Universal cell expressing stc1 and method for preparing the same

Abstract

The present application provides a universal cell expressing STC1 and a preparation method thereof. The universal pluripotent cell can significantly reduce or escape the recognition and attack of the immune system, especially the attack of T cells, natural killer cells, macrophages and the like, while not changing the stem cell update and differentiation characteristics.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and stem cell technology, and particularly relates to a universal cell expressing STC1 and a preparation method thereof. BACKGROUND

[0002] Stem cells are a class of cells with self-renewal ability and differentiation ability to specific functional cells. According to the degree of stem cell characteristics, stem cells are mainly divided into: totipotent stem cells, pluripotent stem cells and adult stem cells. Induced pluripotent stem cells (iPSC) have the potential of unlimited proliferation, self-renewal and differentiation into various types of cells, and have important application prospects in the treatment of cancer, neurological, cardiovascular and other diseases. However, the key problems of immune incompatibility and immune rejection of transplanted cells hinder the clinical application of transplanted allogeneic functional cells for treatment.

[0003] Human major histocompatibility complex (MHC), also known as human leukocyte antigen (HLA), is the main cause of immune incompatibility. MHC is composed of a series of genes and can be divided into class I, class II and class III. MHC-I genes are expressed in almost all tissue cell types, and transplanted cells expressing "non-self" MHC class I molecules will stimulate the activation of CD8+ T cells and be eliminated. CD4+ helper T cells recognize "non-self" cells of MHC-II genes, thereby causing immune rejection, and III class molecules do not participate in immune activities.

[0004] In recent years, it has been reported that by knocking out B2M, CIITA and other genes, the expression of MHC-I and MHC-II cell surface or itself genes can be deleted, thereby making the cells immune tolerant or escaping T cell / B cell specific immune response, and producing immune compatible universal pluripotent stem cells.

[0005] It has been reported that on the basis of destroying the expression of MHC-I and MHC-II class genes, the cells can express HLA-E / G and other non-classical HLA-I class molecules, or express PD-L1, CTLA4-Ig, CD47, CD24 and other immune inhibitory checkpoint proteins, which can effectively escape the killing of NK cells (WO2021041316 A1). SUMMARY

[0006] In one aspect, the present application provides a hypoimmunogenic pluripotent stem cell comprising: reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to a parental pluripotent stem cell; reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and reduced susceptibility to NK cell killing compared to the parental pluripotent stem cell, wherein the reduced susceptibility to NK cell killing is caused by increased expression of STC1 protein.

[0007] In some embodiments, the MHC-I function is reduced by reducing the activity of an MHC class I protein or an MHC-I transcriptional regulator.

[0008] In one embodiment, the MHC-I function is reduced by reducing the activity of a B2M protein.

[0009] In one embodiment, the B2M protein is a human B2M protein comprising an amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence that is 90% identical to the amino acid sequence set forth in SEQ ID NO: 1.

[0010] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC class II protein or an MHC-II transcriptional regulator.

[0011] In one embodiment, the MHC-II function is reduced by reducing the activity of a CIITA protein.

[0012] In one embodiment, the CIITA protein is a human CIITA protein comprising an amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence that is 90% identical to the amino acid sequence set forth in SEQ ID NO: 2.

[0013] In some embodiments, the STC1 protein is a human STC1 protein comprising an amino acid sequence set forth in SEQ ID NO: 3 or an amino acid sequence that is 90% identical to the amino acid sequence set forth in SEQ ID NO: 3.

[0014] In one embodiment, the hypoimmunogenic pluripotent stem cell comprises one or more alterations that reduce endogenous B2M protein activity; one or more alterations that reduce endogenous CIITA protein activity; and one or more alterations that result in increased STC1 protein expression in the hypoimmunogenic pluripotent stem cell.

[0015] In one embodiment, the hypoimmunogenic pluripotent stem cell comprises one or more alterations that inactivate both alleles of an endogenous B2M gene; one or more alterations that inactivate both alleles of an endogenous CIITA gene; and one or more alterations that result in increased STC1 gene expression in the hypoimmunogenic pluripotent stem cell.

[0016] In another aspect, the present application also provides a method of producing the low immunogenic pluripotent stem cell of the present application, the method comprising: reducing endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cell; reducing endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cell; and increasing expression of a protein that reduces the susceptibility of the pluripotent stem cell to killing by NK cells, wherein the protein is a STC1 protein.

[0017] In an embodiment, the method comprises: reducing activity of a B2M protein in the pluripotent stem cell; reducing activity of a CIITA protein in the pluripotent stem cell; and increasing expression of a STC1 protein in the pluripotent stem cell.

[0018] In an embodiment, the method comprises: ablating activity of both alleles of a B2M gene in the pluripotent stem cell; ablating activity of both alleles of a CIITA gene in the pluripotent stem cell; and increasing expression of a STC1 gene in the pluripotent stem cell.

[0019] In an embodiment, the activity of the B2M protein in the pluripotent stem cell is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0020] In an embodiment, the activity of the CIITA protein in the pluripotent stem cell is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0021] In an embodiment, the expression of the STC1 protein is increased by expression of a transgene.

[0022] In a preferred embodiment, the expression of the STC1 protein is increased by introducing at least one copy of a STC1 gene under the control of a promoter into the pluripotent stem cell via a lentiviral vector, by constructing a nucleic acid sequence encoding a STC1 protein into a lentiviral vector.

[0023] In an embodiment, the nucleic acid sequence encoding the STC1 protein comprises a nucleic acid sequence set forth in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity to the nucleic acid sequence set forth in SEQ ID NO: 4.

[0024] In another aspect, the present application also provides use of the low immunogenic pluripotent stem cell of the present application or the low immunogenic pluripotent stem cell produced by the method of the present application in the manufacture of a medicament for preventing or treating a disease in which cell transplantation is required. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1This paper presents the B2M gene knockout strategy in the B2M and CIITA double knockout cell line (DKO) and the results of B2M gene knockout verification by PCR.

[0026] Figure 2 This paper presents the CIITA gene knockout strategy in the B2M and CIITA double knockout cell line (DKO) and the results of CIITA gene knockout verification by PCR.

[0027] Figure 3 The results of qPCR detection of B2M and CIITA expression at the RNA level in the B2M / CIITA biallelic knockout clone DKO are shown.

[0028] Figure 4 The results of Western blot analysis of B2M protein levels in the B2M / CIITA biallelic knockout clone DKO are shown.

[0029] Figure 5 The results of FACS detection of HLA type I / II molecules on the surface of H1 cells are shown using IFN-γ stimulation of WT and DKO cells.

[0030] Figure 6 The karyotype detection results of the B2M / CIITA biallelic knockout clone DKO are shown.

[0031] Figure 7A , Figure 7B and Figure 7C The results show the detection results of stem gene expression in DKO cells. Figure 7A The results of immunofluorescence detection of the protein levels of stem genes POU5F1 and NANOG in WT and DKO cells; Figure 7B The results of RT-qPCR detection of the expression of stem genes POU5F1, NANOG and SOX2 at the RNA level in WT and DKO cells; Figure 7C The results of flow cytometry analysis of the expression of stem genes SSEA-4 and Tra1-81 on the surface of WT and DKO cells.

[0032] Figure 8 The results show the ability of B2M / CIITA bis-allelic knockout DKO cells to form teratomas and differentiate into cells from the endoderm, mesoderm, and ectoderm in vivo, as detected by hematoxylin and eosin staining.

[0033] Figure 9Results of detecting the immune escape function of WT and DKO cells by RTCA are shown. The upper three graphs are the results of detecting the killing rate of NK cells on WT and DKO cells by RTCA, i.e. the detection results of the immune escape function of WT and DKO cells to NK cells; the lower three graphs are the results of detecting the killing rate of T cells on WT and DKO cells by RTCA, i.e. the detection results of the immune escape function of WT and DKO cells to T cells.

[0034] Figure 10 A structural schematic diagram of a lentiviral vector pGC-EF1a vector is shown.

[0035] Figure 11A and Figure 11B Results of verifying the overexpression of CD47 in DKO+CD47 cells are shown. Figure 11A Results of detecting the expression level of CD47 in DKO+CD47 cell lines by FACS; Figure 11B Results of detecting the expression level of CD47 in DKO+CD47 cell lines by qPCR.

[0036] Figure 12 Results of detecting the immune escape function of WT and DKO+CD47 cells by RTCA are shown.

[0037] Figure 13 Results of detecting the overexpression level of mRNA in the constructed DKO+STC1 cell line by RT-PCR are shown.

[0038] Figure 14 Results of detecting the protein level of stemness genes OCT4, NANOG, SOX2, TRA-1-60 and TRA-1-81 in the constructed DKO+STC1 cell line by immunofluorescence are shown.

[0039] Figure 15 Results of detecting the expression level of cell surface stemness genes SSEA-4, TRA-1-60, Tra1-81 and OCT4 in the constructed DKO+STC1 cell line by flow cytometry are shown.

[0040] Figure 16 Results of detecting the three germ layer differentiation ability of the constructed DKO+STC1 cell line by immunofluorescence are shown.

[0041] Figure 17 Detection results of the teratoma formation ability of the DKO+STC1 cell line are shown.

