Urinary microvesicle miRNA markers and their applications, and kits for diagnosing secondary glomerular diseases

Abstract

The present invention relates to the field of molecular diagnostic technology, and discloses a urine micron vesicle miRNA marker and its application, and a kit for diagnosing secondary glomerular disease. The urine micron vesicle miRNA marker is selected from at least one of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p. The urine micron vesicle miRNA marker provided by the present invention can be stably present in urine for a long time, is resistant to RNAse degradation, can be used for early diagnosis, individualized treatment and prognosis judgment of lupus nephritis, and provides possibility for the use of new biological preparations.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular diagnosis, and in particular to a urine micronized vesicle miRNA marker and application thereof, and a kit for diagnosing secondary glomerular diseases. Background Art

[0002] Systemic lupus erythematosus is a systemic autoimmune disease and a common connective tissue disease. Lupus nephritis is the most common complication of systemic lupus erythematosus and one of the main causes of death in patients with systemic lupus erythematosus. The clinical and pathological changes of lupus nephritis are diverse, with clinical manifestations ranging from proteinuria, hematuria to renal failure, and pathological changes ranging from mild mesangial hyperplasia to nephrosclerosis.

[0003] In terms of laboratory tests, urinalysis and serum creatinine tests are simple methods for detecting renal involvement in systemic lupus erythematosus, but they are not specific diagnostic methods. Non-invasive serological indicators for the diagnosis of the disease and judgment of treatment response mainly include anti-ds-DNA antibodies and complement levels. Currently, renal biopsy is the gold standard for diagnosing lupus nephritis, but this invasive procedure may cause bleeding, perinephric hematoma, and arteriovenous fistula, and some patients have contraindications to renal biopsy.

[0004] Therefore, it is of great significance to find specific biomarkers for early noninvasive diagnosis of lupus nephritis.

[0005] MicroRNA (miRNA) is a class of endogenous small RNAs with a length of about 18-24 nucleotides, which have a variety of important biological regulatory effects. Migrasomes are contractile fibers left behind at the rear end of the cell when it migrates. At the end or bifurcation of the contractile fibers, small vesicles with a diameter of 0.5-3μm will grow. Migrasomes contain varying numbers of small vesicles with a diameter of about 100nm. Intracellular proteins and other components can be released into the extracellular environment through migrasomes. More and more studies have shown that migrasome miRNA, especially urine migrasome miRNA, has great potential value for disease diagnosis and treatment monitoring.

[0006] However, for lupus nephritis, there has been no research on the use of urine migrasomes, i.e. miRNA encapsulated in urine microvesicles, as markers to assist in the diagnosis. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a urine micronized vesicle miRNA marker and its application for more accurate diagnosis, efficacy detection or prognosis judgment of lupus nephritis.

[0008] In order to achieve the above-mentioned object, the first aspect of the present invention provides a urine micron vesicle miRNA marker, which is selected from at least one of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p.

[0009] The second aspect of the present invention provides use of the urine microvesicle miRNA marker described in the first aspect in preparing a kit for detecting podocyte injury.

[0010] The third aspect of the present invention provides use of the urine microvesicle miRNA marker described in the first aspect in the preparation of a kit for diagnosing secondary glomerular diseases.

[0011] The fourth aspect of the present invention provides a kit for diagnosing secondary glomerular disease, which includes a reagent for identifying urine micron vesicle miRNA markers, wherein the urine micron vesicle miRNA markers are selected from at least one of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p.

[0012] The urine micronized vesicle miRNA marker provided by the present invention can be stably present in urine for a long time, is resistant to RNAse degradation, has a simple extraction method, can be used for early diagnosis, efficacy monitoring and prognosis judgment of lupus nephritis, and provides a possible target for the development of new drugs for individualized treatment.

[0013] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the quality inspection result of RNA extracted from urine microvesicles of lupus patients using Agilent 2100 bioanalyzer.

[0015] Figure 2 This is the quality inspection result of RNA extracted from urine microvesicles of healthy controls using Agilent 2100 bioanalyzer.

[0016] Figure 3 This is a heat map of miRNA sequencing in urine microvesicles of lupus nephritis patients and healthy controls;

[0017] Figure 4is qPCR detection of the expression level of hsa-miR-205-5p in urine microvesicles;

[0018] Figure 5 This is the KEGG biological function clustering diagram of urine microvesicle miRNAs target genes that are significantly differentially expressed in patients with lupus nephritis. DETAILED DESCRIPTION

[0019] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0020] As described above, the first aspect of the present invention provides a urine micron vesicle miRNA marker, which is selected from at least one of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p.

