Polypeptides having binding affinity for axl protein and uses thereof
The peptide formed by mutating the Z segment of Staphylococcus A protein solves the problem of insufficient targeting of existing AXL inhibitors, achieving high affinity binding to AXL protein and high efficiency in tumor treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- WENZHOU MEDICAL UNIV
- Filing Date
- 2024-04-20
- Publication Date
- 2026-05-08
AI Technical Summary
Existing AXL inhibitors, such as monoclonal antibodies and small molecule inhibitors, have problems such as insufficient targeting, high cost, and poor penetration in cancer treatment, making it difficult to effectively target the AXL protein.
A polypeptide with binding affinity to the AXL protein was designed by mutating the amino acid sequence of the Z segment of the Staphylococcus A protein to form a polypeptide with 14-20 amino acid variations, which was then linked with a conjugate to form a targeting molecule for targeting the AXL protein.
It achieves high-affinity binding to the AXL protein, enabling the detection and treatment of tumors with upregulated AXL expression, reducing treatment costs, and improving targeting and penetration.
Smart Images

Figure CN118344446B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedicine and clinical diagnostics, specifically to a polypeptide with binding affinity for AXL protein and its applications. Background Technology
[0002] The AXL receptor (also known as UFO / ARK / Tyro7 / JTK11) is a member of the receptor tyrosine kinase (RTK) TAM family, widely expressed in various cells and tissues throughout the body. Together with Tyro3 (also known as Sky / Rse) and MerTK (also known as Eyk / Nyk / Tyro12), it forms the TAM receptor family, playing important roles in cell occlusion, immune homeostasis, and inflammatory responses. The AXL gene is located on human chromosome 19 q13.2. This gene was initially isolated from two patients with chronic myeloid leukemia (CML) and was shown to induce tumor transformation in NIH3T3 cells.
[0003] The AXL protein consists of 894 amino acids, with its extracellular domain primarily containing two immunoglobulin-like (IgL) structures and two fibronectin III (FNIII) structures. These domains are responsible for binding to its ligands, growth arrest-specific protein 6 (Gas6) and the vitamin K-dependent family protein Pros1, participating in the AXL ligand activation pathway. The Gas6 / AXL ligand binding pathway is also the most common AXL activation pathway. In this process, the Gas6 protein first binds to the AXL receptor to form a Gas6 / AXL dimer, and then forms a 2:2 homodimer complex with another Gas6 / AXL dimer, thereby initiating downstream signaling pathway transduction. In addition, the AXL receptor can also bind to other AXL receptors in the same or neighboring cells to form self-dimers, other TAM family receptors, and other types of RTK receptors, leading to their activation. Due to the unique function of the AXL receptor, its multiple activation mechanisms, and its multicellular expression characteristics, it has become a research hotspot in various fields such as tumor immunology and antiviral therapy.
[0004] Currently, cancers associated with upregulated AXL expression include lung cancer, breast cancer, nasopharyngeal carcinoma, gastric cancer, colon cancer, and liver cancer, indicating a significant correlation between AXL and cancer development. Targeting AXL may offer broad-spectrum anti-tumor effects. Furthermore, AXL is associated with metastasis and drug resistance in some cancers; targeting AXL can enhance the therapeutic effects of chemotherapy and other small molecule inhibitors, such as VEGF, EGFR, and HER2 inhibitors. Currently, the AXL inhibitor bemcentinib has received FDA approval via Fast Track designation for use in combination with the PD1 / PD-L1 inhibitor pembrolizumab in the treatment of advanced lung adenocarcinoma patients who have received prior line therapy, demonstrating the significant clinical potential of AXL inhibitors.
[0005] The development of AXL inhibitors for targeted cancer therapy currently leans towards monoclonal antibodies and small molecule inhibitors, but these have some insurmountable drawbacks limiting their clinical efficacy. For example, due to the similarity in molecular structure, most developed AXL small molecule inhibitors also inhibit other RTK kinases, and their effect on AXL is relatively weak, often requiring combination with other inhibitors for treatment. While monoclonal antibodies have strong targeting, their manufacturing process is complex, they have poor penetration into solid tumors, and their development costs are high, increasing the economic burden on patients. Therefore, AXL-targeting inhibitors other than small molecule inhibitors and monoclonal antibodies are essential for targeted cancer therapy.