[0042] Figures 18A-18D Results of detecting the escape function of the constructed DKO+STC1 cell line to different immune cells by RTCA are shown. Figure 18A andFigure 18B Results of NK cell killing of DKO+STC1 cells detected by RTCA, where Figure 18B Multiple killing histogram. Figure 18C and Figure 18D Results of T cell+NK cell killing of DKO+STC1 cells detected by RTCA, where Figure 18D Multiple killing histogram.

[0043] Figure 19 Cell condition of the constructed DKO+STC1 cell line after 24 hours of co-culture with NK cells is shown.

[0044] Figure 20A and Figure 20B Results of IFN-γ spot secretion by the constructed DKO+STC1 cell line after 24 hours of co-culture with NK cells detected by Elispot, where Figure 20B Statistical histogram of IFN-γ spot frequency.

[0045] Figure 21 Results of expression of NK cell activity marker CD 107a in the constructed DKO+STC1 cell line detected by FACS are shown.

[0046] Figure 22A and Figure 22B Results of escape function of differentiated cells of the constructed DKO+STC1 cell line from NK cells detected by RTCA, where Figure 22B Multiple killing histogram. DETAILED DESCRIPTION

[0047] General definitions and terms

[0048] All patents, patent applications, scientific publications, manufacturer's specifications and handbooks, etc., cited herein are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such disclosure.

[0049] Unless otherwise indicated, the scientific and technical terms used herein have the meanings that would be understood by one of ordinary skill in the art. Also, the terms of protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those used generally in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 2 ndEdition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Also, for better understanding of the present application, the following definitions and explanations of related terms are provided.

[0050] As used herein, the recitations "comprising", "containing", "including", and "having" are open-ended, meaning including but not limited to, the listed elements, steps or components. The recitation "consisting of excludes any element, step or component not specified. The recitation "consisting essentially of means limited to the specified elements, steps or components, plus an optional presence of an element, step or component that does not materially affect the basic and novel characteristic(s) of the claimed subject matter. It is understood that the recitations "consisting essentially of and "consisting of encompass the meaning of the recitation "comprising".

[0051] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. The recitation "one" or "at least one" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9, or more.

[0052] The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. No numerical value or range of values is intended to be critical unless expressly indicated as such in the specification.

[0053] The designations of method steps described herein, such as 1), 2),..., i), ii),..., a), b),..., are only used as examples for differentiation and do not indicate that the described method steps are performed in such order, unless otherwise indicated.

[0054] The term "pluripotent cell" refers to a cell that is capable of self-renewal and proliferation while maintaining an undifferentiated state and can be induced to differentiate into specialized cell types under appropriate conditions.

[0055] As used herein, the term "pluripotent stem cell" has the potential to differentiate into any of the three germ layers: endoderm (e.g., stomach attachment, gastrointestinal tract, lung, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.), or ectoderm (e.g., epidermal tissue and nervous system tissue). The term "pluripotent stem cell" as used herein also includes "induced pluripotent stem cells" or "iPSCs," a pluripotent stem cell derived from a non-pluripotent cell. Exemplary human pluripotent stem cell lines include the Hl human pluripotent stem cell line and the H9 human pluripotent stem cell line. Additional exemplary pluripotent stem cell lines include those available through the National Institutes of Health Human Embryonic Stem Cell Registry and the Howard Hughes Medical Institute HUES collection (as described in Cowan CA, et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350(13): 1353-6.).

[0056] As used herein, the term "totipotent" refers to the ability of a cell to form a complete organism. For example, in mammals, only the zygote and the first cleavage stage blastomeres are totipotent. In an embodiment, the pluripotent stem cells described herein do not have totipotency and will not form a complete organism.

[0057] As used herein, the term "universal cell" refers to a cell that is engineered using gene editing technology to eliminate immune rejection, enabling universalization.

[0058] The cells can be from, for example, a human or a non-human mammal. Exemplary non-human mammals include, but are not limited to, mice, rats, cats, dogs, rabbits, guinea pigs, hamsters, sheep, pigs, horses, cows, and non-human primates. In some embodiments, the cells are from an adult human or non-human mammal. In some embodiments, the cells are from a neonatal human, adult human, or non-human mammal.

[0059] As used herein, the term "immune rejection" or "immunological incompatibility" refers to the fact that a foreign cell, tissue, or organ will be attacked by the recipient's own immune cells after being transplanted into the recipient, thereby failing to guarantee its normal physiological function. The human major histocompatibility complex (MHC), i.e., human leukocyte antigen (HLA), is the main cause of "immune rejection" or "immunological incompatibility."

[0060] As used herein, the term "subject" or "patient" refers to any animal, such as a domestic animal, a zoo animal, or a human. The "subject" or "patient" can be a mammal, such as a dog, cat, bird, livestock, or human. Particular examples of "subjects" and "patients" include, but are not limited to, individuals (particularly humans) having a disease or disorder associated with the liver, heart, lung, kidney, pancreas, brain, neural tissue, blood, bone, bone marrow, and the like.

[0061] A "hypoinmunogenic pluripotent stem cell" herein refers to a pluripotent stem cell that retains its pluripotent stem cell characteristics and produces a reduced immune rejection response when transplanted into an allogeneic host. In preferred embodiments, the hypoinmunogenic pluripotent stem cell does not produce an immune response. Thus, "hypoinmunogenic" refers to a significantly reduced or eliminated immune response as compared to the immune response of the parental ("WT") stem cell prior to immune engineering. For example, such a hypoinmunogenic cell can be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or greater than 99% less likely to produce an immune rejection relative to a wild-type cell that has not been immune engineered.

[0062] The term "major histocompatibility complex (MHC)" relates to a complex of genes that occurs in all vertebrates. MHC proteins or molecules play a role in the signaling between lymphocytes and antigen-presenting cells in the normal immune response. The human MHC, also known as HLA for human leukocyte antigen, is located on chromosome 6 and includes MHC-I and MHC-II.

[0063] The term "MHC-I" or "MHC class I" relates to the major histocompatibility complex class I protein or gene. Within the human MHC-I region, there are HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, CDla, CDlb, and CDlc subregions. MHC class I proteins are present on the surface of almost all cells, including most tumor cells. MHC-I proteins are loaded with antigens, which are typically derived from endogenous proteins or pathogens present within the cell, and then presented to cytotoxic T lymphocytes (CTLs, also known as CD8+ T cells). The T cell receptor is able to recognize and bind to the peptide complexed with the MHC class I molecule. Each cytotoxic T lymphocyte expresses one unique T cell receptor, which is able to bind to a specific MHC / peptide complex. MHC class I molecules primarily mediate the process of endogenous antigen presentation.

[0064] The term "MHC-II" or "MHC class II" refers to major histocompatibility complex class II proteins or genes. MHC class II includes five proteins: HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR. MHC class II proteins are primarily expressed on antigen-presenting cells such as B cells, monocytes / macrophages, and dendritic cells. MHC class II molecules mainly mediate the presentation of exogenous antigens; they present exogenous antigenic peptide molecules to Th cells (helper T cells), thus stimulating CD4+ T cells.

[0065] The term "MHC / peptide complex" refers to a non-covalent complex of a binding domain of an MHC class I or MHC class II molecule and a binding peptide of an MHC class I or MHC class II molecule.

[0066] In this context, "knockout" refers to the process of rendering a specific gene inactive in its host cell, resulting in the absence of the target protein or its inactive form. As understood by those skilled in the art and further described below, this can be achieved in a variety of different ways, including removing nucleic acid sequences from the gene, interrupting the sequence with other sequences, altering the reading frame, or changing the regulatory components of the nucleic acid. For example, all or part of the coding region of the target gene can be removed or replaced with a "nonsense" sequence, all or part of the regulatory sequences (e.g., promoters) can be removed or replaced, and translation initiation sequences can be removed or replaced, etc.

[0067] In this paper, the terms “reduction” and “reduction” are generally used to indicate a reduction that is statistically significant. However, to avoid ambiguity, “reduction” or “reduction” includes a reduction of at least 10% compared to a reference level, such as a reduction of at least about 20% or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% reduction (i.e., a level that does not exist compared to the reference sample), or any reduction between 10% and 100%.

[0068] In this article, "knock-in" or "overexpression" refers to the process of adding genetic function to a host cell. This results in an increase in the level of the encoded protein. As those skilled in the art will understand, this can be achieved in several ways, including adding one or more additional copies of a gene to the host cell or altering the regulatory components of an endogenous gene to increase protein expression. This can be achieved by modifying a promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0069] In the present context, the term "increased" is generally used to indicate an increase of a statistically significant amount; for the avoidance of any doubt, the term "increased" refers to an increase of at least 10% compared to a reference level, such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase, or any increase between 10-100%, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any increase between 2-fold and 10-fold or greater than 10-fold compared to a reference level.

[0070] The "Beta-2 microglobulin" or "β2M" or "B2M" protein is a component of MHC class I molecules. The B2M protein is expressed in all nucleated cells (except red blood cells) and can non-covalently bind to the alpha chain of MHC-I molecules, attach to the cell membrane, and also be released into various tissue fluids.

[0071] The "CD47 protein" or "integrin-associated protein (IAP)" is an important self-signal that can inhibit the phagocytosis of macrophages by binding to the N-terminal of the ligand signal regulatory protein alpha (SIRPα) on immune cells, thereby causing immune escape.

[0072] The "MHC-II transactivator (CIITA) protein" is a key molecule that regulates MHC-II expression, and the body mainly regulates the expression level of MHC II genes by controlling the expression of CIITA.