[0021] It should be noted that specific miRNA produced by specific cells can be secreted outside the cells through microvesicles. After the microvesicles transport the specific miRNA into the target cells, the secreted miRNA directly acts on the target molecule mRNA, and ultimately regulates the activity and function of the target cells by inhibiting the translation of its corresponding target gene in the receptor cells.

[0022] During the research process, the inventors found that the urine micronized vesicle miRNA marker provided by the present invention can serve as a type of microvesicle that specifically reflects podocyte damage, and thus can be used as a new molecular marker for lupus nephritis, thereby realizing early diagnosis, individualized treatment and prognosis judgment of lupus nephritis, which is of great significance for the non-invasive diagnosis of secondary glomerular diseases.

[0023] Among them, the nucleotide sequences of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p and hsa-miR-514a-3p are well known to those skilled in the art. For example, the nucleotide sequence of hsa-miR-21-5p is shown in SEQ ID NO:1; the nucleotide sequence of hsa-miR-205-5p is shown in SEQ ID NO:2; the nucleotide sequence of hsa-miR-135b-5p is shown in SEQ ID NO:3; the nucleotide sequence of hsa-miR-203a-3p is shown in SEQ ID NO:4; the nucleotide sequence of hsa-miR-223-5p is shown in SEQ ID NO:5; the nucleotide sequence of hsa-miR-138-5p is shown in SEQ ID NO: NO:6; the nucleotide sequence of hsa-miR-514a-3p is shown in SEQ ID NO:7.

[0024] SEQ ID NO:1:UAGCUUAUCAGACUGAUGUUGA

[0025] SEQ ID NO:2:UCCUUCAUUCCACCGGAGUCUG

[0026] SEQ ID NO:3:UAUGGCUUUUCAUUCCUAUGUGA

[0027] SEQ ID NO:4: GUGAAAUGUUUAGGACCACUAG

[0028] SEQ ID NO:5:UGUCAGUUUGUCAAAUACCCCA

[0029] SEQ ID NO:6: AGCUGGUGUUGUGAAUCAGGCCG

[0030] SEQ ID NO:7:AUUGACACUUCUGUGAGUAGA

[0031] It should be noted that the DNA sequence that can be transcribed into the miRNA provided by the present invention should also be considered to be within the protection scope of the present invention.

[0032] It should also be noted that after the technicians in this field understand the miRNA of the present invention and the DNA as above, the sequence addition, replacement, knockout and modification of the miRNA or DNA for conventional purposes such as amplification, enzyme digestion, vector construction, expression, etc. of the miRNA or DNA should be deemed to be within the scope of protection of the present invention.

[0033] As mentioned above, the second aspect of the present invention provides the use of the urine microvesicle miRNA marker described in the first aspect in the preparation of a kit for detecting podocyte injury.

[0034] As mentioned above, the third aspect of the present invention provides the use of the urine microvesicle miRNA marker described in the first aspect in the preparation of a kit for diagnosing secondary glomerular disease.

[0035] Preferably, the secondary glomerular disease is lupus nephritis.

[0036] As described above, the fourth aspect of the present invention provides a kit for diagnosing secondary glomerular disease, which kit includes a reagent for identifying urine micron vesicle miRNA markers, wherein the urine micron vesicle miRNA markers are selected from at least one of hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p.

[0037] The kit of the present invention can effectively and quantitatively detect hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p and hsa-miR-514a-3p, thereby assisting in the diagnosis of secondary glomerular diseases with high sensitivity and specificity.

[0038] According to the present invention, the kit also contains reagents for extracting RNA from urine microvesicles. The reagents for extracting RNA from urine microvesicles may include: Trizol, chloroform, isopropanol, anhydrous ethanol, DEPC water, miRNA detection probes (hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p and hsa-miR-514a-3p), reverse transcription reagents, and RT-qPCR reagents.

[0039] In one embodiment of the present invention, it relates to a method for diagnosing lupus nephritis, which includes: obtaining urine micron vesicles from a test sample (which may be urine); extracting miRNA from the urine micron vesicles; and quantitatively detecting hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p and hsa-miR-514a-3p. If at least one of the detected hsa-miR-21-5p, hsa-miR-205-5p, hsa-miR-135b-5p, hsa-miR-203a-3p, hsa-miR-223-5p, hsa-miR-138-5p, and hsa-miR-514a-3p is significantly different from the control sample, the individual corresponding to the test sample suffers from lupus nephritis.

[0040] The present invention will be described in detail below by way of examples. In the following examples, unless otherwise stated, the raw materials and instruments involved are all commercially available products.

[0041] Example 1

[0042] (1) Isolation of urine microvesicles

[0043] A total of 6 patients with lupus nephritis were randomly selected, including 3 males and 3 females with an average age of 34 years old. Gender- and age-matched healthy subjects were also selected as healthy controls.

