A reporter gene plasmid vector, plasmid and application thereof for detecting transcriptional activity of promoter of Gram-negative bacteria

Abstract

The invention relates to the technical field of gene engineering, and in particular to a reporter gene plasmid vector, a plasmid and an application thereof for detecting the transcriptional activity of a promoter of gram-negative bacteria. The reporter gene plasmid vector of the invention comprises a pFA-Gm and / or a pFA-Kan plasmid, the pFA-Gm plasmid comprises a replicon element, a mob element and a screening marker gentamicin resistance gene, the two sides of a multiple cloning site region of the pFA-Gm plasmid respectively contain terminator regions T1 and T2 of an rrnB gene encoding ribosomal RNA of Escherichia coli, and the 3′ end direction of the multiple cloning site of the pFA-Gm plasmid contains a 1×Flag tag; the reporter gene plasmid is obtained by connecting a reporter gene fragment to a reporter gene plasmid vector; the invention realizes the evaluation of the transcriptional activity of a gene promoter in gram-negative bacteria by using the reporter gene plasmid, and has lower cost and operation difficulty than a real-time fluorescence quantitative PCR technology.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a reporter gene plasmid vector, a plasmid and an application thereof for detecting the transcription activity of a gram-negative bacterial promoter. Background Art

[0002] Promoters are located upstream of a gene's transcription start site, acting like a "twist switch." Their activity often determines the level of gene expression. In prokaryotes, transcription and translation occur simultaneously. Studying prokaryotic transcriptional regulation not only provides insights into gene function and the mechanisms of gene-gene interaction, but also allows for the reduction of pathogenicity by inhibiting or interfering with promoters, or for the significant increase in the production of certain secondary metabolites by activating promoters, thereby reducing production costs.

[0003] Currently, quantitative real-time PCR (qRT-PCR) is used to study promoter activity in prokaryotes. This protocol requires extraction of total bacterial RNA, reverse transcription into cDNA, and final qRT-PCR. This method is costly, difficult to perform, and has relatively low throughput. Summary of the Invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a reporter gene plasmid vector, plasmid and application for detecting the transcriptional activity of Gram-negative bacterial promoters, so as to solve the problems of high cost and difficulty in operation when using real-time fluorescence quantitative PCR technology for studying the activity of prokaryotic promoters.

[0005] In order to solve the above problems, the present invention adopts the following technical solutions:

[0006] To study prokaryotic promoter activity, a promoter can be fused to a reporter gene and its expression level directly observed to determine promoter activity. This method is simple and reproducible, making it suitable for large-scale screening in the early stages of research.

[0007] Reporter genes include: β-galactosidase lacZ gene, which can decompose the substrate X-gal and appear blue in solid culture medium; β-glucuronidase gusA gene, which can decompose the substrate X-gluc and appear blue in solid culture medium; β-lactamase bla gene, which can decompose the substrate nitrocefin, and the solution changes from yellow to red after hydrolysis; and various fluorescent protein genes such as gfp, rfp, etc., which show different intensities of fluorescence under a fluorescence microscope.

[0008] In a first aspect, the present invention provides a reporter gene plasmid vector for detecting the transcriptional activity of a Gram-negative bacterial promoter, comprising a pFA-Gm plasmid and / or a pFA-Kan plasmid;

[0009] The pFA-Gm plasmid includes a replicon element, a mob element, and a selection marker, a gentamicin resistance gene, wherein the replicon element includes pBBR1 OriV and pBBR1 Rep. The multiple cloning site region of the pFA-Gm plasmid contains terminator regions T1 and T2 of the rrnB gene encoding ribosomal RNA of Escherichia coli on both sides, and the 3′ end of the multiple cloning site of the pFA-Gm plasmid contains a 1×Flag tag. The multiple cloning site region contains multiple cloning sites SfcⅠ, PstⅠ, SphⅠ, HindⅢ, SalⅠ, XbaⅠ, BanⅠ, and KpnⅠ for inserting a promoter sequence.

[0010] The pFA-Kan plasmid is obtained by replacing the screening marker gentamicin resistance gene in the pFA-Gm plasmid with the screening marker kanamycin resistance gene.

[0011] Furthermore, the nucleotide sequence of the pFA-Gm plasmid is SEQ ID NO: 1.

[0012] Furthermore, the method of replacing the selection marker gentamicin resistance gene in the pFA-Gm plasmid with the selection marker kanamycin resistance gene comprises: using plasmid p34M as a template, amplifying the kanamycin resistance gene cassette on the p34M plasmid using primers F1 / R1 to obtain a DNA fragment F1R1; using the DNA fragment F1R1 as a primer and the pFA-Gm plasmid as a template, amplifying using Omega-PCR technology; after amplification, digesting the original plasmid template with Dpn I and introducing it into Escherichia coli Top10 competent cells through heat shock transformation for cultivation; picking a single clone for colony PCR verification, and screening the colonies after successful replacement of the selection marker to obtain the pFA-Kan plasmid;

[0013] The nucleotide sequence of the primer F1 / R1 is SEQ ID NO: 2-SEQ ID NO: 3;

[0014] The nucleotide sequence of the DNA fragment F1R1 is SEQ ID NO: 4.

[0015] In a second aspect, the present invention provides a reporter gene plasmid for detecting the transcriptional activity of a Gram-negative bacterial promoter, wherein the reporter gene plasmid is obtained by connecting a reporter gene fragment to the reporter gene plasmid vector; the reporter gene fragment includes a gusA reporter gene fragment, a bla reporter gene fragment, an egfp reporter gene fragment and / or an rfp reporter gene fragment; the reporter gene fragment is located downstream of the position where the promoter sequence is inserted.

