1717.

[0056] The synthesis reaction equation for QQ-3 is as follows:

[0057]

[0058] Example 4

[0059] A DNA-intercalating fluorescence quenching compound (QQ-4) has the following structural formula as shown in Formula IV:

[0060]

[0061] The preparation method of the above-mentioned DNA-intercalated fluorescence quenching compound (QQ-4) differs from that of Example 1 in that the aromatic aldehyde is replaced with the compound numbered 1D in the following reaction equation. The structural characterization of the product QQ-4 is shown in [reference needed]. Figure 6 and Figure 7 (yield 85%) 1 H NMR(400MHz, DMSO-d6)δ8.88(d,J=9.1Hz,1H),8.55-8.46(m,3H),8.29-8.26(m,3H),8.14-8.09(m ,1H),7.90-7.86(m,1H),7.63(d,J=15.5Hz,1H),6.84(d,J=9.1Hz,3H),4.48(s,3H),3.17(s,6H). 13 C NMR (100MHz, DMSO-d6) δ160.25,156.75,153.23,146.52,142.99,139.64,136.41,134.83,130. 35,128.79,127.53,120.75,119.58,119.48,113.55,107.01,40.66,38.19.HRMS(ESI)m / z:[M] + Calcd for C19H20N3 + 290.1657; Found 290.1664.

[0062] The synthesis reaction equation for QQ-4 is as follows:

[0063]

[0064] Comparative Example 1

[0065] A pyridine-based fluorescence quencher compound (PQ-1) has the structural formula shown in Formula VI below, and its preparation method is as follows:

[0066] 0.92 mmol of p-dimethylaminebenzaldehyde (compound number 1C in the reaction equation) and 0.92 mmol of 2-methylpyridine (compound number 3 in the reaction equation) were dissolved in 5 mL of acetonitrile, and then 1.39 mmol of methylpiperazine was added to obtain the reaction solution. The reaction solution was stirred at 50 °C for 4 h, and the solvent was removed by rotary evaporation after cooling to room temperature. The crude product was purified by silica gel column chromatography using a methanol / dichloromethane (v / v) mixture as the eluent to give PQ-1 (yield 92%). The structure of product PQ-1 is shown in [reference needed]. Figure 8 (yield 91%):1H NMR (400MHz, DMSO-d6) δ8.76-8.74(m,1H),8.46-8.43(m,1H),8.36-8.32(m,1H),7.92(d,J=15.8Hz,1H),7.73- 7.69(m,3H),7.24(d,J=15.7Hz,1H),6.80(d,J=9.0Hz,2H),4.29(s,3H),3.04(s,6H).HRMS(ESI)m / z:[M]+Calcd for C16H19N2+239.1548; Found 239.1550.

[0067] The synthesis reaction equation for PQ- is as follows:

[0068]

[0069] Product effectiveness test

[0070] 1. Spectroscopic testing of the binding of fluorescence quenching compounds to DNA

[0071] The DNA sequences used in the tests are shown in Table 1, where each single-stranded DNA contains 18 bases. Due to the difficulty in synthesizing long-chain polyG, short chains of 6 G were used as a substitute. During the tests, the molar concentration of mononucleotides in all test systems was kept consistent to ensure comparability of experimental results. The test method is as follows: Fluorescence quenching compound solutions (quenchers) for QQ-1, QQ-2, QQ-3, QQ-4, and PQ-1, and single-stranded DNA solutions were prepared using phosphate-buffered saline (PBS, pH 7.4). The concentration of the fluorescence quencher was 20 μM, and the concentration of the single-stranded DNA solution was 40 μM (based on the molar concentration of the nucleoside). Following the combinations shown in Table 1, equal volumes of the two single-stranded DNA solutions were mixed to prepare a double-stranded DNA solution (40 μM). Then, the quencher solution was mixed with equal volumes of the single-stranded DNA solution and the double-stranded DNA solution, respectively. The final concentrations of the quencher and DNA in the test systems were 10 μM and 20 μM, respectively. After equilibration at room temperature for 10 min, the absorption spectrum was scanned using a microplate reader.