[0044] Collect the patient's morning urine into a 50mL centrifuge tube, and immediately use a high-speed centrifuge (model thermo-50ml, purchased from Thermo LYNX4000* company) precooled at 4°C to centrifuge at 1000g for 10min, discard the precipitate and recover the supernatant, then centrifuge at 4000g for 20min, discard the precipitate and recover the supernatant, and then centrifuge at 20000g for 30min. The precipitate is the migratoria; dissolve the precipitate with 100μL PBS and collect it in a clean, enzyme-free 1.5ml Eppendorf tube (hereinafter referred to as "EP tube") for RNA extraction.

[0045] (2) Extraction of urine microvesicles

[0046] Add 1 ml of Reagent (Cat. No. 15596018, purchased from Invitrogen TMCompany) vortexed for 20s, let stand at room temperature for 10min; added 200μL of chloroform, vortexed for 20sec, let stand at room temperature for 10min; centrifuged at 16000g for 20min at 4℃; aspirated the supernatant into a new enzyme-free EP tube, added an equal volume of isopropanol, inverted to mix, let stand at room temperature for 10min; centrifuged at 16000g for 20min at 4℃, discarded the supernatant; then, added 1mL of ethanol prepared with 75% DEPC-treated water (purchased from ThermoFisher Scientific), vortexed to mix; centrifuged at 16000g for 20min at 4℃, discarded the supernatant and dried at room temperature; added 20μL of DEPC water to dissolve. RNA extracted from urine microvesicles of 6 patients with lupus nephritis was mixed into 1 tube for sequencing, and RNA extracted from urine microvesicles of 6 healthy controls was mixed into 1 tube for sequencing.

[0047] (5) RNA extraction and sequencing

[0048] The urine microvesicle RNA obtained above was tested by Agilent 2100 bioanalyzer. The test results are as follows: Figure 1 and Figure 2 .

[0049] in, Figure 1 This is the quality inspection result of RNA extracted from urine microvesicles of lupus patients using Agilent 2100 bioanalyzer. Figure 2 The figure shows the quality inspection results of RNA extracted from urine microvesicles of healthy controls using Agilent 2100 Bioanalyzer. Figure 1 and Figure 2 It can be seen that the RNA extracted from the urine microvesicles of lupus patients and healthy controls meets the detection standards.

[0050] The extracted RNA was then placed in a sequencer (MGISEQ-200 sequencer, purchased from MGI) for miRNA sequencing. The specific sequencing results are shown in Figure 2 and Table 1.

[0051] The present invention exemplarily provides a sequencing heat map of urine microvesicle miRNA in lupus nephritis patients and healthy subjects, see Figure 3 .

[0052] from Figure 3 It can be seen that compared with the expression model of urinary microvesicle miRNAs in healthy subjects, the expression levels of multiple urinary microvesicle miRNAs in patients with lupus nephritis were significantly increased.

[0053] Table 1

[0054]

[0055] It can be seen from the above table that compared with the healthy control group, the expression of 7 miRNAs in the urine microvesicles of lupus nephritis patients was significantly upregulated.

[0056] Example 2

[0057] To verify whether the urine micronized vesicle miRNA marker provided by the present invention is a marker for lupus nephritis, the present invention exemplarily provides a verification process of hsa-miR-205-5p, and the expression level of hsa-miR-205-5p in urine micronized vesicles of 20 normal control populations, 20 lupus nephritis patients, 20 IgA nephropathy patients and 20 membranous nephropathy patients is detected by qPCR.

[0058] (1) Experimental methods

[0059] 1) Reversal of hsa-miR-205-5p

[0060] The hsa-miR-205-5p in the microvesicles extracted from urine was reversed using ABI stem-loop primers (Cat. No. 000509, purchased from Thermo Fisher).

[0061] The reversal system of hsa-miR-205-5p (10 μL) is shown in Table 2:

[0062] Table 2

[0063] Reagents Volume (μL) AMV reverse transcriptase 0.5 dNTP Mixture 1 5×AMV buffer 2 hsa-miR-205-5p RT primers 1 DEPC water 3.5 RNA 2 Total 10.0μL

[0064] After the system is added, mix well and put into the PCR instrument for reaction. The reverse transcription program of hsa-miR-205-5p is shown in Table 3:

[0065] Table 3

[0066] temperature time 16℃ 30min 42℃ 30min 85℃ 5min 4℃ ∞

[0067] 2) qPCR detection of hsa-miR-205-5p expression level

[0068] After reverse transcription is completed, the matching qPCR probe is used for quantitative detection. The qPCR system (20 μL) of Taqman probe is shown in Table 4:

[0069] Table 4

[0070] Reagents Volume (μL) rTaq 0.3 dNTP mixture 0.4 <![CDATA[MgCl2]]> 1.2 10×PCR buffer 2.0 hsa-miR-205-5p Tm primers 0.33 <![CDATA[ddH2O]]> 14.77 cDNA 1.0 Total 20.0μL

[0071] The qPCR program for Taqman probes is shown in Table 5:

[0072] Table 5

[0073]

[0074]

[0075] (2) Experimental results

[0076] The results of the qPCR assay for hsa-miR-205-5p expression level are shown in Figure 4 ,exist Figure 4 In the figure, Normal refers to normal control population, LN refers to patients with lupus nephritis, IgAN refers to patients with IgA nephropathy, MN refers to patients with membranous nephropathy, *P<0.05; the left ordinate Absolute concentrations refers to absolute concentration. The results showed that the expression level of hsa-miR-205-5p in urine microvesicles of patients with lupus nephritis was significantly higher than that of normal control population, while the expression level of hsa-miR-205-5p in urine microvesicles of patients with IgA nephropathy and membranous nephropathy was not significantly different from that of normal control population. This result shows that hsa-miR-205-5p is a marker of lupus nephritis and can be used for early diagnosis, individualized treatment and prognosis of lupus nephritis.

[0077] Example 3

[0078] In this example, TargetScan (https: / / www.targetscan.org / vert_72 / ) was used to predict the target genes of the urine microvesicle miRNAs that were significantly differentially expressed between lupus nephritis patients and the control group (healthy subjects). The results of the TargetScan software predicting the target genes of the differentially expressed miRNAs in the urine microvesicles of lupus nephritis patients are shown in Table 6.

[0079] Table 6

[0080] miRNA types Number of target genes predicted by TargetScan software hsa-miR-21-5p 384 hsa-miR-205-5p 593 hsa-miR-135b-5p 848 hsa-miR-203a-3p 960 hsa-miR-223-5p 3610 hsa-miR-138-5p 704 hsa-miR-514a-3p 3520

[0081] The miRNA target genes predicted by TargetScan software were analyzed for signal pathway enrichment using the KEGG database (https: / / www.kegg.jp / ). The specific analysis results are shown in Figure 5 ,exist Figure 5 In the figure, the number of genes is represented by the size of the bubble. The larger the bubble, the more enriched genes there are.

[0082] exist Figure 5 In the figure, the English words on the left vertical axis are shown in Table 7 from top to bottom:

[0083] Table 7

[0084] Glycolysis / Gluconeogenesis Glycolysis / gluconeogenesis pathway Citrate cycle (TCA cycle) TCA cycle Pentose phosphate pathway Pentose phosphate pathway Pentose and glucuronate interconversions Pentose, glucuronic acid conversion Fructose and mannose metabolism Fructose and mannose metabolic pathways Galactose metabolism Galactose metabolism Ascorbate and aldarate metabolism Ascorbic acid and aldarate metabolism Fatty acid biosynthesis Fatty acid biosynthesis Fatty acid elongation Fatty acid elongation Fatty acid degradation Fatty acid degradation Synthesis and degradation of ketone bodies Synthesis and degradation of ketone bodies Steroid biosynthesis Steroid biosynthesis Primary bile acid biosynthesis Primary bile acid biosynthesis Ubiquinone and other terpenoid-quinone biosynthesis Biosynthetic pathways of ubiquinone and other terpenoid quinones Steroid hormone biosynthesis Steroid hormone biosynthesis Oxidative phosphorylation Oxidative phosphorylation Arginine biosynthesis Arginine biosynthesis Purine metabolism Purine metabolism Caffeine metabolism Caffeine metabolism Pyrimidine metabolism Pyrimidine metabolism

[0085] from Figure 5 It can be seen that the target genes predicted by the differentially expressed urinary micron vesicles miRNAs in patients with lupus nephritis are greatly enriched with multiple metabolism-related pathways, suggesting that the 7 miRNAs significantly differentially expressed in the urinary micron vesicles of patients with lupus nephritis play an important role in the occurrence and development of lupus nephritis.

[0086] It can be seen from the above results that the urine microvesicle miRNA markers provided by the present invention can be used for early diagnosis, individualized treatment and prognosis judgment of lupus nephritis, providing a possibility for the use of new biological agents.

[0087] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. Use of urine microvesicle miRNA markers in the preparation of a kit for diagnosing secondary glomerular diseases, characterized in that: The secondary glomerular disease is lupus nephritis; The urine microvesicle miRNA marker is hsa-miR-205-5p.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the hsa-miR-205-5p is shown in SEQID NO:2.

Images