[0016] Furthermore, the nucleotide sequences of the gusA, bla, egfp and rfp genes involved in the reporter gene fragment are SEQ ID NO: 5-SEQ ID NO: 8.

[0017] Furthermore, the gusA reporter gene fragment was obtained by PCR amplifying the gusA gene using the Escherichia coli MG1655 genome as a template and primers F2 / R2; the nucleotide sequence of the primers F2 / R2 is SEQ ID NO: 9-SEQ ID NO: 10;

[0018] The bla reporter gene fragment was obtained by PCR amplifying the bla gene using the pBAD24M plasmid as a template and primers F3 / R3; the nucleotide sequence of the primers F3 / R3 is SEQ ID NO: 11-SEQ ID NO: 12;

[0019] The egfp reporter gene fragment is obtained by PCR amplifying the egfp gene using primers F4 / R4 using the pET-eGfp plasmid as a template; the nucleotide sequence of the primers F4 / R4 is SEQ ID NO: 13-SEQ ID NO: 14;

[0020] The rfp reporter gene fragment was obtained by PCR amplifying the rfp gene using the pRP1028 plasmid as a template and primers F5 / R5; the nucleotide sequence of the primers F5 / R5 is SEQ ID NO: 15-SEQ ID NO: 16.

[0021] Furthermore, the reporter gene fragment is connected to the vector plasmid and introduced into Escherichia coli Top10 competent cells through heat shock transformation and cultured, single clones are picked for colony PCR verification, and positive recombinants are screened to obtain the reporter gene plasmid;

[0022] The nucleotide sequence of the colony PCR primer F6 / R6 used in the colony PCR verification is SEQ ID NO: 17-SEQ ID NO: 18.

[0023] In a third aspect, the present invention provides an application of the reporter gene plasmid, characterized in that it comprises:

[0024] Application in determining the transcriptional regulatory region of rpfF in Xanthomonas bacteria;

[0025] Application in screening transcription factors that affect gene transcription regulation in Gram-negative bacteria.

[0026] Furthermore, the application of determining the transcriptional regulatory region of rpfF in Xanthomonas bacteria includes:

[0027] The DNA sequence upstream of the rpfF start codon was amplified by PCR and cloned into a reporter gene plasmid. Promoters of different lengths were then inserted into the constructed reporter gene plasmids. The reporter gene activities of β-glucuronidase were compared in Xanthomonas bacteria.

[0028] Specifically include:

[0029] Using the genome of Xanthomonas campestris as a template, the promoter regions of the rpfF gene and the upstream gene rpfB were fused by overlap extension PCR to obtain a 1216 bp sequence containing dual promoters, the nucleotide sequence of which is SEQ ID NO: 23;

[0030] Amplify the 512 bp sequence upstream of the rpfF gene. The nucleotide sequence of the amplified sequence is SEQ ID NO: 25.

[0031] A 176 bp sequence upstream of the rpfF gene was amplified. The nucleotide sequence of the amplified sequence is SEQ ID NO: 27.

[0032] Sequences SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, and the reporter gene plasmid were digested with restriction endonucleases, rpfF promoter fragments of different lengths were ligated to the reporter gene plasmids, and then introduced into Escherichia coli Top10 competent cells via heat shock transformation and cultured. Single clones were selected for colony PCR verification to screen for positive recombinants.

[0033] The positive recombinant and the reporter gene plasmid are respectively introduced into Xanthomonas campestris by electroporation to obtain strains containing different reporter gene plasmids;

[0034] After reactivating the strain, the color development of the bacteria was observed and the fluorescence value was detected using solid NYG medium containing gentamicin and X-gluc to compare the GUS enzyme activity.

[0035] Furthermore, the application of the method in screening transcription factors that affect gene transcription regulation in Gram-negative bacteria includes:

[0036] Using the Tn5 transposition principle, DNA fragments of the Tn5 transposon sequence are randomly inserted into the genome of the target bacteria. Recombinants are screened based on changes in reporter gene expression levels. Finally, the insertion site of the Tn5 transposon is located using Tail-PCR.

[0037] Specifically include:

[0038] Pick a single colony of Xanthomonas campestris to prepare electroporation competent cells;

[0039] The pFA-PrpfF-1216-Gus-Kan reporter plasmid synthesized with the sequence SEQ ID NO: 23 was added to the electroporated competent cells, and after electroporation, the cells were cultured in NYG solid medium containing kanamycin and rifampicin, and single clones were picked for colony PCR verification;

[0040] Xanthomonas campestris carrying a reporter gene plasmid was cultured in NYG liquid medium containing kanamycin and rifampicin. Escherichia coli S17-1 carrying the plasmid pBT20(Tn5) was cultured in LB liquid medium containing ampicillin. The two bacterial cultures were then mixed, centrifuged, and cultured on antibiotic-free NYG solid medium.

[0041] The two bacteria were diluted and spread, with a dilution gradient of 10 -5 or 10 -6 , spread on NYG solid culture medium containing kanamycin, gentamicin, rifampicin and X-Gluc, screen for monoclonal clones that do not show blue, use Tail-PCR technology to amplify by PCR, and then recover fragments of 1-3Kb in size for sequencing, and obtain information on the insertion site by sequence alignment.