[0006] Based on the above description, there is still an urgent need in this field to study new drugs or methods for targeted therapy targeting AXL receptors and related tumors in order to improve the current clinical situation. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings and deficiencies of the existing technology and to provide a polypeptide with binding affinity for AXL protein and its applications. The technical solution adopted by this invention is as follows:
[0008] In a first aspect, the present invention provides a polypeptide having binding affinity for AXL protein, the polypeptide being obtained by modifying 12-20 (preferably 13-16, such as 14 or 15) amino acids using the amino acid sequence of the Z segment (Z domain) of Staphylococcus aureus protein A (SPA) as the backbone.
[0009] The polypeptide having binding affinity to the AXL protein has an amino acid mutation at positions 9-11, 13-14, 17-18, 24-25, 27-28, 32, 35, and 43 relative to the amino acid sequence of the Z segment of Staphylococcus A protein (SEQ ID NO:1).
[0010] The sequence of the polypeptide with binding affinity to the AXL protein is shown in SEQ ID NO:3:
[0011] The 9th amino acid is mutated to C;
[0012] The 10th amino acid is mutated to H;
[0013] The 11th amino acid is mutated to M;
[0014] The 13th amino acid is mutated to V;
[0015] The 14th amino acid is mutated to W;
[0016] The 17th amino acid is mutated to T;
[0017] The 18th amino acid is mutated to L;
[0018] The 24th amino acid is mutated to H;
[0019] The 25th amino acid is mutated to Q;
[0020] The 27th amino acid is mutated to G;
[0021] The 28th amino acid is mutated to P;
[0022] The 32nd amino acid is mutated to P;
[0023] The 35th amino acid is mutated to R;
[0024] The 43rd amino acid is mutated to E.
[0025] The KD value of the interaction between SEQ ID NO:3 and the AXL protein is 3.19 × 10⁻⁶. -6 M.
[0026] In another aspect of the invention, a targeting molecule for targeting AXL protein is provided, the targeting molecule comprising the previously described polypeptide (SEQ ID NO:3) and a conjugate linked to (or coupled to) the polypeptide, the conjugate comprising (but not limited to): cysteine residues, polypeptide tags, or detectable markers (such as fluorescent markers, enzymes, biotin, or radioisotopes).
[0027] In a preferred embodiment, the conjugate is a peptide, and the conjugate and the polypeptide having binding affinity for the AXL protein constitute a fusion polypeptide.
[0028] In another preferred embodiment, the peptide tag includes, but is not limited to: His tag (e.g., 6×His), Myc tag, GST tag, and Flag tag.
[0029] In another preferred embodiment, the enzyme includes, but is not limited to, alkaline phosphatase or horseradish peroxidase.
[0030] In another preferred embodiment, the conjugate is linked to the polypeptide having binding affinity for the AXL protein via a flexible peptide, the flexible peptide comprising (but not limited to): (Gly4Ser)3.
[0031] In another aspect of the invention, a separated polynucleotide is provided that encodes the aforementioned polypeptide having binding affinity for the AXL protein.
[0032] In another aspect of the invention, a polynucleotide is provided that encodes the targeting molecule targeting the AXL protein, wherein the conjugate is a peptide.
[0033] In another aspect of the invention, a recombinant vector is provided, the vector comprising the aforementioned polynucleotide.
[0034] In another aspect of the invention, a host cell is provided that contains the recombinant vector, or contains or has the polynucleotide integrated into its genome.
[0035] In another aspect of the present invention, a method for preparing a polypeptide with binding affinity to AXL protein as described above is provided, the method comprising: (1) culturing the cells to express the polypeptide with binding affinity to AXL protein; and (2) separating and purifying the polypeptide obtained in (1).
[0036] In another aspect of the invention, the use of the polypeptide having binding affinity to the AXL protein or the targeting molecule targeting the AXL protein is provided for the preparation of a drug for treating tumors with upregulated AXL protein expression; or for the preparation of a detection reagent or kit for detecting the AXL protein; or for the preparation of a diagnostic reagent for diagnosing tumors with upregulated AXL protein expression.
[0037] In a preferred embodiment, the conjugate in the targeting molecule targeting AXL protein is an antitumor drug (such as a toxin), the polypeptide having binding affinity for AXL protein, or the targeting molecule targeting AXL protein is used to prepare a drug for treating tumors with upregulated AXL protein expression.