[0073] The "STC1 (Stanniocalcin-1) protein" is a glycoprotein hormone involved in calcium / phosphate homeostasis, which can regulate various cellular processes during normal development and tumorigenesis. It has been reported that the STC1 protein can block the phagocytosis of macrophages and dendritic cells to dying or dead cancer cells as a blocker of the "eat-me" signal in the body.

[0074] The term "syngeneic" as used herein refers to the genetic similarity or identity of a host organism and a cell graft, wherein there is no immune response; for example, no immune response is generated.

[0075] The term "allogeneic" as used herein refers to the genetic difference of a host organism and a cell graft, wherein an immune response is generated.

[0076] The term "B2M- / -" as used herein refers to a diploid cell having an inactivated B2M gene in both chromosomes.

[0077] As used herein, the term "CIITA- / -" refers to a diploid cell having an inactivated CIITA gene in both chromosomes.

[0078] As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" can comprise one or more polypeptides, wherein the polypeptides interact with each other by covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" are used interchangeably.

[0079] In the context of a cell, "wild type" refers to a cell found in nature. However, in the context of a pluripotent stem cell, as used herein, it also refers to a pluripotent stem cell that has not undergone a genetic editing procedure to achieve low immunogenicity, e.g., a parental pluripotent stem cell (WT) described herein.

[0080] As used herein, the term "% identity" with respect to a sequence refers to the percentage of nucleotides or amino acids that are the same in the best alignment between the sequences to be compared. Differences between two sequences can be distributed over a local region (segment) or the entire length of the sequences to be compared. Identity between two sequences is typically determined following optimal alignment of a segment or "comparison window" between the two sequences. Optimal alignment can be performed manually or with the aid of algorithms known in the art, including but not limited to the local homology algorithm described by Smith and Waterman, 1981, Ads App. Math. 2, 482, the similarity search method described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. The percentage identity of two sequences can be determined, for example, using the BLASTN or BLASTP algorithm publicly available on the National Center for Biotechnology Information (NCBI) website.

[0081] The % identity is obtained by determining the number of positions in the compared sequence that correspond to the same position, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100. In some embodiments, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the region gives the degree of identity. In some embodiments, the entire length of the reference sequence gives the degree of identity. The alignment for determining the sequence identity can be performed using tools known in the art, preferably with optimal sequence alignment, e.g., with Align, with standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0082] In the present context, "nucleotides" include deoxyribonucleotides and ribonucleotides and derivatives thereof. As used herein, "ribonucleotides" are the constituent materials of ribonucleic acid (RNA), consisting of one molecule of base, one molecule of five-carbon sugar, and one molecule of phosphate, which refers to a nucleotide having a hydroxyl group at the 2' position of the beta-D-ribofuranosyl group. Whereas "deoxyribonucleotides" are the constituent materials of deoxyribonucleic acid (DNA), also consisting of one molecule of base, one molecule of five-carbon sugar, and one molecule of phosphate, which refers to a nucleotide having a hydrogen instead of a hydroxyl group at the 2' position of the beta-D-ribofuranosyl group, and are the primary chemical constituents of chromosomes. "Nucleotides" are generally referred to by a single letter representing the base therein: "A (a)" refers to a deoxyadenylate or adenylate containing adenine, "C (c)" refers to a deoxycytidylate or cytidylate containing cytosine, "G (g)" refers to a deoxyguanylate or guanylate containing guanine, "U (u)" refers to a uridylate containing uracil, and "T (t)" refers to a deoxythymidylate containing thymine.

[0083] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence", "nucleic acid sequence", and "nucleotide sequence" are used interchangeably to indicate the order of nucleotides in a polynucleotide. It will be understood by those skilled in the art that a DNA coding strand (sense strand) and its encoded RNA can be considered to have the same nucleotide sequence, with the deoxythymidylates in the DNA coding strand sequence corresponding to the uridylates in the encoded RNA sequence.

[0084] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve production of a transcript and / or a polypeptide. The term "transcription" relates to the process of transcribing the genetic code in a DNA sequence into RNA (transcript). The term "in vitro transcription" refers to the synthesis of RNA, in particular mRNA, in vitro in a system free of cells, for example in an appropriate cell extract (see, e.g., Pardi N., Muramatsu H., Weissman D., Kariko K. (2013). In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). A vector that can be used to produce a transcript is also referred to as "transcription vector", which comprises regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription".

[0085] As used herein, "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA or an mRNA, to serve as templates for synthesis of other macromolecules such as, but not limited to, proteins, RNA, etc. Thus, a gene codes for a protein if its mRNA produced by transcription and translation results in the synthesis of the protein in a cell or other biological system.

[0086] Unless otherwise indicated, all methods described herein can be performed in any suitable order.

[0087] Pluripotent stem cell

[0088] In one aspect, the present application provides a hypoimmunogenic pluripotent stem cell, the hypoimmunogenic pluripotent stem cell comprising:

[0089] reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to a parental pluripotent stem cell;

[0090] reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to a parental pluripotent stem cell; and

[0091] reduced sensitivity to NK cell killing compared to a parental pluripotent stem cell.

[0092] In the present context, a parental pluripotent stem cell refers to a parental (in the present context also referred to as "WT") pluripotent stem cell prior to immunomodification, which has not undergone a genetic editing procedure to achieve hypoimmunogenicity.

[0093] In a particularly preferred embodiment, the reduced susceptibility to NK cell killing is caused by increased expression of STC1 protein.

[0094] As will be appreciated by those skilled in the art, reduction of function can be achieved in a variety of ways, including removal of nucleic acid sequences from a gene, interruption of sequences with other sequences, or alteration of regulatory components of the nucleic acid. For example, all or part of the coding region of a gene of interest can be removed or replaced with a "nonsense" sequence, a frameshift mutation can be made, all or part of a regulatory sequence such as a promoter can be removed or replaced, a translation initiation sequence can be deleted or replaced, and the like.

[0095] As will be appreciated by those skilled in the art, reduction of MHC I (HLA I when the cell is derived from a human cell) function in the pluripotent stem cell can be measured using techniques known in the art and described below; for example, using FACS techniques with labeled antibodies that bind HLA complexes; for example, using commercially available HLA-A, HLA-B, HLA-C antibodies that bind human major histocompatibility HLA class I. Reduction of MHC II (HLA II when the cell is derived from a human cell) function in the pluripotent stem cell can be measured using techniques known in the art and described below; for example, using FACS techniques with labeled antibodies that bind HLA complexes; for example, using commercially available HLA-DQ, HLA-DR, HLA-DP antibodies that bind human major histocompatibility HLA class II.

[0096] In some embodiments, the MHC-I function is reduced by reducing the activity of a MHC-I class protein.

[0097] In an embodiment, the MHC-I class protein comprises a human leukocyte antigen-A (HLA-A) protein, a human leukocyte antigen-B (HLA-B) protein, or a human leukocyte antigen-C (HLA-C) protein.

[0098] In some embodiments, the MHC-I function is reduced by reducing the activity of a MHC-I transcriptional regulator. In some preferred embodiments, the MHC-I transcriptional regulator can be selected from one or more of: beta 2 microglobulin (B2M), transporter associated with antigen processing 1 (TAP1), transporter associated with antigen processing 2 (TAP2), transporter associated with antigen processing (TAP) related glycoprotein (Tapasin), or NOD-like receptor family caspase recruitment domain 5 (NLRC5).

[0099] In an embodiment, the MHC-I function is reduced by reducing the activity of a HLA-A protein.

[0100] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the HLA-A protein.

[0101] In an embodiment, the MHC-I function is reduced by reducing the activity of a HLA-B protein.

[0102] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the HLA-B protein.

[0103] In an embodiment, the MHC-I function is reduced by reducing the activity of a HLA-C protein.

[0104] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the HLA-C protein.

[0105] In an embodiment, the MHC-I function is reduced by reducing the activity of a TAP1 protein.

[0106] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the TAP1 protein.

[0107] In an embodiment, the MHC-I function is reduced by reducing the activity of a TAP2 protein.

[0108] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the TAP2 protein.

[0109] In an embodiment, the MHC-I function is reduced by reducing the activity of a Tapasin protein.

[0110] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the Tapasin protein.

[0111] In an embodiment, the MHC-I function is reduced by reducing the activity of a NLRC5 protein.

[0112] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the NLRC5 protein.

[0113] In a preferred embodiment, the MHC-I function is reduced by reducing the activity of a B2M protein.

[0114] In an embodiment, the B2M protein is a human B2M protein comprising an amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 1.

[0115] In an embodiment, the MHC-I function is reduced by knocking out a gene encoding the B2M protein.

[0116] In some embodiments, the MHC-II function is reduced by reducing the activity of MHC-II class proteins.

[0117] In an embodiment, the MHC-II class proteins comprise human leukocyte antigen-DR (HLA-DR) proteins, human leukocyte antigen-DQ (HLA-DQ) proteins, or human leukocyte antigen-DP (HLA-DP) proteins.

[0118] In some embodiments, the MHC-II function is reduced by reducing the activity of MHC-II transcriptional regulators. In some preferred embodiments, the MHC-II transcriptional regulators can be selected from one or more of: MHC-II transactivator (CIITA), Regulatory Factor X-Associated Ankyrin (RFXANK), Regulatory Factor X5 (RFX5), Regulatory Factor X-Associated Protein (RFXAP).

[0119] In an embodiment, the MHC-II function is reduced by reducing the activity of HLA-DR proteins.