[0042] The beneficial effects of the present invention are: the present invention provides a reporter gene plasmid vector, plasmid and application for detecting the transcriptional activity of the promoter of Gram-negative bacteria, the plasmid can be replicated in a variety of Gram-negative bacteria and has a wide range of applications. It also integrates two screening markers: gentamicin resistance (Gm R ), kanamycin resistance (Kanamycin resistance R ) and four reporter genes: gusA, bla, egfp, and rfp. In actual use, appropriate screening markers and reporter genes can be selected for research. If there are special needs, the screening markers and reporter genes on the plasmid can be further replaced. The MCS region upstream of the reporter gene contains multiple cloning sites SfcⅠ, PstⅠ, SphⅠ, HindⅢ, SalⅠ, XbaⅠ, BanⅠ, and KpnⅠ. The promoter sequence to be studied can be directly inserted through enzyme ligation or seamless cloning. The operation is convenient and the promoter sequence can be easily replaced and modified. The 3′ end of the reporter gene contains a 1×Flag tag. If necessary, the reporter gene can be detected by protein immunoblotting (Western Blot) experiment, which provides an additional research method. In addition, the terminators T2 and T1 are contained upstream and downstream of the reporter gene, respectively. As effective transcription terminators, they can eliminate interference with the reporter gene and make the experimental results more accurate and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of the construction of plasmid pFA-Gm in Example 1 of the present invention.

[0044] Figure 2 Schematic diagram of the construction of the reporter gene plasmid in Example 1 of the present invention.

[0045] Figure 3 Schematic diagram of the reporter gene plasmid structure in Example 1 of the present invention.

[0046] Figure 4 Schematic diagram of inserting promoters of different lengths into the reporter gene plasmid in Example 2 of the present invention.

[0047] Figure 5 This is a diagram showing the qualitative and quantitative detection results of GUS enzyme activity in Example 2 of the present invention.

[0048] Figure 6 Schematic diagram of screening strain Xcc8004::Tn5 / pFA-PrpfF-1216-Gus-Kan with reduced GUS enzyme activity in Example 3 of the present invention. DETAILED DESCRIPTION

[0049] The present invention will be further described in detail below with reference to specific embodiments.

[0050] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.

[0051] The materials used in the following examples include:

[0052] Escherichia coli MG1655, Top10, and S17-1 were deposited by our institution.

[0053] Plasmids p34M, pBAD24M, pET-eGfp, and pRP1028 were deposited by our institution.

[0054] The pFA series reporter gene plasmids are constructed by the present invention.

[0055] Ligase, PCR high-fidelity enzyme and other reagents were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0056] Restriction endonucleases were purchased from New England Biotechnology (Beijing) Co., Ltd.

[0057] PCR primers were synthesized by the Guangzhou Branch of Sangon Biotechnology (Shanghai) Co., Ltd.

[0058] Example 1

[0059] Construction of pFA reporter system plasmids

[0060] The pFA-Gm plasmid is deposited by our institution. The replicon element, mob element, and selection marker gentamicin resistance gene on this plasmid are all derived from the pSRK-Gm plasmid (Khan et al., 2008). The replicon elements pBBR1 OriV and pBBR1Rep are derived from a broad-host replication plasmid pBBR1 isolated from Bordetella bronchiseptica. This plasmid has been shown to be able to replicate autonomously in a wide range of Gram-negative bacteria. The pFA-Gm plasmid contains the terminator regions T1 and T2 of the rrnB gene encoding ribosomal RNA of Escherichia coli on both sides of the multiple cloning site (MCS). This sequence is often used as an effective terminator for transcription. It also contains a 1×Flag tag at the 3′ end of the multiple cloning site (MCS). This sequence is artificially synthesized. For its specific structure, see Figure 1 The full length of the pFA-Gm plasmid is 4311 bp, and the specific nucleotide sequence is SEQ ID NO: 1.

[0061] To enrich the selection markers, the present invention uses Omega-PCR technology to convert the gentamicin resistance (Gm R ) is replaced by kanamycin resistance (Kan R ) to obtain plasmid pFA-Kan. The specific steps are as follows:

[0062] Plasmid p34M was used as a template for PCR amplification of the kanamycin resistance gene cassette. Primers F1 / R1 were designed with 21 bp of homologous sequences upstream and downstream of the replacement region in the pFA-Gm plasmid at their 5' ends. The nucleotide sequences of primers F1 / R1 are SEQ ID NOs: 2 and 3. A 968-bp DNA fragment F1R1 was obtained by PCR amplification (amplification system (50 μL): 25 μL 2× PrimeStar Premix, 2 μL each of primers F1 and R1, 1 μL of plasmid template, 20 μL sterile water; amplification conditions: 98°C predenaturation for 2 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, 72°C extension for 10 s, 32 cycles). The nucleotide sequence of DNA fragment F1R1 is SEQ ID NO: 4. The PCR product was purified and recovered, and amplified using the fragment as primer and the pFA-Gm plasmid as template using Omega-PCR technology (20 μL amplification system: 5× PrimeSTAR Buffer 4 μL, dNTP Mixture 2 μL, DNA fragment F1R 11 μL, plasmid template 1 μL, PrimeSTAR HSDNA Polymerase 0.2 μL, sterile water 11.8 μL; amplification conditions: first step 96°C 1 min; second step 96°C 45 s, 58°C 30 s, 72°C 4 min, cycle number 5; third step 96°C 45 s, 68°C 4 min, cycle number 23; 25°C hold). After Omega-PCR amplification, the pFA-Gm plasmid template was digested with Dpn I (25 μL of digestion system: 2.5 μL of 10× buffer, 20 μL of Omega-PCR product, 1 μL of Dpn I, 1.5 μL of sterile water; reaction at 37°C for 1 hour). The plasmid was then transformed into competent E. coli Top10 cells via heat shock (transformation conditions: 25 μL of digestion product, 100 μL of competent cells, incubate on ice for 30 minutes, heat shock for 90 seconds, incubate on ice for 30 minutes, incubate in 1 mL of antibiotic-free LB medium, incubate at 37°C for 1 hour, then plate all cells in LB medium containing kanamycin and culture for 1-2 days). Single colonies were selected for colony PCR verification. After successful replacement of the resistance selection marker, the plasmid was named pFA-Kan.