[0038] In another preferred embodiment, the conjugate in the targeting molecule targeting AXL protein is a detectable marker (such as a fluorescent label or enzyme), the polypeptide having binding affinity for AXL protein, or the targeting molecule targeting AXL protein is used to prepare a drug for diagnosing tumors with upregulated AXL protein expression.
[0039] In another preferred embodiment, the tumors with upregulated AXL protein expression include nasopharyngeal carcinoma, lung cancer, breast cancer, gastric cancer, cervical cancer, liver cancer, etc.
[0040] In another aspect of the invention, a pharmaceutical composition is provided comprising: the aforementioned polypeptide having binding affinity for AXL protein or the aforementioned targeting molecule targeting AXL protein; and a pharmaceutically acceptable carrier.
[0041] In another aspect of the invention, a kit is provided for diagnosing or treating tumors with upregulated AXL protein expression, the kit comprising: the polypeptide having binding affinity for AXL protein, or the targeting molecule targeting AXL protein, or the pharmaceutical composition.
[0042] The beneficial effects of the present invention are as follows: The present invention relates to a polypeptide with binding affinity to AXL protein and its application; the polypeptide has binding affinity to AXL protein, and therefore can be used to detect AXL protein, so that the polypeptide has diagnostic or therapeutic uses as a drug or molecular targeting reagent. Attached Figure Description
[0043] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.
[0044] Figure 1 A schematic diagram of the recombinant plasmid pET21a(+) / AXL (A) and prokaryotic expression, purification and identification of the AXL recombinant protein (B, C), where M: Protein Marker, 1: E. coli BL21 (DE3), 2: p ET21a(+) / E. coli. BL21(DE3), 3: p ET21a(+) / AXL / E. coli. BL21(DE3) induction before, 4. p ET2la(+) / AXL / E. coli. 5. After BL21(DE3) induction and purification p ET2la(+) / AXL / E. coli. BL21(DE3);
[0045] Figure 2 Using AXL recombinant protein as the antigen, the capacity of each peptide library after three rounds of panning was determined by phage display technology, where AC represents the capacity determination of each peptide library obtained after the first, second and third rounds of panning, respectively.
[0046] Figure 3 Random selection Figure 2 Forty-eighty monoclonal strains of the grade 3 peptide library were obtained by washing. Using the AXL recombinant protein purified by prokaryotic expression as the antigen, the affinity of these 480 strains was detected by phage-ELISA.
[0047] Figure 4 pET21a(+) / Z AXL:N Schematic diagram of recombinant plasmid and Z AXL:NSDS-PAGE electrophoresis and Western blotting analysis of prokaryotic expression and purification of recombinant affibody protein, including (A) pET21a(+) / Z AXL:N Schematic diagram of recombinant plasmid: Nde I, Xho I, Hind III is the restriction enzyme cleavage site; HA and His are HA.
[0048] and His-tagged proteins; (B)Z AXL:N SDS-PAGE electrophoresis identification of prokaryotic expression and purification of recombinant affibody protein; (C)Z AXL:N Western Blot identification and analysis of prokaryotic expression and purification of recombinant affibody protein;
[0049] Figure 5 Z AXL:N Affinity assay for the interaction between affibody recombinant protein and AXL recombinant protein molecules, wherein (A) ELISA: Z AXL:N ELISA detection of the interaction between affibody, Zwt, and AXL-specific pAb with AXL recombinant protein; (BC) SPR: different concentrations of Zwt AXL:239 SPR detection and analysis of the affinity of affibody (B) and Zwt (C) recombinant proteins to AXL recombinant protein on a Biacore X100 instrument;
[0050] Figure 6 Western Blot identification of AXL expression levels after protein extraction from different cancer cell lines, where A and B are Western Blot identifications of AXL expression levels in different gastric cancer cell lines (A) and nasopharyngeal cancer cell lines (B), respectively.
[0051] Figure 7 Z AXL:239 The binding of affibody peptides to native AXL protein in different cell lines was identified by immunofluorescence assay, where A and B represent Z... AXL:239 Immunofluorescence identification of the binding of affibody peptides to naturally expressed AXL protein in different gastric cancer cell lines (A) and nasopharyngeal cancer cell lines (B);
[0052] Figure 8 The Z marked Dylight755 AXL:239 Biodistribution and tumor-targeting imaging analysis of affibody peptides in nude mice. Detailed Implementation
[0053] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings. The following content is only for further explanation of this invention and should not be construed as limiting the scope of protection of this invention. Those skilled in the art can make some non-essential improvements and adjustments to this invention based on the content of the invention.