[0072] Table 1. DNA sequences used in spectral testing

[0073]

[0074] The results are as follows Figure 9 (a)- Figure 9 As shown in (e), the spectral peaks are uniformly normalized to 1 for easy labeling. Figure 9 (a)- Figure 9 (e) shows the absorption spectra of QQ-1, QQ-2, QQ-3, QQ-4, and PQ-1 after reacting with different DNAs. The results show that the fluorescence quenching compounds QQ-1, QQ-2, QQ-3, and QQ-4 exhibit significant red shifts in their absorption spectra after mixing with polyA-T (double-stranded DNA composed of polyA and polyT). QQ-1 and QQ-2, when mixed with polyAT repeat sequences, showed similar red shifts to the polyA-T system. The mixtures of QQ-3 and QQ-4 with polyA-T also showed significant red shifts, but the red shift with polyAT sequences was not significant. All quinoline-based fluorescence quenching compounds did not respond to single-stranded DNA, nor did they show significant responses to GC double-stranded DNA. QQ-1 and QQ-2 showed good selectivity for AT-enriched DNA double strands, while QQ-3 and QQ-4 only showed good responses to double-stranded DNA composed of polyA and polyT. Figure 9(e) It is evident that Comparative Example 1 prepared a pyridine-based fluorescence quenching compound, PQ-1, by replacing quinoline with pyridine, which has a smaller molecular weight and molecular volume. PQ-1 showed only a weak spectroscopic change when mixed with various DNAs. These results indicate that the DNA-intercalating fluorescence quenching compounds QQ-1 to QQ-4 of the present invention possess a certain degree of DNA sequence selectivity.

[0075] Table 2. Changes in peak absorption wavelengths of various fluorescence quenching compounds before and after binding to polyA-T double-stranded DNA.

[0076]

[0077] Table 2 shows the spectral shifts of QQ-1, QQ-2, QQ-3, QQ-4, and PQ-1 before and after binding with polyA-T double strands. It can be seen that the shifts of QQ-1 to QQ-4 reach 21 nm, 16 nm, 32 nm, and 20 nm, respectively, while the shift of PQ-1 is only 5 nm. This indicates that the quinoline structure in compounds QQ-1 to QQ-4 is crucial to the DNA response performance of this type of quencher. The DNA response performance of quencher PQ-1, constructed using pyridine with a smaller molecular weight and volume, is significantly reduced. These results demonstrate that a relatively large molecular volume of the electron-withdrawing group may facilitate the stable binding of the quencher with AT-enriched DNA double strands. In Table 2, "Quencher only" represents a single quencher, and "Quencher+AT" represents the binding of the quencher with the double-stranded polyA-T.

[0078] Figure 9 (f) shows the color change after QQ-1 binds to DNA. It can be seen that after QQ-1 binds to polyA-T and polyAT respectively, its color changes from reddish-purple to blue, and the color change is highly distinguishable to the naked eye. Therefore, QQ-1 has good application prospects in colorimetric detection visible to the naked eye.

[0079] 2. DNA-intercalating fluorescence quenching compounds for label-free fluorescence analysis

[0080] Because the DNA-intercalating fluorescence quenching compound provided by this invention can be intercalated into DNA and has good sequence selectivity, label-free fluorescence analysis can be achieved by introducing specific DNA sequences into the detection system. The following is one application example:

[0081] Design a label-free system for the fluorescent detection of the DNA restriction endonuclease EcoR V. The detection method is as follows: Figure 10 (a)- Figure 10 (b), Figure 10 (a) is a schematic diagram of a DNA sequence; Figure 10(b) The FRET pair formed by QQ-1 and DOX is used for the fluorescence analysis of EcoR V. The detection principle is as follows: QQ-1 is inserted into a DNA sequence (polyA-T), doxorubicin (DOX) is inserted into a DNA sequence, and the recognition and restriction site of EcoR V is constructed into a DNA segment. DOX is a known fluorescent molecule with GC sequence selective binding ability, and its emission wavelength peaks at around 600 nm. Its fluorescence spectrum overlaps well with the absorption spectrum of the QQ-1 / DNA complex, and DOX / QQ-1 can form an ideal FRET pair. When QQ-1 and DOX bind to their respective sequences, the fluorescence of DOX is quenched through the FRET mechanism, so the detection system exhibits a weak fluorescence state. When EcoR V selectively cleaves the DNA double strand at the restriction site, the spatial distance between QQ-1 and DOX increases significantly, thereby inhibiting energy transfer and allowing the fluorescence of DOX to be released, resulting in enhanced fluorescence.

[0082] The specific operation process is as follows:

[0083] In PBS 7.4 buffer, equal volumes of DNA single strand 1 (AAAAAAAAGATATCGCGGCGGC) and complementary strand 2 (TTTTTTTTCTATAGCGCCGCCG) were mixed to prepare a DNA double-stranded solution (nucleoside concentration 40 μM). 75 μL of this DNA double-stranded solution was then mixed with 75 μL of DOX solution (16 μM) to obtain a mixed solution. The mixed solution was incubated at 70 °C for 1 min, then cooled to room temperature. The DNA-DOX complex was then prepared. A QQ-1 stock solution was prepared using DMSO. A small amount of the QQ-1 stock solution was added to the DNA-DOX solution to bring the final QQ-1 concentration to 8 μM. After vortexing to mix, the mixture was allowed to stand for 10 min. The label-free fluorescent assay system DNA-DOX-QQ-1 for detecting EcoR V was thus prepared (see [link to PBS]). Figure 10 (b) During detection, the reaction system was prepared by adding samples in the following order and volume ratio on ice in accordance with the EcoR V kit instructions: ddH2O (double-distilled water): 10×cut buffer: DNA-DOX-QQ-1: EcoR V = 16:3:10:1. The enzyme digestion reaction was carried out at 37℃. After incubation for a certain period of time, the reaction solution was heated to 80℃ and held for 20 minutes to inactivate the enzyme. After cooling to room temperature, the fluorescence was ready for spectral detection. The fluorescence excitation wavelength was 480nm, and the spectrum was acquired using a multi-functional microplate reader.

[0084] The results are as follows Figure 10 As shown in (c) Figure 10(c) This diagram shows the changes in the fluorescence spectrum of the analytical system during the EcoR V enzymatic digestion reaction (fluorescence excitation wavelength is 480 nm). The results show that the DNA-DOX-QQ-1 system can indeed detect EcoR V. As the enzyme digestion time increases, the fluorescence of DOX gradually recovers. The label-free fluorescence analysis system constructed using the fluorescence quenching compound provided in this invention is also applicable to the analysis of other nucleases, demonstrating excellent scalability.

[0085] 3. Nuclease fluorescence analysis based on DNA intercalation-type fluorescence quenching compounds

[0086] Nucleases are enzymes that cleave double-stranded DNA, ultimately producing nucleotide monomers or short DNA fragments. DNases can recognize and cleave almost all double-stranded DNA with high efficiency. However, even trace amounts of DNase can affect nucleic acid detection methods such as PCR, and this enzyme can easily be introduced into the detection process through consumables such as PCR tubes. Therefore, nuclease detection of PCR tubes and other consumables is of significant practical importance. Furthermore, in PCR, to eliminate DNA contamination in consumables, PCR tubes and other consumables are typically enzymatically digested with DNase, followed by washing to remove the DNase. Whether the DNase has been inactivated or completely removed also depends on rapid DNase detection.