[0063] F1 (SEQ ID NO: 2):

[0064] CCGTGGAAACGGATGAAGGCA AAAGCCACGTTGTGTCTC.

[0065] R1 (SEQ ID NO: 3):

[0066] GATCTCGGCTTGAACGAATTG TTAGAAAAACTCATCGAGCATC.

[0067] The MCS regions of plasmids pFA-Gm and pFA-Kan were further modified by inserting β-glucuronidase gene (gusA), β-lactamase gene (bla), enhanced green fluorescent protein gene (egfp) and red fluorescent protein gene (rfp) as reporter genes, respectively, and redesigning the new multiple cloning site (MCS).

[0068] The gusA gene was amplified by PCR using the Escherichia coli MG1655 genome as a template. The nucleotide sequence is shown in SEQ ID NO: 5. Primers F2 / R2 were designed with a multiple cloning site (MCS) at the 5' end of the upstream primer and the gusA start codon (atg) removed. The downstream primer had an Xho I restriction site and a 1× Flag tag at the 5' end, and the gusA stop codon (tga) removed. The primer sequences are as follows. A DNA fragment of 1878 bp was obtained by PCR amplification (50 μL: 2× PrimeStar Premix 25 μL, 2 μL each of primers F2 and R2, 1 μL of genomic template, 20 μL of sterile water; amplification conditions: 98°C predenaturation for 2 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, and 72°C extension for 15 s, for 32 cycles). The resulting PCR product was purified and recovered.

[0069] F2 (SEQ ID NO: 9):

[0070] AA CTGCAGGCATGCAAGCTTGTCGACTCTAGACCGGGTACC TTAC GTCCTGTAGAAACC.

[0071] R2 (SEQ ID NO: 10):

[0072] CCG CTCGAG CTTATCGTCGTCATCCTTGTAATCGATTTGTTTGCCTC

[0073] CCTGCTG.

[0074] Using the pBAD24M plasmid (Zhu et al., 2010) as a template, PCR amplification of the bla gene from this plasmid was performed. The nucleotide sequence is shown in SEQ ID NO:6. Primers F3 / R3 were designed with a multiple cloning site (MCS) at the 5' end of the upstream primer and the signal peptide sequence and start codon (atg) of the bla gene removed. The downstream primer had an Xho I restriction site and a 1× Flag tag at its 5' end, and the stop codon (taa) of the bla gene removed. The primer sequences are as follows. An 861-bp DNA fragment was obtained by PCR amplification (50 μL: 2× PrimeStar Premix 25 μL, 2 μL each of primers F3 and R3, 1 μL of plasmid template, 20 μL of sterile water; amplification conditions: 98°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, and 72°C extension for 10 s, for 32 cycles). The resulting PCR product was purified and recovered.

[0075] F3 (SEQ ID NO: 11):

[0076] AA CTGCAGGCATGCAAGCTTGTCGACTCTAGACCGGGTACC CACC CAGAAACGCTGGTG.

[0077] R3 (SEQ ID NO: 12):

[0078] CCG CTCGAG CTTATCGTCGTCATCCTTGTAATCGATCCAATGCTTAA TCAGTGAG.

[0079] Using the pET-eGfp plasmid as a template, PCR amplification of the egfp gene from the plasmid was performed. The nucleotide sequence is shown in SEQ ID NO:7. Primers F4 / R4 were designed with a multiple cloning site (MCS) sequence at the 5' end of the upstream primer and the egfp gene start codon, atg, removed. The downstream primer had an Xho I restriction site at its 5' end, a 1× Flag tag, and the egfp gene stop codon, taa, removed. The primer sequences are as follows. A 786-bp DNA fragment was obtained by PCR amplification (amplification system (50 μL): 2× PrimeStar Premix (25 μL), 2 μL each of primers F4 and R4, 1 μL of plasmid template, 20 μL of sterile water; amplification conditions: 98°C predenaturation for 2 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, and 72°C extension for 10 s, for 32 cycles). The resulting PCR product was purified and recovered.

[0080] F4 (SEQ ID NO: 13):

[0081] AA CTGCAGGCATGCAAGCTTGTCGACTCTAGACCGGGTACC GTGA GCAAGGGCGAGGAG.

[0082] R4 (SEQ ID NO: 14):

[0083] CCG CTCGAG CTTATCGTCGTCATCCTTGTAATCGATCTTGTACAGCT CGTCCATG.

[0084] Using the pRP1028 plasmid as a template, PCR amplification of the rfp gene from the plasmid was performed. The nucleotide sequence is shown in SEQ ID NO:8. Primers F5 / R5 were designed with a multiple cloning site (MCS) sequence at the 5' end of the upstream primer and the rfp gene start codon (atg) removed. The downstream primer had an Xho I restriction site at its 5' end, a 1× Flag tag, and the rfp gene stop codon (taa) removed. The primer sequences are as follows. A 780-bp DNA fragment was obtained by PCR amplification (50 μL: 2× PrimeStar Premix 25 μL, 2 μL each of primers F5 and R5, 1 μL of plasmid template, 20 μL of sterile water; amplification conditions: 98°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, and 72°C extension for 10 s, for 32 cycles). The resulting PCR product was purified and recovered.