[0054] As used herein, the “human AXL protein-binding affinity polypeptide” refers to a polypeptide obtained by modifying 12-20 amino acids using the amino acid sequence of the Z segment of Staphylococcus A protein as a backbone, and that the polypeptide can specifically bind to human AXL protein and has very little or no non-specific binding.
[0055] As used herein, the terms "polypeptide of the present invention," "polypeptide with binding affinity to AXL protein," "affibody protein," "AXL protein-binding polypeptide," "AXL protein-binding polypeptide," and "Z" are used to refer to specific proteins or proteins. AXL:N "Recombinant protein", "Z" AXL:N “Z” AXL:N "affibody", "affibody recombinant protein", "Z" AXL:N affibody polypeptide, Z AXL "Can be used interchangeably"; "Human AXL protein" and "AXL recombinant protein" can be used interchangeably; "Z AXL:239 “Z” AXL:4 “Z” AXL:256 “Z” AXL:361 "and "Z AXL:N ”, “SPA-N”, “ZN” and “Z AXL " can be used interchangeably; and "SPA Z" and "affibody Zwt", "SPA", "SPA-Z" and "Zwt" can be used interchangeably.
[0056] As used herein, "targeting molecule" refers to a molecule that can target the AXL protein, obtained by linking the polypeptide of the present invention, which has binding affinity for the AXL protein, with other functional conjugates. The conjugates may be cysteine residues, polypeptide tags, drugs that bind to human AXL protein, enzymes, or detectable markers, etc.
[0057] As used herein, the term "fusion polypeptide" is a sub-concept of "targeting molecule," referring to a molecule that can target human AXL protein obtained by linking a polypeptide with binding affinity for human AXL protein to other functional peptides (e.g., toxic proteins or functional protein fragments).
[0058] The inventors selected the extracellular region of human AXL protein as the target antigen. Using the Z domain (Zwt, SEQ ID NO: 1) of Staphylococcus A protein as a scaffold, the inventors randomly mutated the surface amino acid residues and antibody Fc binding sites. A mutant library was constructed using phage display technology, and affinity screening of the library was performed using human AXL protein as the target antigen. After extensive screening, peptides with high affinity for human AXL protein were finally obtained.
[0059] The polypeptide of the present invention is obtained by modifying 14-20 (preferably 14) amino acid sequences using the amino acid sequence of the Z domain of Staphylococcus A protein as a backbone. As a preferred embodiment of the present invention, the polypeptide of the present invention contains amino acid mutations at positions 9-11, 13-14, 17-18, 24-25, 27-28, 32, 35, and 43 relative to the amino acid sequence of the Z domain of Staphylococcus A protein (SEQ ID NO: 1). More preferably, the polypeptide of the present invention has the amino acid sequence shown in SEQ ID NO: 3.
[0060] This invention also covers polypeptides formed by adding additional amino acid residues to either end or both ends of the amino acid sequence of the human AXL protein-binding polypeptide. These additional amino acid residues may function in the binding of the polypeptide to the human AXL protein, but may also be used for other purposes, such as in relation to one or more of the production, purification, stabilization, conjugation, or detection of the polypeptide. These additional amino acid residues may include one or more amino acid residues added for chemical conjugation purposes, such as adding a cysteine residue at the first or last position of the polypeptide chain, i.e., adding a cysteine residue at the N or C terminus. Such additional amino acid residues may also include a "label" for polypeptide purification or detection, such as a six-histidine peptide (His6) label that interacts with a labeled antibody, or a "myc" label or a "flag" label. Furthermore, other alternatives well known to those skilled in the art are also included in this invention.
[0061] The “additional amino acid residues” may also constitute one or more polypeptide domains with the intended function, such as the same binding function as the first, human AXL protein binding domain, or other binding functions, or an enzymatic function, or a fluorescent function, or a combination thereof.
[0062] This invention also includes peptides modified from the aforementioned human AXL protein-binding peptide to increase its stability under alkaline conditions. This stability includes site-directed substitution of any aspartic acid residues appearing in the unmodified sequence with amino acid residues less sensitive to alkaline conditions. Since affinity chromatography columns are subjected to frequent strong alkali treatment for elution between different reactions, this reduced sensitivity to alkali is advantageous for using the peptides of this invention as affinity ligands in affinity chromatography, extending the lifespan of the affinity chromatography matrix.