[0120] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the HLA-DR proteins.

[0121] In an embodiment, the MHC-II function is reduced by reducing the activity of HLA-DQ proteins.

[0122] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the HLA-DQ proteins.

[0123] In an embodiment, the MHC-II function is reduced by reducing the activity of HLA-DP proteins.

[0124] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the HLA-DP proteins.

[0125] In an embodiment, the MHC-II function is reduced by reducing the activity of RFXANK proteins.

[0126] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the RFXANK proteins.

[0127] In an embodiment, the MHC-II function is reduced by reducing the activity of RFX5 proteins.

[0128] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the RFX5 protein.

[0129] In an embodiment, the MHC-II function is reduced by reducing the activity of the RFXAP protein.

[0130] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the RFXAP protein.

[0131] In a preferred embodiment, the MHC-II function is reduced by reducing the activity of the CIITA protein.

[0132] In an embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 2.

[0133] In an embodiment, the MHC-II function is reduced by knocking out a gene encoding the CIITA protein.

[0134] In a preferred embodiment, the gene is knocked out using CRISPR technology. In some cases, the CRISPR technology is used to introduce a small deletion / insertion into the coding region of the gene such that no functional protein is produced, typically the result of a frameshift mutation which results in the creation of a stop codon such that a truncated, non-functional protein is produced.

[0135] The successful reduction of MHC-I (HLA-I when the cell is derived from a human cell) function and MHC-II (HLA-II when the cell is derived from a human cell) function in the pluripotent stem cell can be measured using techniques known in the art, for example, Western blotting using protein antibodies, FACS technology, RT-PCR, qPCR technology, and the like.

[0136] In some embodiments, the reduced susceptibility to killing by NK cells is caused by an increased expression of the STC1 protein in the pluripotent stem cell. This is accomplished in several ways, as will be appreciated by one skilled in the art, either using "knock-in" or transgenic technology. In some cases, the increased expression of STC1 is caused by one or more STC1 transgenes.

[0137] Accordingly, in some embodiments, one or more copies of the STC1 gene are added to the pluripotent stem cell under the control of an inducible or constitutive promoter. In some embodiments, a lentiviral construct is used as described herein or known in the art. The STC1 gene can be integrated into the genome of the host cell under the control of a suitable promoter as known in the art.

[0138] In one embodiment, the increased expression of STC1 protein is caused by the STC1 transgene.

[0139] In one embodiment, the STC1 protein is a human STC1 protein comprising the amino acid sequence set forth in SEQ ID NO: 3 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 3.

[0140] The presence of sufficient STC1 protein expression can be determined using known techniques, such as those described in the Examples, for example using a Western blot, an ELISA assay, or a FACS assay. Generally, "sufficient" in this context means an increase in STC1 protein expression on the surface of the pluripotent stem cell that silences killing by NK cells.

[0141] In yet another aspect, the present application also provides a hypoimmunogenic pluripotent stem cell comprising:

[0142] one or more alterations that reduce endogenous B2M protein activity;

[0143] one or more alterations that reduce endogenous CIITA protein activity; and

[0144] one or more alterations that cause increased STC1 protein expression in the hypoimmunogenic pluripotent stem cell.

[0145] In one embodiment, the hypoimmunogenic pluripotent stem cell comprises:

[0146] one or more alterations that inactivate both alleles of the endogenous B2M gene;

[0147] one or more alterations that inactivate both alleles of the endogenous CIITA gene; and

[0148] one or more alterations that cause increased STC1 gene expression in the hypoimmunogenic pluripotent stem cell.

[0149] As used herein, the term "alteration" or "genetic alteration" refers to a change to a cell, e.g., a pluripotent stem cell described herein, which can be effected, e.g., by modifying the genome or introducing a new genetic fragment. In the present context, modifying the genome refers to modifying nucleic acid sequences within a cell or in a cell-free condition to produce engineered pluripotent cells and pluripotent stem cells. Exemplary "alteration" or "genetic alteration" techniques include, but are not limited to, homologous recombination, knock-in, ZFN (zinc finger nuclease), TALEN (transcription activator-like effector nuclease), CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9, and other site-specific nuclease technologies. These technologies enable double-stranded DNA breaks at desired genetic locus sites. These controlled double-stranded breaks facilitate homologous recombination at the specific genetic locus site. The process focuses on targeting a specific sequence of a nucleic acid molecule, e.g., a chromosome, with an endonuclease that recognizes and binds to the sequence and induces a double-stranded break in the nucleic acid molecule. The double-stranded break is repaired by error-prone non-homologous end joining (NHEJ) or by homologous recombination (HR). Exemplary "alteration" or "genetic alteration" techniques also include introducing gene expression modification molecules including, but not limited to, siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO, or Anti-miRNA oligonucleotides AMO.

[0150] Those skilled in the art will appreciate that many different techniques can be used to engineer the pluripotent cells and pluripotent stem cells of the present application to make them hypoimmunogenic.

[0151] Generally, these techniques can be used individually or in combination. For example, the CRISPR technology is used to reduce expression of active B2M and / or CIITA proteins in the engineered cells and a viral technology, e.g., lentivirus, is used to knock-in the STC1 gene. Further, those skilled in the art will appreciate that these genes can be manipulated using different techniques in different orders.

[0152] In some embodiments, one or more alterations comprised by the hypoimmunogenic pluripotent stem cells of the present application reduce endogenous major histocompatibility class I antigen (MHC-I) function. In some embodiments, one or more alterations comprised by the hypoimmunogenic pluripotent stem cells of the present application reduce endogenous major histocompatibility class II antigen (MHC-II) function. In some embodiments, one or more alterations comprised by the hypoimmunogenic pluripotent stem cells of the present application reduce sensitivity to NK cell killing.

[0153] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can reduce endogenous B2M protein activity. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can reduce endogenous CIITA protein activity. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can increase STC1 protein expression.

[0154] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can inactivate both alleles of the endogenous B2M gene. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can inactivate both alleles of the endogenous CIITA gene. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can increase STC1 gene expression.

[0155] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can repress endogenous B2M protein expression. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can repress endogenous CIITA protein expression.

[0156] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can interfere with endogenous B2M protein expression. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can interfere with endogenous CIITA protein expression.

[0157] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can reduce endogenous B2M protein expression. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can reduce endogenous CIITA protein expression.

[0158] In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can knock out endogenous B2M protein. In some embodiments, the one or more alterations comprised by the low immunogenic pluripotent stem cells of the application can knock out endogenous CIITA protein.

[0159] In one embodiment, the pluripotent stem cell is altered using clustered regularly interspaced short palindromic repeats / Cas ("CRISPR") technology known in the art to reduce endogenous B2M protein activity.

[0160] In one embodiment, the pluripotent stem cell is altered using Clustered Regularly Interspaced Short Palindromic Repeat / Cas ("CRISPR") technology known in the art such that endogenous CIITA protein activity is reduced.

[0161] In one embodiment, the pluripotent stem cell is altered using Clustered Regularly Interspaced Short Palindromic Repeat / Cas ("CRISPR") technology known in the art such that both alleles of the endogenous B2M gene are inactivated.

[0162] In one embodiment, the pluripotent stem cell is altered using Clustered Regularly Interspaced Short Palindromic Repeat / Cas ("CRISPR") technology known in the art such that both alleles of the endogenous CIITA gene are inactivated.

[0163] Assays to test whether a gene has been inactivated are known and described herein. In one embodiment, the assay is a Western blot of cell lysate probed with an antibody against B2M protein or CIITA protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) confirms the presence of the inactivating alteration.

[0164] In one embodiment, viral technology known in the art can be used to cause increased expression of the STC1 gene in the hypoimmunogenic pluripotent stem cell. The viral technology includes, but is not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai viral vectors. In some embodiments, a nucleic acid sequence encoding an STC1 protein is introduced into a selected site of the cell; the selected site of the cell is an AAVS1, CCR5, and the like safe harbor gene site. As used herein, "safe harbor gene site" refers to a site that can be used for gene safe knock-in and can ensure normal stable expression of the transgene.

[0165] In a preferred embodiment, a lentiviral vector is used to cause increased expression of the STC1 gene in the hypoimmunogenic pluripotent stem cell.

[0166] In one embodiment, the hypoimmunogenic pluripotent stem cell is a human pluripotent stem cell.

[0167] In one embodiment, the B2M protein is a human B2M protein comprising the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 1.

[0168] In an embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 2.

[0169] In an embodiment, the STC1 protein is a human STC1 protein comprising the amino acid sequence set forth in SEQ ID NO: 3 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NO: 3.

[0170] In an embodiment, the hypoimmunogenic stem cell comprises:

[0171] reduced endogenous major histocompatibility class I antigen (MHC-I) function as compared to a parental pluripotent stem cell;

[0172] reduced endogenous major histocompatibility class II antigen (MHC-II) function as compared to a parental pluripotent stem cell; and

[0173] reduced sensitivity to NK cell killing as compared to a parental pluripotent stem cell.

[0174] In an embodiment, the hypoimmunogenic pluripotent stem cell elicits a T cell response that is lower than a T cell response elicited by a parental pluripotent stem cell that does not comprise the alteration that reduces B2M and CIITA protein activity and the alteration that causes increased STC1 protein expression. In an embodiment, the T cell response is measured by assaying the killing of the hypoimmunogenic pluripotent stem cell or the parental pluripotent stem cell by T cells in real-time, label-free kinetic cell analysis (RTCA).