[0085] F5 (SEQ ID NO: 15):

[0086] AA CTGCAGGCATGCAAGCTTGTCGACTCTAGACCGGGTACC CGTG GATCAGGATCTATG.

[0087] R5 (SEQ ID NO: 16):

[0088] CCG CTCGAG CTTATCGTCGTCATCCTTGTAATCGATTCTATGCCCTA ATTTACTAGG.

[0089] The recovered gusA gene fragment, bla gene fragment, egfp gene fragment, rfp gene fragment, pFA-Gm plasmid, and pFA-Kan plasmid were digested with restriction endonucleases PstⅠ and XhoⅠ, respectively (enzyme digestion system: 100 μL: fragment or plasmid 60 μL, 10× enzyme digestion buffer 10 μL, PstⅠ2 μL, XhoⅠ2 μL, sterile water 26 μL). After the enzyme digestion products were purified and recovered, the reporter gene fragments were ligated to the pFA-Gm and pFA-Kan vectors, respectively (ligation system: 20 μL: 10× ligase buffer 2 μL, Takara T4 ligase 1 μL, enzyme-digested vector 3 μL, enzyme-digested fragment 10 μL, sterile water 4 μL, ligation at 16°C for 3 h). The ligation system was introduced into Escherichia coli Top10 competent cells by heat shock transformation (transformation conditions were: 20 μL of ligation product, 100 μL of competent cells, ice bath for 30 min, heat shock for 90 s, ice bath for 30 min, 1 mL of antibiotic-free LB liquid medium, and culture at 37°C for 1 h); if the vector was pFA-Gm, the cells were spread on LB solid medium containing gentamicin; if the vector was pFA-Kan, the cells were spread on LB solid medium containing kanamycin, and cultured at 37°C for 1-2 days. Single clones were picked for colony PCR verification (10 μL amplification system: 2× Taq enzyme mix 5μL, 1μL recombinant bacterial solution, 0.5μL primers F6 and R6, 3μL sterile water; amplification conditions: 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 53℃ annealing for 30s, 72℃ extension for 1min; program cycle number: 30 cycles). The sequence of colony PCR primers F6 / R6 is as follows. The positive recombinants obtained by screening were sent to the Guangzhou Branch of Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The construction diagram of the reporter plasmid is shown in the figure below. Figure 2 As shown. A set of reporter gene plasmids pFA-Gus-Gm, pFA-Gus-Kan, pFA-Bla-Gm, pFA-Bla-Kan, pFA-eGfp-Gm, pFA-eGfp-Kan, pFA-Rfp-Gm, pFA-Rfp-Kan were obtained for the detection of promoter activity in Gram-negative bacteria, as shown in FIG. Figure 3 shown.

[0090] F6 (SEQ ID NO: 17): TAACGACCCTGCCCTGAAC.

[0091] R6 (SEQ ID NO: 18): TGCCTTCATCCGTTTCCAC.

[0092] Example 2

[0093] Xanthomonas bacteria are typical plant pathogens. The production of their virulence factors is closely related to the quorum sensing system mediated by the DSF family signal, encoded by the gene cluster rpfBFCG. The main function of the rpfF gene is to encode the DSF family signal molecule synthase. To determine the transcriptional regulatory region of rpfF, the present invention uses Xanthomonas campestris pv. Campestris 8004 (hereinafter referred to as Xcc8004) as an example, PCR amplifies DNA sequences of varying lengths upstream of the rpfF start codon, and clones them into the reporter gene plasmid pFA-Gus-Gm constructed by the present invention (which can also be other plasmids such as pFA-Gus-Kan, pFA-Bla-Gm, and pFA-Bla-Kan). Reporter gene plasmids with promoters of different lengths are respectively introduced into Xcc8004, and the transcriptional activity of the promoter regions of different lengths is analyzed by comparing the enzymatic activity of the reporter gene β-glucuronidase.

[0094] See the schematic diagram Figure 4 The specific process is as follows:

[0095] (1) The rpfB gene is located upstream of the rpfF gene. The promoter regions of rpfB and rpfF were fused by overlap extension PCR to obtain a 1216 bp sequence containing dual promoters. The procedure was as follows: Using the Xcc8004 genome as a template, primers F7 / R7 were used to amplify the 704 bp sequence, including the first 276 bp of the 5′ end of the rpfB gene and the 428 bp upstream of it. Primers F8 / R8 were used to amplify the 512 bp sequence upstream of the rpfF gene. When designing primers, the upstream primer F7 contained the restriction site HindⅢ, and the downstream primer R8 contained the restriction site KpnⅠ. Primers R7 and R8 formed a pair of complementary primers. Overlap extension PCR technology was used to amplify the recovered fragments F7R7 and F8R8 using templates and primers F7 / R8 (amplification system 50 μL: 2× PrimeStar Premix 25 μL, 2 μL each of primers F7 and R8, 1 μL each of fragments F7R7 and F8R8, 20 μL of sterile water; amplification conditions: 98°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, 72°C extension for 15 s, 32 cycles). Fragments F7R7 and F8R8 were merged into a 1216 bp long fragment F7R8, which contains the rpfB and rpfF dual promoters, with the nucleotide sequence of SEQ ID NO: 23. The obtained fragment was purified and recovered.

[0096] (2) Amplification of the 512 bp upstream sequence of the rpfF gene: Using the Xcc8004 genome as a template, primers F9 / R8 were used for amplification. The upstream primer F9 contained a HindIII restriction site. The PCR product was purified and recovered to yield DNA fragment F9R8, the nucleotide sequence of which is SEQ ID NO: 25.