[0063] This invention also includes peptides obtained by further modifications to the human AXL protein-binding peptide of this invention. These modifications (generally without altering the primary structure) include: chemically derived forms of the peptide, such as acetylation or carboxylation, either in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications performed during peptide synthesis and processing or further processing steps. This modification can be accomplished by exposing the peptide to glycosylating enzymes (such as mammalian glycosylation or deglycosylation enzymes). Modifications also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine). Furthermore, peptides modified to improve their resistance to proteolysis or optimize their solubility are also included.
[0064] The human AXL protein-binding polypeptide of the present invention can be linked to a conjugate to form a functional targeting molecule. This linking can be achieved through chemical bonds (including peptide bonds) or adsorption; the chemical bonds can be covalent or non-covalent. As a preferred embodiment, peptide bonds are used to form a fusion polypeptide. The human AXL protein-binding polypeptide and the conjugate can be directly linked or linked through a polypeptide linker (linking peptide). The linker may comprise, for example, 1-30 amino acids; preferably 1-20 amino acids. The inclusion of the linking peptide does not substantially affect the activity of the individual polypeptides in the fusion protein. Preferably, a flexible peptide (Gly4Ser)3 can be used for linking. Other linking peptides well known to those skilled in the art can also be used in this invention.
[0065] In the "heterologous" fusion peptide, the human AXL protein-binding peptide constitutes the first domain or first moiety, and the second and other moieties have functions other than binding the human AXL protein, which are also within the scope of this invention. The second and other moieties of the fusion peptide may contain binding domains with affinity for other target molecules besides the human AXL protein. Such binding domains may also be associated with the SPA domain, but with substitution mutations at positions 1 to approximately 20. The result is that the fusion peptide has at least one human AXL protein-binding domain and at least one domain with affinity for the other target molecules. This expands the applications of the peptides of this invention, such as as therapeutic agents or as capture, detection, or separation reagents.
[0066] Other options for the second and other portions of the fusion peptide of the present invention include one or more portions for therapeutic applications. In therapeutic applications, other molecules may also be covalently or non-covalently coupled to the peptide of the present invention by other methods, such as linking a modified Pseudomonas aeruginosa exotoxin PE38KDEL or granzyme (GrB) to the C-terminus or N-terminus of a human AXL protein via a flexible peptide to form a fusion protein. Non-limiting examples include enzymes that guide effector enzymes (e.g., carboxypeptidase) for “ADEPT” (antibody-directed enzyme prodrug therapy); proteins that recruit effector cells and other components of the immune system; cytokines such as IL-2, IFNγ, IL-12, TNFα, IP10; procoagulant factors such as tissue factor and von Willebrand factor; toxins such as ricin A, calcheamicin, and maytansine alkaloids; and toxic small molecules such as auristatin analogs and doxorubicin. At the same time, in order to more easily incorporate radioactive nuclides (such as...) 68 Ga、 76 Br、 111 In、 99 Tc, 124 I, 125 I) Used for diagnosis or radionuclide (e.g.) 90 Y、 131 I, 211 For treatment, additional amino acids listed above (especially hexahistine labeling and cysteine) can be considered, with the aim of coupling the radioactive isotope chelating agent to the polypeptide sequence.
[0067] The present invention also covers linking a detectable marker (such as a fluorescent label, biotin, or a radioisotope) to the human AXL protein binding peptide, thereby enabling the detection of tumors with upregulated AXL protein expression based on the specificity of the peptide of the present invention.
[0068] "Human AXL protein binding affinity" refers to the ability to bind to proteins that can be achieved, for example, through surface plasmon resonance technology such as Biocore. ® The device detects a peptide property. The binding affinity of human AXL protein can be detected experimentally by immobilizing the human AXL protein on the sensor chip of the device and then passing a sample containing the analyte peptide through the chip. Alternatively, the analyte peptide can be immobilized on the sensor chip of the device, and then a sample containing the human AXL protein can be passed through the chip. Those skilled in the art can use the obtained sensor images to establish at least one qualitative measurement method for the binding affinity of the peptide to the human AXL protein. If a quantitative measurement method is required, for example, to establish a KD value between interactions, surface plasmon resonance methods can also be used. For example, the binding value can be obtained using Biocore. ® The determination was performed using a T200 device (GE). Human AXL protein was immobilized on the sensor chip of this device, while the peptide sample for affinity testing was prepared by serial dilution and injected in a random order. The KD value was then calculated from the results. In an embodiment of the invention, the KD value of the peptide reached 3.19 × 10⁻⁶. -6 M.