[0175] In an embodiment, the hypoimmunogenic pluripotent stem cell elicits a natural killer (NK) cell response that is lower than a NK cell response elicited by a B2M / CIITA double knock-out clonal DKO cell that comprises the alteration that reduces B2M and CIITA protein activity but does not comprise the alteration that causes increased STC1 protein expression. In an embodiment, the NK cell response is measured by assaying the level of IFN-g of NK cells incubated in vitro with the hypoimmunogenic pluripotent stem cell or the DKO cell. In an embodiment, the NK cell response is measured by assaying the killing of the hypoimmunogenic pluripotent stem cell or the DKO cell by NK cells in real-time, label-free kinetic cell analysis (RTCA).

[0176] Methods of producing the low immunogenic pluripotent stem cells of the present invention

[0177] The present invention also provides a method of producing the low immunogenic pluripotent stem cells of the present invention, the method comprising: reducing endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cell; reducing endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cell; and increasing expression of a protein that reduces the susceptibility of the pluripotent stem cell to killing by NK cells, wherein the protein is an STC1 protein.

[0178] In some embodiments, the method comprises: reducing activity of a B2M protein in the pluripotent stem cell; reducing activity of a CIITA protein in the pluripotent stem cell; and increasing expression of an STC1 protein in the pluripotent stem cell.

[0179] In one embodiment, the method comprises: ablating activity of both alleles of a B2M gene in the pluripotent stem cell; ablating activity of both alleles of a CIITA gene in the pluripotent stem cell; and increasing expression of an STC1 gene in the pluripotent stem cell.

[0180] In some embodiments, the activity of a B2M protein in the pluripotent stem cell can be reduced by a "modifying" or "genetically modifying" technique as described above. In some embodiments, the activity of a CIITA protein in the pluripotent stem cell can be reduced by a "modifying" or "genetically modifying" technique as described above. The technique is, for example, introduction of a gene expression modifying molecule, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology, Transcription Activator-Like Effector Nuclease (TALEN) technology, Zinc Finger Nuclease (ZFN) technology, or homologous recombination technology. In a preferred embodiment, the gene expression modifying molecule comprises siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO, or Anti-miRNA oligonucleotides AMO.

[0181] In some embodiments, the CRISPR / Cas system comprises a Cas protein or a nucleic acid sequence encoding a Cas protein and at least one to two ribonucleic acids (e.g., gRNAs) capable of directing the Cas protein to a target motif of a target polynucleotide sequence and hybridizing to the target motif. In some embodiments, the CRISPR / Cas system comprises a Cas protein or a nucleic acid sequence encoding a Cas protein and a single ribonucleic acid or a pair of at least one ribonucleic acid (e.g., gRNAs) capable of directing the Cas protein to a target motif of a target polynucleotide sequence and hybridizing to the target motif.

[0182] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprise conservative amino acid substitutions. In some cases, the substitutions and / or modifications can prevent or reduce proteolytic degradation and / or prolong the half-life of the polypeptide in a cell. In some embodiments, the Cas protein can comprise a peptide bond replacement (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein can comprise naturally occurring amino acids. In some embodiments, the Cas protein can comprise alternative amino acids (e.g., D-amino acids, beta-amino acids, homocysteic acid, phosphoserine, etc.). In some embodiments, the Cas protein can comprise modifications to include moieties (e.g., pegylation, glycosylation, lipidation, acetylation, capping, etc.).

[0183] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises a Cas protein of the E. coli subtype (also referred to as CASS2). Exemplary Cas proteins of the E. coli subtype include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Cas protein of the Ypest subtype (also referred to as CASS3). Exemplary Cas proteins of the Ypest subtype include, but are not limited to, Csyl, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises a Cas protein of the Nmeni subtype (also referred to as CASS4). Exemplary Cas proteins of the Nmeni subtype include, but are not limited to, Csnl and Csn2. In some embodiments, the Cas protein comprises a Cas protein of the Dvulg subtype (also referred to as CASSl). Exemplary Cas proteins of the Dvulg subtype include, but are not limited to, Csd 1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Cas protein of the Tneap subtype (also referred to as CASS7). Exemplary Cas proteins of the Tneap subtype include, but are not limited to, Cstl, Cst2, Cas5t. In some embodiments, the Cas protein comprises a Cas protein of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include, but are not limited to, Cshl, Csh2, and Cas5h. In some embodiments, the Cas protein comprises a Cas protein of the Apern subtype (also referred to as CASS5). Exemplary Cas proteins of the Apern subtype include, but are not limited to, Csal, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises a Cas protein of the Mtube subtype (also referred to as CASS6). Exemplary Cas proteins of the Mtube subtype include, but are not limited to, Csm 1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP-type Cas protein. Exemplary RAMP-type Cas proteins include, but are not limited to, Cmrl, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6.

[0184] In some embodiments, the Cas protein is a Streptococcus pyogenes Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Streptococcus aureus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Streptococcus thermophilus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Neisseria meningitides Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Treponema denticola Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Cas9 protein from any bacterial species or a functional portion thereof. Cas9 proteins are members of the type II CRISPR system, which generally includes a trans-encoded small RNA (tracrRNA), an endogenous ribonuclease 3 (rnc), and a Cas protein. Cas9 proteins (also known as CRISPR-associated endonuclease Cas9 / Csn1) are polypeptides comprising 1368 amino acids.

[0185] In an embodiment, the activity of the B2M protein in the pluripotent stem cell is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0186] In an embodiment, the activity of both alleles of the B2M gene in the pluripotent stem cell is eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0187] In an embodiment, the activity of the CIITA protein in the pluripotent stem cell is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0188] In an embodiment, the activity of both alleles of the CIITA gene in the pluripotent stem cell is eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0189] In an embodiment, the expression of the STC1 protein is increased by modification of an endogenous locus. In some embodiments, the modification of the endogenous locus is by a technology as described above as “altering” or “genetically altering”. The technology is, for example, a gene knock-in, a clustered regularly interspaced short palindromic repeats (CRISPR) technology, a transcription activator-like effector nuclease (TALEN) technology, a zinc finger nuclease (ZFN) technology, or a homologous recombination technology.

[0190] In one embodiment, expression of STC1 protein is increased by expression of a transgene. Expression of STC1 protein can be increased using transgenic expression techniques known in the art, including but not limited to viral techniques, Piggybac transposon techniques, Sleeping Beauty transposon techniques.

[0191] In this context, expression constructs as described herein can be produced using well-known recombinant techniques. In certain embodiments, a nucleic acid sequence encoding a protein of interest can be operably linked to one or more regulatory nucleotide sequences in an expression construct. The regulatory nucleotide sequences are generally appropriate to the host cell and the subject to be treated. A variety of types of suitable expression vectors and suitable regulatory sequences are known in the art for a variety of host cells. Typically, the regulatory nucleotide sequence(s) can include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences. Expression constructs used herein can use constitutive or inducible promoters known in the art. The promoter can be a naturally occurring promoter, or a hybrid promoter that combines elements of more than one promoter. The expression construct can exist as a separate entity (e.g., a plasmid), or the expression construct can be inserted into the host cell's chromosome. In a particular embodiment, the expression vector includes a selectable marker gene to allow selection of transformed host cells. Certain embodiments include an expression vector comprising a nucleotide sequence encoding a protein of interest operably linked to at least one regulatory sequence. Regulatory sequences used herein include promoters, enhancers, and other expression control elements. In certain embodiments, the expression vector is designed to select the host cell to be transformed, the protein of interest desired to be expressed, the copy number of the vector, the ability to control that copy number, or expression of any other protein encoded by the vector, such as an antibiotic marker. In some embodiments, the promoter is an EF1a promoter.

[0192] Viral techniques can be used to cause increased expression of the STC1 gene in the hypoimmunogenic pluripotent stem cells. The viral techniques include, but are not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai viral vectors.

[0193] In a preferred embodiment, expression of STC1 protein is increased by introducing at least one copy of the STC1 gene under the control of a promoter into the pluripotent stem cells via a lentiviral vector, by constructing the nucleic acid sequence encoding the STC1 protein into the lentiviral vector.

[0194] In one embodiment, a nucleic acid sequence encoding an STC1 protein is introduced into a selected site of the genome of the pluripotent stem cell. In a preferred embodiment, the selected site is an AAVS1, CCR5, or the like safe harbor gene site. As used herein, "safe harbor gene site" refers to a site that can be used for gene safe knock-in and can ensure normal stable expression of the introduced gene.

[0195] In one embodiment, the STC1 protein is a human STC1 protein.

[0196] In one embodiment, the nucleic acid sequence encoding an STC1 protein comprises the nucleic acid sequence set forth in SEQ ID NO: 4 or a nucleic acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 4.

[0197] Prevention or treatment

[0198] The present application further provides use of the hypoimmunogenic pluripotent stem cell of the present application or the hypoimmunogenic pluripotent stem cell prepared by the method of the present application in the manufacture of a medicament for preventing or treating a disease in need of cell transplantation.