[0097] (3) Amplification of the 176-bp upstream sequence of the rpfF gene: Using the recovered fragment F9R8 as a template, primers F10 / R8 were used for amplification. The upstream primer F10 was designed to contain a HindIII restriction site. The PCR product was purified to recover the DNA fragment F10R8, the nucleotide sequence of which is SEQ ID NO: 27.

[0098] F7 (SEQ ID NO: 19):

[0099] CAGT AAGCTT TCAGCAACACGCTGAAGCGC.

[0100] R7 (SEQ ID NO: 20):

[0101] CGATATAGACGAAGCCACGGTATTGCAGGCAGTTGGGC.

[0102] F8 (SEQ ID NO: 21):

[0103] GCCCAACTGCCTGCAATACCGTGGCTTCGTCTATATCG.

[0104] R8 (SEQ ID NO: 22):

[0105] GCTC GGTACC CATGGTGGTTCTCCGTGAGAC.

[0106] F9 (SEQ ID NO: 24):

[0107] ATGC AAGCTT GTCTATATCGTCGACCGCAAG.

[0108] F10 (SEQ ID NO: 26):

[0109] ATGC AAGCTT CCAACCGTGCAACCGCAG.

[0110] (4) The recovered fragments F7R8, F9R8, F10R8 and plasmid pFA-Gus-Gm were digested with restriction endonucleases HindⅢ and KpnⅠ, respectively (enzyme digestion system: 100 μL: fragment or plasmid 60 μL, 10× enzyme digestion buffer 10 μL, HindⅢ 2 μL, KpnⅠ 2 μL, sterile water 26 μL). After the enzyme digestion products were purified and recovered, the promoter fragments of rpfF of different lengths were ligated to the pFA-Gus-Gm plasmid vector (ligation system: 20 μL: 10× ligase buffer 2 μL, Takara T4 ligase 1 μL, enzyme-digested vector 3 μL, enzyme-digested fragment 10 μL, sterile water 4 μL, ligation at 16°C for 3 h). The ligation system was introduced into Escherichia coli Top10 competent cells by heat shock transformation (transformation conditions were: 20 μL of enzyme digestion product, 100 μL of competent cells, ice bath for 30 min, heat shock for 90 s, ice bath for 30 min, 1 mL of antibiotic-free LB liquid medium, culture at 37°C for 1 h, then all the bacteria were spread on LB solid medium containing gentamicin and cultured at 37°C for 1 day). Single clones were picked for colony PCR verification, and the gusA reporter gene plasmids pFA-PrpfF-1216-Gus-Gm, pFA-PrpfF-512-Gus-Gm, and pFA-PrpfF-176-Gus-Gm under the control of rpfF promoter regions of different lengths were screened.

[0111] (5) The plasmids pFA-PrpfF-1216-Gus-Gm, pFA-PrpfF-512-Gus-Gm, pFA-PrpfF-176-Gus-Gm, and pFA-Gus-Gm were respectively introduced into Xanthomonas campestris Xcc8004 by electroporation to obtain strains containing different reporter gene plasmids.

[0112] (6) After reactivating the strain, pick a single colony and dissolve it in 100 μL of sterile water. After mixing, take 3 μL of the bacterial solution and spot it on solid NYG medium containing gentamicin and X-gluc. Incubate at 30°C for 36-48 hours and observe the color development of the bacteria.

[0113] (7) After reactivating the strain, pick a single colony and place it in 5 mL of NYG liquid medium containing rifampicin and gentamicin, and shake and culture it at 30°C with 200 rpm for 24 h; take 100 μL of the bacterial solution and transfer it to 5 mL of NYG liquid medium containing rifampicin, and shake and culture it at 30°C with 200 rpm until the OD 600Stop the culture when the value is approximately 1.0. Ultrasonicate the cells to extract total protein and determine the protein content. Add 50 μL of GUS-containing enzyme solution to 450 μL of 2 mmol / L MUG solution. Incubate at 37°C for 15 minutes, then add 50 μL of the reaction solution to 950 μL of 0.2 mol / L Na2CO3 solution to terminate the reaction. Fluorescence is measured using a microplate reader at an excitation wavelength of 365 nm and an emission wavelength of 455 nm to compare GUS enzyme activity.

[0114] By comparing the activities of promoters of different lengths, we can identify or analyze whether these promoter regions contain regulatory regions. Figure 5 The results of qualitative GUS enzyme activity testing clearly show that when promoter sequences of varying lengths are inserted before the reporter gene GUS, GUS enzyme activity exhibits a gradient of activity. Furthermore, without the promoter inserted, the gusA gene is not expressed. Both qualitative and quantitative GUS enzyme activity tests showed consistent trends.

[0115] Example 3

[0116] The present invention can also be achieved by the following technical solution to screen regulatory factors that affect gene transcription in Gram-negative bacteria. First, the reporter gene plasmid is electroporated and introduced into the target bacteria. Using the Tn5 transposition principle, the Tn5 transposon sequence (containing the gentamicin resistance Gm R ) DNA fragments were randomly inserted into the genome of the target bacteria. Corresponding recombinants were screened based on changes in reporter gene expression levels. Finally, the insertion site of the Tn5 transposon was located using Tail-PCR, providing guidance for further research. This study used screening for genes that inhibit the activity of the Xcc8004 rpfF promoter as an example, using the reporter gene plasmid pFA-PrpfF-1216-Gus-Kan for detection. The specific steps were as follows:

[0117] (1) Preparation of electroporated competent cells: a single colony of Xanthomonas campestris Xcc8004 was placed in 5 mL of NYG liquid medium containing rifampicin antibiotics, and cultured at 30°C with a shaker at 200 rpm for 24 h; 100 μL of the bacterial solution was transferred to 5 mL of NYG liquid medium containing rifampicin antibiotics, and cultured at 30°C with a shaker at 200 rpm until the OD 600 Stop the culture when the value is about 0.6, and dispense 1 mL into pre-cooled sterile 1.5 mL centrifuge tubes and place them on ice for 10 min; centrifuge at 4°C, 6000 rpm for 10 min, discard the supernatant and retain the bacteria, add 1 mL of pre-cooled 10% glycerol, gently pipette to mix the bacteria, and repeat this step three times; for the last centrifugation, retain about 100 μL of supernatant and gently pipette to resuspend the bacteria to obtain electroporation competent cells.