[0069] This invention also provides isolated nucleic acids, or their complementary strands, encoding the human AXL protein-binding polypeptide, targeting molecule, or fusion polypeptide of this invention. The nucleic acids can be synthesized in their entirety artificially, or obtained separately using PCR amplification.
[0070] The present invention also provides a vector comprising encoding the nucleic acid molecule. The vector may further comprise an expression regulatory sequence operably linked to the sequence of the nucleic acid molecule to facilitate the expression of the fusion protein. As used herein, “operably linked” or “operably coupled” refers to a situation where certain portions of a linear DNA sequence can influence the activity of other portions of the same linear DNA sequence. For example, if a promoter controls transcription of a coding sequence, then it is operably coupled to the coding sequence.
[0071] In this invention, any suitable vector may be used, such as some vectors for cloning and expression of bacteria, fungi, yeast and mammalian cells, such as Pouwels, etc. Cloning vectors: as described in the Laboratory Manual.
[0072] Furthermore, recombinant cells containing the aforementioned nucleic acid sequence are also included in this invention. The term "host cell" includes prokaryotic and eukaryotic cells. Commonly used prokaryotic host cells include *Escherichia coli*, *Bacillus subtilis*, etc.; for example, *Escherichia coli* cells (… E. coli Examples of common eukaryotic host cells include Escherichia coli HMS174 (DE3) or BL21 (DE3). Commonly used eukaryotic host cells include yeast cells, insect cells, and mammalian cells.
[0073] Methods for producing the human AXL protein-binding polypeptide, targeting molecule, or fusion polypeptide of the present invention are also included in the present invention. The methods include culturing recombinant cells encoding nucleic acids containing the corresponding polypeptide to obtain the product polypeptide. The polypeptide obtained in the above preparation can be purified to have substantially homogeneous properties, for example, appearing as a single band on SDS-PAGE electrophoresis.
[0074] Based on the information about the polypeptide to be expressed and the current level of technology for recombinant protein expression, combined with the content disclosed in this invention, those skilled in the art can readily prepare the polypeptide of this invention. For example, a plasmid expressing an unmodified Z domain can be used as starting material. Using known techniques, the desired substitution mutation can be introduced into this plasmid to obtain the expression vector of this invention.
[0075] When preparing the polypeptides, targeted molecules, or fusion proteins of the present invention using chemical polypeptide synthesis methods, any naturally occurring amino acid residues in the aforementioned polypeptides can be replaced by any corresponding, non-naturally occurring amino acid residues or their derivatives, as long as the function of the product polypeptide is substantially not impaired.
[0076] The present invention also relates to the application of the aforementioned human AXL protein-binding peptide or targeting molecule or fusion peptide in various aspects, including applications in treatment, diagnosis and / or detection.
[0077] The human AXL protein binding polypeptide of the present invention can serve as a substitute for human AXL protein antibodies in various applications.
[0078] As a non-limiting example, it can be used to treat diseases characterized by the expression of human AXL protein, such as tumors (e.g., gastric cancer, nasopharyngeal carcinoma). By binding to human AXL protein to inhibit cell signaling, it can be used for in vivo and in vitro diagnosis of related diseases. The peptides of the present invention can be used as a detection reagent, a capture reagent, or a separation reagent, and can also be used directly as a therapeutic agent or as a means of targeting human AXL protein with other therapeutic agents. In vitro use of the peptides of the present invention can be performed in various ways, such as microtiter plates, protein arrays, biosensor surfaces, and tissue sections, etc. To make the peptides of the present invention suitable for specific uses, the peptides of the present invention can be modified and / or added without departing from the scope of the invention.
[0079] These modifications and additions are described in detail below, and may include additional amino acids contained in the same polypeptide chain, or labeling and / or therapeutic agents that chemically modify or otherwise bind to the polypeptide of the present invention. Additionally, the present invention also covers fragments of the polypeptide that retain the ability to bind to human AXL protein.