[0199] The hypoimmunogenic pluripotent stem cell of the present application or the hypoimmunogenic pluripotent stem cell prepared by the method of the present application can be induced to differentiate into different cells, which can be used for different prophylactic or therapeutic purposes to prevent or treat different diseases. As will be appreciated by one skilled in the art, the method of differentiation depends on the desired cell type using known techniques. For example, the cells can be suspended and then made into a gel matrix form, such as a Matrigel, gelatin, or fibrin / thrombin form, to promote cell survival. Differentiation can generally be determined as known in the art by assessing the presence of cell specific markers. For example, the cells can be differentiated into cardiomyocytes, neural cells, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, pancreatic islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, liver cells, thyroid cells, skin cells, blood cells, or epithelial cells under certain differentiation conditions.

[0200] In some embodiments, the disease is a cancer, which includes solid tumors and blood tumors. In some embodiments, the solid tumor includes small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, or melanoma. In some embodiments, the blood tumor includes acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, or multiple myeloma.

[0201] In one embodiment, the disease includes aplastic anemia.

[0202] In one embodiment, the disease comprises an innate immune deficiency disease.

[0203] In some embodiments, the disease is an autoimmune disease, which comprises systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, or type I diabetes.

[0204] In some embodiments, the disease is a neurodegenerative disease, which comprises Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degenerative disease, stroke, Huntington's disease, or amyotrophic lateral sclerosis.

[0205] In some embodiments, the disease is a cardiovascular disease, which comprises atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, myocarditis, myocardial infarction, heart failure, aortic aneurysm, or peripheral arterial disease.

[0206] In some embodiments, the disease is a metabolic-related disease, which comprises type II diabetes, anemia, hypoglycemia, hyperlipidemia, or osteoporosis.

[0207] Beneficial effects

[0208] The pluripotent stem cells of the present application and the low immunogenic pluripotent stem cells prepared by the method of the present application can exhibit excellent effects, such as but not limited to: (1) having good self-renewal and differentiation ability; (2) being able to escape T cell killing; (3) being able to escape NK cell killing; and / or (4) the differentiated cells also being able to escape NK cell killing; thereby exhibiting excellent application potential.

[0209] Examples

[0210] The present application is further described by reference to the following examples. It will be appreciated that these examples are by way of illustration and do not constitute limitation of the present application. The following materials and instruments are commercially available or prepared according to methods well known in the art. The following experiments are performed according to the manufacturer's instructions or according to methods and procedures well known in the art.

[0211] Example 1. Construction of B2M and CIITA double knockout cell line (DKO)

[0212] 1.1 Construction of B2M and CIITA double knockout cell line (DKO)

[0213] The following examples select human pluripotent stem cell lines H1 (Wicell, WA01) or H9 (Wicell, WA09) for the construction of target cell lines, and the cell culture and gene knockout reagents used are shown in Table 1.

[0214] Table 1. Cell culture and gene knockout reagents

[0215]

[0216] Using CRISPR / CAS9 to knock out beta-2-microglobulin (B2M) in endoplasmic reticulum, so that the cell surface MHC-I cannot form functional molecules, thereby escaping from allogeneic CD8 + T cell killing; escape from CD4+T cell killing is by knocking out the positive regulator of MHC-II gene transcription CIITA, and reducing MHC-II class molecule expression.

[0217] CRISPR / CAS9 gene knockout strategy of B2M and gRNA sequence and identification primer used as Figure 1 As shown in Table 2, B2M-gRNA1 and B2M-gRNA2 (EasyEdit sgRNA, Geneart) were used to directly knock out both ends of the B2M exon segment, and then B2M-F1 / R1 and B2M-F2 / R2 two pairs of PCR primers were used to verify the knockout of the genomic sequence.

[0218] In addition, the CRISPR / CAS9 gene knockout strategy of CIITA and the gRNA sequence and identification primer used as Figure 2 As shown in Table 2, CIITA-gRNA1 and CIITA-gRNA2 (EasyEdit sgRNA, Geneart) were used to directly knock out both ends of the CIITA exon segment, and then CIITA-F1 / R1 and CIITA-F2 / R2 two pairs of PCR primers were used to verify the knockout of the genomic sequence.

[0219] Table 2. gRNA sequence and identification primer

[0220]

[0221] The specific operation is as follows:

[0222] 1) Normal use of Matrigel coated 6-well plate with Y-27632 added mTeSR1 medium to culture human pluripotent stem cells to 80% density. After digestion with TrypLE, add DMEM / F12 to neutralize, count. 2x10 6 The cells were centrifuged in EP tubes, and the supernatant was discarded.

[0223] 2) According to the 100 μL transfection system of Neon transfection system (ThermoFisher), add 15 μg TrueCut TMCas9 Protein + 3 μg gRNA (B2M-gRNA1 + B2M-gRNA2 + CIITA-gRNA1 + CIITA-gRNA2) to form ribonucleoprotein complex (RNP) system, mix well and stand at room temperature for 20 min.

[0224] 3) Resuspend the cells with 100 μL RNP electrotransformation system, and perform electrotransformation with Neon transfection system, with the electrotransformation parameters of 1200V, 30ms, 1 pause. Add preheated medium to the cells after electrotransformation, and evenly inoculate in a 1-hole Matrigel-coated 6-hole plate.

[0225] 4) Replace fresh mTeSR1 medium every day. When the single cells grow up, pick single clones in a 48-hole plate. After the clones are expanded, collect genomic samples for PCR detection of gene editing. The PCR results are shown in Figure 1 and 2 The PCR positive clones are sent to the company for Sanger sequencing for further verification.

[0226] 5) Expansion culture and cryopreservation of positive B2M / CIITA double-allele knockout clone DKO.

[0227] 1.2 Detection of the expression of B2M and CIITA RNA level of DKO

[0228] Total RNA of cells is extracted using FastPure Cell / Tissue Total RNA Isolation Kit V2 (NORWEGIAN, RC112-01), and then the RNA is reversely converted into cDNA using HiScript III RT SuperMix for qPCR (NORWEGIAN, R323-01) according to the manufacturer's instructions.

[0229] qPCR is used to detect the expression of B2M and CIITA of B2M / CIITA double-allele knockout clone DKO at the RNA level. The primers used are as follows.

[0230] B2M-F: AAGATGAGTATGCCTGCCGT

[0231] B2M-R: ATGCGGCATCTTCAAACCTC

[0232] CIITA-F: CCTGGAGCTTCTTAACAGCGA

[0233] CIITA-R: TGTGTCGGGTTCTGAGTAGAG

[0234] Using a Roche 480II instrument, the reaction system is as follows:

[0235] Pre-incubation, 95℃, 30s.

[0236] Amplification, 95℃ for 10s, 60℃ for 30s, 40 cycles.

[0237] Melting curve and Cooling are the default programs.

[0238] qPCR results as follows Figure 3 As shown, compared with untreated wild-type human pluripotent stem cells, the expression of B2M and CIITA at the RNA level in the B2M / CIITA biallelic knockout clone DKO was almost non-existent, confirming the successful knockout of B2M and CIITA.

[0239] 1.3 Detection of B2M protein expression levels in DKO

[0240] Western blotting was used to detect the expression level of B2M protein in the B2M / CIITA biallelic knockout clone DKO (B2M antibody catalog number ab75853; internal control antibody GAPDH catalog number ab181602, both purchased from Abcam).

[0241] Western blot results as follows Figure 4 As shown, the B2M protein level in DKO was significantly lower than that in wild-type human pluripotent stem cells, confirming the successful knockout of the B2M protein.

[0242] 1.4 Detection of HLA class I / II molecules in DKO

[0243] The HLA type I / II molecules on the surface of H1 cells were detected by stimulating WT and DKO cells with IFN-γ (PeproTech, Cat#300-02). The specific detection method is as follows:

[0244] Cells were plated, and on the second day, when changing the medium, medium containing IFN-γ was added to the cells. After 48 hours of incubation, the cells were digested and the expression of HLA-I / II was detected using flow cytometry (Agilent Technologies, NovoCyte).

[0245] Flow cytometry results as follows Figure 5Figure 2 shows the results of the HLA-I and HLA-II class molecule detection. The left side HLA-ABC detects HLA-I class molecules; the right side HLA-DR, DQ, DP detects HLA-II class molecules; T cells are positive controls. It is observed that the B2M / CIITA double allelic knockout clone DKO cannot express HLA-I / II class molecules in response to IFN-γ stimulation, proving that the DKO HLA-I and HLA-II functions are reduced.

[0246] 1.5 Karyotype detection of DKO

[0247] The obtained positive clone of B2M / CIITA double allelic knockout (DKO) is subjected to karyotype detection, and the specific detection method is as follows:

[0248] The chromosome sample fixed on the slide is treated with trypsin and then stained with Giemsa staining solution. According to the length of the chromosome, the position of the centromere, the ratio of the long arm and the short arm, the presence or absence of the satellite, etc., the metaphase chromosomes are analyzed for the number and morphological structure of the chromosomes to determine whether the karyotype is consistent with the normal karyotype.

[0249] The karyotype detection results are shown in Figure 3, and the DKO karyotype is normal, with no obvious change compared with the normal karyotype. Figure 6

[0250] Example 2. Stemness and immune function of DKO cell line

[0251] This example further detects whether the stemness and immune function of pluripotent stem cells change after knocking out the B2M / CIITA double alleles.