[0118] (2) Electroporation: Add 10 μL of the reporter gene plasmid pFA-PrpfF-1216-Gus-Kan to the freshly prepared electroporation competent cells and incubate on ice for 10 min. Transfer the mixture to a 2 mm gap electroporation cuvette and set the instrument voltage to 2500 V for electroporation. Add 1 mL of antibiotic-free NYG liquid medium to the electroporation cuvette, gently suspend the bacteria at the bottom of the electroporation cuvette, and transfer them to a sterile 1.5 mL centrifuge tube. Incubate the cells at 200 rpm on a shaker at 30°C for 3 h, then spread the cells on NYG solid medium containing kanamycin and rifampicin and incubate at 30°C for 2-3 days. Pick a single clone for colony PCR verification to obtain the strain Xcc8004 / pFA-PrpfF-1216-Gus-Kan.

[0119] (3) Combined transformation and introduction of plasmid pBT20 (Tn5): Pick up wild Xanthomonas campestris Xcc8004 carrying the reporter gene plasmid pFA-PrpfF-1216-Gus-Kan and culture it in 5 mL of NYG liquid medium containing kanamycin and rifampicin at 30°C with shaking at 200 rpm for 1-2 days; pick up Escherichia coli S17-1 carrying plasmid pBT20 (Tn5) and culture it in 5 mL of LB liquid medium containing ampicillin and culture it in a shaker at 37°C with shaking at 200 rpm overnight; take 500 μL of each of the two bacterial solutions into a sterile 1.5 mL centrifuge tube, centrifuge at 6000 rpm for 5 minutes, discard the supernatant and retain the bacteria; add 200 μL of anti-NYG medium to resuspend the bacteria, add all of it dropwise to the anti-NYG solid medium, and culture it upright at 30°C for 1-2 days.

[0120] (4) Dilution and coating: scrape an appropriate amount of bacterial moss into 1 mL of sterile water, vortex mix, take 100 μL of bacterial solution and dilute it in 900 μL of sterile water, repeat this step until the dilution gradient is 10 -5 or 10 -6 100 μL of the diluted bacterial solution was spread on NYG solid medium containing kanamycin, gentamicin, rifampicin, and X-Gluc, and cultured at 30°C for 2-3 days. Single clones with no blue or lighter blue color were selected and named Xcc8004::Tn5 / pFA-PrpfF-1216-Gus-Kan. Figure 6 shown.

[0121] (5) Tail-PCR: To identify the location of the Tn5 transposon insertion in the genome of the single clones screened in the previous step that showed no blue or a lighter blue color, tail-PCR was used. After PCR amplification, a fragment of approximately 2 kb was recovered and sent to the company for sequencing. Sequence alignment revealed the genetic information of the Tn5 insertion site in strain Xcc8004::Tn5 / pFA-PrpfF-1216-Gus-Kan.

[0122] Dilution plating revealed a significant decrease in the GUS enzyme activity of some monoclonal clones, suggesting that the Tn5 transposon may have inserted into a gene in the genome of Xanthomonas campestris Xcc8004, thereby affecting the activity of the rpfF gene promoter. Using Tail-PCR, we can precisely locate the Tn5 transposon insertion site and identify candidate transcription factor-encoding genes, providing guidance for subsequent research on the transcriptional regulation of the rpfF gene.