[0080] The AXL protein-binding properties of the peptide of the present invention, and the stability of the production of targeted molecules (including fusion proteins) and / or labeled binding molecules using the peptide, mean that the peptide can also be used to target other active substances to tumor sites, including cells expressing the AXL protein. Therefore, another aspect of the invention provides the application of the human AXL protein-binding peptide described herein conjugated with a substance having anticancer activity to deliver said substance to cells expressing the human AXL protein, inducing damage or apoptosis of the target cells.
[0081] Such anticancer active substances may be proteins fused to or chemically coupled to human AXL protein-binding peptides, such as effector enzymes selected for "ADEPT" (antibody-directed enzyme prodrug therapy); proteins used to recruit effector cells and other components of the immune system; cytokines, such as IL-2, IFNγ, IL-12, TNFαa, IP10, etc.; procoagulant factors, such as tissue factor, von Willebrand factor, etc.; toxins, such as ricin A, Pseudomonas exotoxin, calcheamicin, maytansine alkaloids, etc. Alternatively, the active substance may also be a cytotoxic drug, such as auristatin analogues or doxorubicin or a radioactive isotope (e.g., 90 Y、 131 I, 211 At (etc.), this isotope can bind directly to human AXL protein-binding peptides, or bind to human AXL protein-binding peptides through a chelating agent, such as the well-known chelating agent DOTA or DTPA.
[0082] In a related aspect, the present invention also provides a method for directing the expression of a substance with anticancer activity into human AXL protein cells in vivo, comprising administering to a patient a conjugate of the active substance described herein with a human AXL protein-binding polypeptide. Such a conjugate has been appropriately described above.
[0083] The present invention also includes the use of the peptide that binds to human AXL protein to detect human AXL protein in a sample.
[0084] For example, this detection can be used to diagnose diseases characterized by the expression of human AXL protein. The detection of the presence of human AXL protein can be performed in vivo or in vitro. Preferred options for in vivo diagnosis include positron emission tomography (PET), etc. The sample being tested can be, for example, a biological liquid sample or a tissue sample. A common current method is to use antibodies against human AXL protein, a method applicable to the human AXL protein-binding peptides of this invention. This method is a histochemical method for detecting the presence of human AXL protein, used to identify the expression of human AXL protein in fresh, frozen, or formalin-fixed, paraffin-embedded tissue samples.
[0085] The polypeptides of the present invention can also be used as part of a fusion protein, wherein other domains are reporter enzymes or luciferases. Alternatively, they can be labeled with one or more fluorescent agents and / or radioisotopes, optionally by chelating agents. Suitable radioisotopes include 68 Ga、 76 Br、 111 In、 99 Tc, 124 I and 125 I et al.
[0086] The present invention also includes the application of the human AXL protein-binding peptide described herein to the detection of human AXL protein in a biological liquid sample. This method includes the following steps: (1) providing a biological liquid sample from a patient being tested; (2) adding the human AXL protein-binding peptide described herein to the sample under conditions that allow the peptide to bind to any human AXL protein present in the sample; (3) removing unbound peptides; and (4) detecting the bound peptides. The amount of bound peptide detected is related to the amount of human AXL protein present in the sample. In step (2), the human AXL protein-binding peptide can be added to the sample in any suitable form, including, for example, when the human AXL protein-binding peptide is immobilized on a solid support through which the sample is contacted, or when the human AXL protein-binding peptide is present in solution.
[0087] Other applications of the human AXL protein-binding peptide include: a method for detecting human AXL protein in a sample, comprising the following steps: (1) providing a tissue sample suspected of containing human AXL protein, such as a frozen section or a formalin-embedded tissue section; (2) adding the human AXL protein-binding peptide of the present invention to the sample under suitable conditions, said conditions being conducive to the binding of the peptide to any human AXL protein present in the sample; (3) removing unbound peptides; and (4) detecting bound peptides. The amount of bound peptides detected is related to the amount of human AXL protein present in the sample.
[0088] The present invention also provides a kit for diagnosing human AXL protein expression in tissue samples, comprising a human AXL protein binding peptide of the present invention fused with a reporter enzyme (such as alkaline phosphatase or horseradish peroxidase), a reagent for detecting enzyme activity, and positive and negative control tissue sections.
[0089] The present invention also provides a kit for diagnosing human AXL protein expression in tissue samples, comprising the human AXL protein-binding polypeptide of the present invention fused with a label (such as a flag label or a myc label) for detection by antibody, a label-specific primary antibody, a secondary antibody specific to the primary antibody and conjugated to a reporter enzyme, a reagent for detecting enzyme activity, and positive and negative control tissue sections.