[0252] 2.1 Expression of stemness genes in DKO cells

[0253] The protein levels of stemness genes POU5F1 and NANOG in WT and DKO cells are detected by immunofluorescence, the expression of stemness genes POU5F1, NANOG and SOX2 in WT and DKO cells at the RNA level is detected by RT-qPCR, and the expression of stemness genes SSEA-4 and Tra1-81 on the surface of WT and DKO cells is detected by flow cytometry, and the specific detection method is as follows:

[0254] Immunofluorescence detection: plate WT or DKO cells in a 12-well plate, and when the cells grow to 60-80% density, discard the culture medium and add 4% paraformaldehyde for fixation. After breaking the cell membrane, use the primary antibodies of POU5F1 and NANOG for overnight incubation at 4°C, wash away the primary antibodies and incubate the secondary antibodies with fluorescent labels at room temperature, and then use a fluorescence microscope (Nikon Ts2R-FL) to take pictures.

[0255] RT-qPCR detection: ​

[0256] The reaction system is as follows using Roche 480II instrument:

[0257] Pre-incubation, 95℃, 30s.

[0258] Amplification, 95℃ 10s, 60℃ 30s, 40 cycles.

[0259] Melting curve and Cooling are default procedures.

[0260] Mesenchymal stem cells (MSC) are negative controls for stemness gene expression.

[0261] Flow cytometry:

[0262] After collecting the cells, incubate the cells with antibodies in an EP tube at 4℃ in the dark for 30 min, and then select a suitable fluorescence collection channel according to the antibody information, and detect the fluorescence. All antibodies are from BD Biosciences.

[0263] The results of immunofluorescence detection are shown in Figure 7A WT and DKO cells express stemness genes POU5F1 and NANOG at the protein level, and there is no significant difference in the expression of stemness genes POU5F1 and NANOG in DKO cells compared with WT cells. The results of RT-qPCR detection are shown in Figure 7B WT and DKO cells express stemness genes POU5F1, NANOG and SOX2 at the RNA level, and there is no significant difference in the expression of stemness genes POU5F1, NANOG and SOX2 in DKO cells compared with WT cells. The results of flow cytometry detection are shown in Figure 7C WT and DKO cells both highly express stemness genes SSEA-4 (WT 100% vs. DKO 99.98%) and Tra1-81 (WT 96.75% vs. DKO 99.13%) on the cell surface.

[0264] 2.2 Differentiation ability of DKO cells

[0265] This example detects the differentiation ability of DKO cells. The specific detection method is as follows: 100 μL of a suspension of 5x10 5 DKO cells is injected subcutaneously into immunodeficient mice (SCID Beige, Vantianlihua), and the teratoma is removed when the volume is greater than 1.5 cm 3 After paraffin sectioning and hematoxylin-eosin staining.

[0266] The staining results are shown in Figure 8As shown, B2M / CIITA double allele knockout DKO cells can form teratoma and differentiate into cells of endo-meso-ectoderm in vivo, and the DKO cells have normal tri germ layer differentiation ability.

[0267] 2.3 Immune function of DKO cells

[0268] The killing experiment of T cells and NK cells was performed by using xCELLigence RTCA Instrument to detect the changes of immune function of DKO cells. The reagents used in the killing experiment are shown in Table 3.

[0269] The same amount of WT and DKO cell lines were resuspended in Essential 8 medium containing human IL-2 and inoculated in 96-well E-plates coated with Matrigel, and activated T cells (XC11228, purchased from SAILYBIO) or NK cells (XC11013, purchased from SAILYBIO) were added for killing detection. The T cells will be subjected to CD3, CD4 and CD8 flow detection before use, and the NK cells will be subjected to CD16 and CD56 flow detection before use, to ensure the function of the T cells and NK cells used. The RTCA detection data were analyzed using xCELLigence software to calculate the killing rate and escape function.

[0270] Table 3. Reagents used in the killing experiment

[0271] Name Cat No. Format Manufacturer PE anti-human CD4 980804 500 μl / tube Biolegend APC anti-human CD8 980904 500 μl / tube Biolegend FITC anti-human CD3 300440 500 times Biolegend APC anti-human CD16 301012 100 times Biolegend PE anti-human CD56 (NCAM) 318306 100 times Biolegend human IL-2 202-1L-050 / CF 50 μg R&D Y-27632 2HCl S1049 5 mg Selleck Matrigel 354277 5ml Gibco Essential 8 TM culture medium A1517001 500ml Gibco E-Plate VIEW 96 PET 300601030 6 pieces / box Agilent

[0272] The RTCA results are shown in Figure 9 As shown, the WT cells escape the killing of NK cells due to the expression of HLA-I, but are killed by T cells. The DKO cells can escape the killing of T cells, and are more sensitive to the killing of NK cells.

[0273] Example 3. Construction of DKO+CD47 cell line and verification of immune function

[0274] 3.1 Construction of DKO+CD47 cell line

[0275] In this example, lentiviral vector was used to overexpress CD47 (NM_198793) in the DKO cells obtained in Example 1, and the amino acid sequence of CD47 is shown in SEQ ID NO: 5.

[0276] The nucleic acid sequence encoding CD47 protein (SEQ ID NO: 6) was constructed in a lentiviral vector (pGC-EF1a) driven by EF1a promoter and with a puromycin selection marker. The structure of the pGC-EF1a vector is shown in Figure 10 The specific operation method is as follows:

[0277] The lentivirus vector was cut with BamHI / NheI, and the nucleic acid sequence encoding the CD47 protein (SEQ ID NO: 6) was connected to the lentivirus vector. After successful connection, Sanger sequencing was used to verify the correctness of the inserted sequence and perform virus packaging. The lentivirus vector was transfected into the DKO cells constructed in Example 1, and the medium was changed after 24 h. After 48 h, the medium containing puromycin was changed for screening.

[0278] The constructed stable cell line DKO+CD47 was subjected to flow cytometry detection (CD47 antibody was purchased from FACS: Biolegend, item number: 323108) and qPCR detection. The qPCR primers were CD47-F: AGAAGGTGAAACGATCATCGAGC; CD47-R: CTCATCCATACCACCGGATCT. The detection results are shown in Figure 11A and 11B As shown in the constructed DKO+CD47 cell line, the expression level of CD47 was significantly higher than that of WT cells. The verified DKO+CD47 cell line was subjected to cell expansion and subsequent functional detection.

[0279] 3.2 Verification of the immune function of DKO+CD47

[0280] RTCA was used to detect whether the overexpressed DKO+CD47 cell strain could successfully escape the killing of NK cells while escaping the killing of T cells. The specific detection method is described in Example 2.3.

[0281] RTCA detection is shown in Figure 12 As shown in the constructed DKO+CD47 cell line, the expression level of CD47 was significantly higher than that of WT cells. The verified DKO+CD47 cell line was subjected to cell expansion and subsequent functional detection.

[0282] Example 4. Construction of DKO+STC1 cell line and detection of stemness and differentiation ability

[0283] 4.1 Construction of DKO+STC1 cell line and overexpression detection

[0284] The nucleic acid sequence encoding the STC1 protein (the amino acid sequence of the STC1 protein is shown in SEQ ID NO: 3) was directly synthesized. The nucleic acid sequence is shown in SEQ ID NO: 4

[0285] As described in Example 3.1, the lentivirus vector (pGC-EF1a) was constructed with EF1a promoter and puromycin selection marker. The structure of the pGC-EF1a vector is shown in Figure 10The vector was digested with BamHI / NheI, and the nucleic acid sequence of STC1 synthesized above was ligated into the lentivirus vector. After successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence and virus packaging. The lentivirus vector was transfected into the DKO cells constructed in Example 1, and the medium was changed after 24 h, and the medium containing puromycin was changed after 48 h for screening.

[0286] The mRNA overexpression level of the constructed DKO+STC1 cell line was detected by qPCR, and the mRNA overexpression level was detected by RT-PCR, with WT cells as a negative control. The primers used are shown in Table 5.

[0287] Table 4. qPCR detection primers of STC1

[0288] Primer sequences Specific sequences STC1 F1 CTGAGGCAATTACCGAGGTC STC1 R1 TCATCGCATTCGAGGAGACT

[0289] The detection results are shown in Table 6. Figure 13 The constructed DKO+STC1 cell line has high expression of STC1.

[0290] 4.2 Expression of stemness genes in DKO+STC1 cell line

[0291] The expression of stemness genes in the DKO+STC1 cell line was detected by immunofluorescence and flow cytometry. For specific detection methods, see Example 2.1.

[0292] The immunofluorescence detection results are shown in Table 7. Figure 14 The constructed DKO+STC1 cell line expresses stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 at the protein level.

[0293] The flow cytometry results are shown in Table 8. Figure 15 The DKO+STC1 cell line has high expression of stemness genes SSEA-4, TRA-1-60, Tra1-81, and OCT4 on the cell surface, with a proportion of 99.14%, 99.17%, 97.52%, and 98.71%, respectively.

[0294] The DKO+STC1 cell line was used to detect the three germ layer differentiation ability. To generate mesoderm, endoderm, and ectoderm cells, the dissociated DKO+STC1 single cells were resuspended in three germ layer culture media with Y27632 added, and an appropriate amount of cells were attached to the cell climbing sheet coated with Matrigel in the well plate. After 24 h, the preheated differentiation medium was replaced, and the medium was changed every day until the seventh day to obtain mesoderm, endoderm, and ectoderm cells. The expression of three germ layer marker proteins was detected by immunofluorescence to detect the three germ layer differentiation ability of the DKO+STC1 cell line.