[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. Application of reporter gene plasmid, characterized in that, The application is: Application in determining the transcriptional regulatory region of rpfF in Xanthomonas bacteria or in screening transcription factors affecting gene transcriptional regulation in Gram-negative bacteria; The reporter gene plasmid is obtained by connecting the reporter gene fragment to the reporter gene plasmid vector, the reporter gene plasmid vector includes the pFA-Gm plasmid and / or the pFA-Kan plasmid, the pFA-Kan plasmid is obtained by replacing the selection marker gentamicin resistance gene in the pFA-Gm plasmid with the selection marker kanamycin resistance gene, and the nucleotide sequence of the pFA-Gm plasmid is SEQ ID NO: 1; The application of determining the transcriptional regulatory region of rpfF in Xanthomonas bacteria comprises: Using the genome of Xanthomonas campestris as a template, the promoter regions of the rpfF gene and the upstream gene rpfB were fused by overlap extension PCR technology to obtain a 1216 bp sequence containing dual promoters, the nucleotide sequence of which is SEQ ID NO: 23; Amplify the 512 bp sequence upstream of the rpfF gene, and the nucleotide sequence of the amplified sequence is SEQ ID NO: 25; Amplify the 176 bp sequence upstream of the rpfF gene, and the nucleotide sequence of the amplified sequence is SEQ ID NO: 27; The sequences SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27 and the reporter gene plasmid were digested with restriction endonucleases, rpfF promoter fragments of different lengths were connected to the reporter gene plasmids respectively, and then introduced into Escherichia coli Top10 competent cells by heat shock transformation and cultured, single clones were picked for colony PCR verification, and positive recombinants were screened; The positive recombinant and the reporter gene plasmid are respectively introduced into Xanthomonas campestris by electroporation to obtain strains containing different reporter gene plasmids; After reactivating the strain, the color development of the bacteria and the fluorescence value were observed using solid NYG medium containing gentamicin and X-gluc to compare the GUS enzyme activity; The application of the method in screening transcription factors that affect gene transcription regulation in Gram-negative bacteria includes: Pick a single colony of Xanthomonas campestris to prepare electroporation competent cells; The pFA-PrpfF-1216-Gus-Kan reporter gene plasmid synthesized with the sequence SEQ ID NO: 23 was added to the electroporation competent cells, and after electroporation, the cells were cultured in a NYG solid medium containing kanamycin and rifampicin, and single clones were picked for colony PCR verification; The wild Xanthomonas campestris carrying the reporter gene plasmid was selected and cultured in a NYG liquid medium containing kanamycin and rifampicin, and the Escherichia coli S17-1 carrying the plasmid pBT20 was selected and cultured in an LB liquid medium containing ampicillin, and then the two bacterial liquids were mixed and centrifuged to obtain the bacterial cells, and cultured on a non-antibiotic NYG solid medium; The two bacteria were diluted and spread, and the dilution gradient was 10 -5 or 10 -6 , spread on NYG solid culture medium containing kanamycin, gentamicin, rifampicin and X-Gluc, screen for single clones that do not show blue, use Tail-PCR technology to amplify by PCR, and then recover fragments of 1-3Kb in size for sequencing, and obtain the information of insertion site by sequence alignment.

2. The use of the reporter gene plasmid according to claim 1, characterized in that: The pFA-Gm plasmid comprises a replicon element, a mob element and a screening marker gentamicin resistance gene, wherein the replicon element comprises pBBR1 OriV and pBBR1 Rep, the two sides of the multiple cloning site region of the pFA-Gm plasmid respectively contain the terminator regions T1 and T2 of the rrnB gene encoding ribosomal RNA of Escherichia coli, and the 3′ end direction of the multiple cloning site of the pFA-Gm plasmid contains a 1×Flag tag; the multiple cloning site region contains multiple cloning sites SfcⅠ, PstⅠ, SphⅠ, HindⅢ, SalⅠ, XbaⅠ, BanⅠ and KpnⅠ, which are used for inserting a promoter sequence.

3. The use of the reporter gene plasmid according to claim 1, characterized in that: The step of replacing the screening marker gentamicin resistance gene in the pFA-Gm plasmid with the screening marker kanamycin resistance gene comprises: Using plasmid p34M as a template, primers F1 / R1 were used to amplify the kanamycin resistance gene cassette on the p34M plasmid to obtain DNA fragment F1R1; The DNA fragment F1R1 is used as a primer, and the pFA-Gm plasmid is used as a template to amplify using Omega-PCR technology. After amplification, the original plasmid template is digested with DpnⅠ and introduced into Escherichia coli Top10 competent cells through heat shock transformation for cultivation. Single clones are picked for colony PCR verification, and colonies after successful replacement of the selection marker are screened to obtain the pFA-Kan plasmid; The nucleotide sequence of the primer F1 / R1 is SEQ ID NO:2-SEQ ID NO:3; The nucleotide sequence of the DNA fragment F1R1 is SEQ ID NO:

4.

4. The use of the reporter gene plasmid according to claim 1, characterized in that: The reporter gene fragments include gusA reporter gene fragments, bla reporter gene fragments, egfp reporter gene fragments and / or rfp reporter gene fragments; the reporter gene fragments are located downstream of the position where the promoter sequence is inserted.

5. The use of the reporter gene plasmid according to claim 4, characterized in that: The nucleotide sequences of the gusA, bla, egfp and rfp genes involved in the reporter gene fragment are SEQ ID NO:5-SEQ ID NO:

8.

6. The use of the reporter gene plasmid according to claim 5, characterized in that: The gusA reporter gene fragment is obtained by using the Escherichia coli MG1655 genome as a template and primers F2 / R2 to perform PCR amplification on the gusA gene; the nucleotide sequence of the primers F2 / R2 is SEQ ID NO:9-SEQ ID NO:10; The bla reporter gene fragment is obtained by using the pBAD24M plasmid as a template and primers F3 / R3 to perform PCR amplification on the bla gene; the nucleotide sequence of the primers F3 / R3 is SEQ ID NO: 11-SEQ ID NO: 12; The egfp reporter gene fragment is obtained by using pET-eGfp plasmid as a template and primers F4 / R4 to perform PCR amplification on the egfp gene; the nucleotide sequence of the primers F4 / R4 is SEQ ID NO: 13-SEQ ID NO: 14; The rfp reporter gene fragment is obtained by using pRP1028 plasmid as a template and primers F5 / R5 to perform PCR amplification on the rfp gene; the nucleotide sequence of the primers F5 / R5 is SEQ ID NO: 15-SEQ ID NO:

16.

7. The use of the reporter gene plasmid according to claim 1, characterized in that: The reporter gene fragment is connected to the vector plasmid and then introduced into the competent E. coli Top10 cells through heat shock transformation and cultured, a single clone is picked for colony PCR verification, and positive recombinants are screened to obtain the reporter gene plasmid; The nucleotide sequence of the colony PCR primer F6 / R6 in the colony PCR verification is SEQ ID NO:17-SEQ ID NO:18.

Images