[0087] Fluorescence assays are currently important methods for nuclease detection. For example, FRET-based fluorescence analysis can be achieved by simultaneously introducing fluorescent labels and fluorescence quenchers onto the DNA strand. However, the construction of such analytical systems requires chemical covalent modification of the DNA fragment with fluorescent and quencher groups, respectively. Using the DNA-intercalating fluorescence quencher compound provided in this invention, the chemical covalent modification step can be omitted, thereby reducing costs and improving efficiency. The DNase detection system based on QQ-1 is designed as follows: Figure 11 As shown in (a) and Table 3, a fluorescently labeled polyA single strand is combined with an unlabeled polyT strand to form a double strand. Here, the rhodamine derivative TAMRA, whose fluorescence spectrum highly overlaps with the absorption spectrum of QQ-1, is selected for polyA modification. When QQ-1 is added, its insertion into the AT double strand quenches the fluorescence of TAMRA. The FRET effect is eliminated during DNase-catalyzed DNA hydrolysis, thus enabling fluorescence-activated detection.

[0088] Table 3 shows the TAMRA-tagged polyA and untagged polyT sequences used in the test.

[0089]

[0090] Figure 11 (b) shows the fluorescence activation of the QQ-1-based DNase detection system for DNase activity detection (fluorescence excitation wavelength: 546 nm). The results show that the fluorescence activation gradually increases with the incubation time with DNase, indicating that the system can indeed indicate DNase activity through fluorescence activation. These results demonstrate that the fluorescence analysis system based on the DNA-intercalating fluorescence quencher compound (QQ-1) can reduce chemical labeling steps, shorten time, and save costs, showing great promise for related detection applications.

[0091] In summary, the DNA-intercalating fluorescent quenching compounds QQ-1 to QQ-4 of this invention have absorption in the visible light region but lack fluorescence properties, exhibiting certain DNA sequence selectivity. Specifically, when the fluorescent quenching group QQ-1 binds to the AT DNA double strand, its absorption spectrum shows a significant red shift, and the solution changes from reddish-purple to blue. Using the fluorescent quenching compound QQ-1 as an intercalating quenching compound, a fluorescence analysis system for the restriction endonuclease EcoRV and DNase was designed. The results indicate that this type of intercalating fluorescent quenching compound has good application prospects in related analyses.

Claims

1. Application of DNA intercalation-type fluorescent quenching compounds in label-free fluorescence analysis and label-free nuclease fluorescence analysis, wherein the DNA intercalation-type fluorescent quenching compound is a quencher, and the label-free fluorescence analysis and label-free nuclease fluorescence analysis utilize AT-enriched DNA double strands, wherein the DNA intercalation-type fluorescent quenching compound has any one of the following structural formulas I-II: Formula I Formula II.

2. The application according to claim 1, characterized in that, The preparation method of the DNA-intercalated fluorescence quenching compound includes the following steps: The DNA-intercalating fluorescence quenching compound was prepared by condensing an aromatic aldehyde compound with N-methylquinoline under alkaline conditions.

3. The application according to claim 2, characterized in that, The aromatic aldehyde compound has any one of the following structural formulas: 、 。 4. The application according to claim 2, characterized in that, The condensation reaction occurs under alkaline conditions with a pH value ≥ 10.

5. The application according to claim 4, characterized in that, An aromatic aldehyde compound and N-methylquinoline were dissolved in a solvent, an organic base was added to bring the pH to ≥10, and then a condensation reaction was carried out to obtain the DNA-intercalating fluorescence quenching compound.

6. The application according to claim 2, characterized in that, The condensation reaction is carried out at a temperature of 40-60°C and / or for a time of 1-10 hours.

7. The application according to claim 5, characterized in that, The solvent is at least one of acetonitrile, toluene, and N,N-dimethylformamide.

8. The application according to claim 5, characterized in that, The organic base is at least one of pyrrolidine, piperidine, and methylpiperazine.

9. The application according to claim 2, characterized in that, After the condensation reaction is completed, the mixture is cooled to room temperature, the solvent is removed, and the mixture is purified by chromatography to obtain the DNA intercalation-type fluorescence quenching compound. The chromatography purification uses a mixture of methanol and dichloromethane as the eluent and is performed by silica gel column chromatography to obtain the DNA intercalation-type fluorescence quenching compound.

Images