[0295] The results of immunofluorescence detection are shown in Figure 2. As shown, DKO+STC1 cells express ectoderm marker proteins PAX6 and GAD1, mesoderm marker proteins Brachyury and NCAM, and endoderm marker proteins SOX17 and FOXA2 at the protein level. Figure 16

[0296] This example detects the differentiation ability of DKO+STC1 cells. The specific detection method is as follows: 100 μL of a suspension of 5 x 10 5 DKO+STC1 cells was injected subcutaneously into immunodeficient mice (SCID Beige). When the volume of the teratoma was greater than 1.5 cm 3 , it was removed and paraffin sectioned and hematoxylin-eosin stained.

[0297] Figure 17 The results of teratoma formation ability detection are shown in Figure 3. It can be seen that DKO+STC1 cells form teratomas in vivo and differentiate into cells of the ectoderm, mesoderm and endoderm.

[0298] Example 5 Immune escape function of DKO+STC1 cell line

[0299] To verify the escape function of DKO+STC1 cells to different immune cells, NK cells and T cells+NK cells mixture were used for the experiment.

[0300] 5.1 Detection of immune escape function of DKO+STC1 cells using RTCA

[0301] The escape function of DKO+STC1 cells to different immune cells was detected by RTCA. The specific detection method is described in Example 2.3. The PBNK cells used were obtained by adding IL-2 to increase the proportion of NK cells during in vitro culture of PBMC (peripheral blood mononuclear cells, from SAILYBIO). The detection results are shown in Figure 4. In the NK cell killing experiment detected by RTCA, the DKO cells constructed in Example 1 were completely killed by NK cells, while the WT cells and DKO+STC1 cells successfully escaped (Figure 4(a) and (b)). In the mixed cell (PBNK) killing experiment of T cells+NK cells detected by RTCA, only DKO+STC1 cells successfully escaped, while WT cells and DKO cells were killed to varying degrees, of which DKO cells were completely killed (Figure 4(c) and (d)). Figures 18A-18D Figure 18A Figure 18B Figure 18C Figure 18D Figure 18B 18D

[0302] ​​​​​​​​5.2 Detection of NK cell IFN-γ spot secretion using Elispot

[0303] NK cell IFN-γ spot secretion was detected by Elispot to determine the immune escape function of DKO+STC1 cells. The specific operation method is as follows:

[0304] WT cells, DKO cells and DKO+STC1 cells were plated in 6-well plates at a specific density, and after 24 h, the culture medium was discarded and a specific number of NK cells were added for culture. After 24 h, the NK cells were collected for subsequent IFN-γ secretion detection, and at the same time, the remaining WT cells, DKO cells and DKO+STC1 cells after removal of NK cells were observed, and the results are shown in Figure 19 Compared with DKO cells, fewer WT cells and DKO+STC1 cells were killed by NK cells, indicating that the ability of DKO+STC1 cells to escape NK cell killing was significantly higher than that of DKO cells.

[0305] The NK cells collected after 24 h were plated in a 96-well plate coated with IFN-γ antibody and placed in a 37°C incubator for 24 h; after adding affinity antibody and streptavidin, the color development detection of IFN-γ secretion spots was performed.

[0306] The Elispot detection results are shown in Figure 20A and Figure 20B The number of spots formed by IFN-γ secreted by NK cells after co-culture with WT cells and DKO+STC1 cells was similar and significantly lower than that of DKO cells, indicating that overexpression of STC1 can offset the activation of NK cells caused by B2M / CIITA knockout.

[0307] 5.3 Detection of NK cell activity index using FACS

[0308] WT cells, DKO cells, DKO+STC1 cells were plated in 6-well plates at a specific density, and after 24 h, the culture medium was discarded and a specific number of NK cells were added for co-culture. After 24 h, the NK cells were collected and the cell surface activation index CD107a (Biolegend, 328620) was detected by FACS.

[0309] The FACS detection results are shown in Figure 21 DKO+STC1 cells and DKO cells can both reduce the activation of NK cells.

[0310] Example 6. Verification of immune escape of differentiated cells of DKO+STC1 cells

[0311] Cells were plated on Matrigel and when confluency reached 40%, the medium was changed to differentiation medium and changed daily. After outgrowth, cells were passaged onto 0.1% gelatin-coated dishes and passaged every 3 days, with daily medium changes, for a total of 10 days of differentiation.

[0312] The escape function of differentiated DKO+STC1 cells from NK cells was detected by RTCA. The specific detection method is described in Example 2.3.

[0313] The results are shown in Figures Figure 22A and Figure 22B , wherein Figure 22B is a multiple killing statistical chart. After differentiation, DKO cells were still completely killed by NK cells, while the differentiated cells of WT cells and DKO+STC1 cells successfully escaped the killing of NK cells.

[0314] Although the present application has been disclosed with reference to the preferred embodiments thereof, it is not intended to limit the application, and any person skilled in the art can make various modifications and improvements without departing from the spirit and scope of the application. Therefore, the scope of protection of the present application should be defined by the appended claims.

[0315] SEQUENCE LISTING

[0316]

[0317]

Claims

1. A low-immunogenic pluripotent stem cell, comprising: Reduced function of endogenous major histocompatibility class I (MHC-I) antigens compared to parental pluripotent stem cells; Reduced function of endogenous major histocompatibility class II (MHC-II) antigens compared to parental pluripotent stem cells; and Reduced sensitivity to NK cell killing compared to parental pluripotent stem cells, wherein the reduced sensitivity to NK cell killing is caused by increased expression of STC1 protein. The MHC-I antigen function is reduced by decreasing the activity of the B2M protein; The MHC-II antigen function is reduced by decreasing the activity of the CIITA protein; and The STC1 protein mentioned above is the human STC1 protein, and its amino acid sequence is the amino acid sequence shown in SEQ ID NO:

3.

2. The low immunogenic pluripotent stem cells of claim 1, wherein the B2M protein is a human B2M protein, and its amino acid sequence is the amino acid sequence shown in SEQ ID NO:

1.

3. The low immunogenic pluripotent stem cells of claim 1, wherein the CIITA protein is human CIITA protein, and its amino acid sequence is the amino acid sequence shown in SEQ ID NO:

2.

4. The low immunogenicity pluripotent stem cells of claim 1, comprising: One or more alterations that reduce the activity of endogenous B2M proteins; One or more alterations that reduce the activity of endogenous CIITA proteins; and One or more alterations that induce increased STC1 protein expression in the hypoimmunogenic pluripotent stem cells.

5. The low immunogenicity pluripotent stem cells of claim 4, comprising: One or more alterations that inactivate two alleles of the endogenous B2M gene; One or more alterations that inactivate two alleles of the endogenous CIITA gene; and One or more alterations that induce increased STC1 gene expression in the said low-immunogenic pluripotent stem cells.

6. A method for generating low-immunogenic pluripotent stem cells according to any one of claims 1-5, the method comprising: Reduce the activity of B2M protein in the pluripotent stem cells; Reduce the activity of CIITA protein in the pluripotent stem cells; and Increase the expression of a protein that reduces the sensitivity of the pluripotent stem cells to NK cell killing, wherein the protein is STC1 protein; and The STC1 protein mentioned above is the human STC1 protein, and its amino acid sequence is the amino acid sequence shown in SEQ ID NO:

3.

7. The method of claim 6, wherein the method comprises: Eliminate the activity of two alleles of the B2M gene in the pluripotent stem cells; Eliminate the activity of two alleles of the CIITA gene in the pluripotent stem cells; and Increase the expression of the STC1 gene in the pluripotent stem cells.

8. The method of claim 6, wherein the activity of B2M protein in the pluripotent stem cells and / or the activity of CIITA protein in the pluripotent stem cells are reduced by a technique selected from: Introduce gene expression modification molecules, clustered regularly spaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nucleases (TALEN) technology, zinc finger nucleases (ZFN) technology, or homologous recombination technology; The gene expression modification molecules mentioned above include siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotide ASO, or antimiRNA oligonucleotide AMO.

9. The method of claim 8, wherein Reduce the activity of B2M protein in the pluripotent stem cells using CRISPR / Cas9 gene editing technology with clustered regularly spaced short palindromic repeats; and / or The activity of CIITA protein in the pluripotent stem cells was reduced by CRISPR / Cas9 gene editing technology.

10. The method of any one of claims 6-9, wherein the expression of STC1 protein is increased by modifying an endogenous locus; wherein the modification of the endogenous locus includes modifying the endogenous locus by means of clustered regularly spaced short palindromic repeats (CRISPR), transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN) or homologous recombination.

11. The method of any one of claims 6-9, wherein the expression of STC1 protein is increased by the expression of the transgene.

12. The method of any one of claims 6-9, wherein a nucleic acid sequence encoding the STC1 protein is synthesized and constructed into a lentiviral vector, and at least one copy of the promoter-controlled STC1 gene is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the STC1 protein.

13. The method of claim 12, wherein the nucleic acid sequence encoding the STC1 protein is the nucleic acid sequence shown in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity with the nucleic acid sequence shown in SEQ ID NO:

4.

14. Use of the low immunogenic pluripotent stem cells of any one of claims 1-5 or the low immunogenic pluripotent stem cells prepared by the method of any one of claims 6-13 in the preparation of differentiated cells.

15. A differentiated cell derived from a low-immunogenic pluripotent stem cell of any one of claims 1-5 or a low-immunogenic pluripotent stem cell prepared by the method of any one of claims 6-13.

16. Use of the differentiated cells of claim 15 in the preparation of reagents for cell transplantation.

Images