[0090] One area of diagnostic applications is the detection of cancer cells or their aggregates in vivo. This invention provides a kit for performing such a diagnosis, comprising a human AXL protein-binding peptide of the present invention labeled with a chelate, and a diagnostic radioisotope (a non-limiting example is...). 68 Ga、 76 Br、 111 In、 99 Tc, 124 I and 125 I, etc., and reagents for analyzing incorporation efficiency.
[0091] As described above, this invention covers the application of the human AXL protein-binding peptide of this invention to target an active substance to cells expressing human AXL protein, such as certain types of cancer cells. This invention also provides a kit for this purpose, comprising the human AXL protein-binding peptide of this invention labeled with a chelate, and a therapeutic radioisotope (a non-limiting example is...). 90 Y、 131 I, 211 At), and reagents used to analyze incorporation efficiency.
[0092] The present invention also provides a pharmaceutical composition comprising: an effective amount of the polypeptide or targeting molecule of the present invention having binding affinity for human AXL protein, and a pharmaceutically acceptable carrier.
[0093] As used herein, a "pharmaceuticalally acceptable" ingredient is a substance suitable for human and / or mammalian use without excessive adverse side effects (such as toxicity), i.e., a reasonable benefit / risk ratio. The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity after administration. Suitable carriers are well known to those skilled in the art. A thorough description of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Pharmaceutically acceptable carriers in compositions may contain liquids such as water, saline, glycerin, and sorbitol. Additionally, these carriers may contain auxiliary substances such as lubricants, flow aids, wetting agents or emulsifiers, pH buffers, and stabilizers such as albumin.
[0094] The composition can be formulated into various dosage forms suitable for administration to mammals, including but not limited to: injections, capsules, tablets, emulsions, and suppositories.
[0095] In use, a safe and effective amount of the polypeptide or targeting molecule with binding affinity to human AXL protein, as described in this invention, is administered to mammals (such as humans). This safe and effective amount is typically at least about 1 microgram per kilogram of body weight, and in most cases does not exceed about 10 milligrams per kilogram of body weight. Preferably, the dose is between about 1 microgram per kilogram of body weight and about 1 milligram per kilogram of body weight. Of course, the specific dosage should also consider factors such as the route of administration and the patient's health condition, which are all within the scope of a skilled physician's expertise.
[0096] The present invention will be further described below with reference to specific embodiments.
[0097] Example 1: Preparation and Identification of Human AXL Recombinant Protein
[0098] 1. Sequence retrieval of AXL recombinant protein and its plasmid construction and identification
[0099] The full-length amino acid sequence of AXL protein was found in the NCBI database (GenBank: AAH32229.1). The main amino acid sequence (aa 26-96) of AXL protein that binds to Gas6 in the cell membrane was selected for prokaryotic expression codon optimization (http: / / www.jcat.de / Start.jsp). The pET21a(+) / AXL recombinant plasmid containing the corresponding gene fragment of AXL was synthesized by Hangzhou Qingke Biotechnology Co., Ltd. and then sequenced for identification.
[0100] 2. Prokaryotic expression and identification of AXL recombinant protein
[0101] Transform the recombinant plasmid into E. coli ( E. coli In BL21 (DE3), the protein was cultured at 37°C for 16 h, followed by a further activation and expansion culture for 4 h. Then, 1 mM isopropyl thio-β-D-thiogalactopyranoside (IPTG) (Merck, Germany) was added, and the protein was induced with IPTG for 6 h to express the His-tagged AXL recombinant protein. The induced recombinant protein was purified by affinity chromatography using Ni-NTA agarose (QIAGEN, Germany) and identified by SDS-PAGE and Western blotting.
[0102] Results: SDS-PAGE electrophoresis showed a distinct protein band at approximately 15 kDa after induction, consistent with the expected protein size (Mr). Figure 1 B); After purification by affinity chromatography, SDS-PAGE analysis showed a relatively single protein band at the Mr 15 kDa position. Figure 1 B). Western blot analysis using mouse anti-6×His mAb primary antibody showed a single signal band at Mr 15 kDa in all cases. Figure 1 C) indicates that both induced and purified recombinant proteins can be specifically recognized by the corresponding His-tagged antibodies.
[0103] Example 2: Washing of human AXL protein-binding peptides
[0104] Using the phage random combination library constructed by our research team, which is a primary library of affibody peptides constructed by randomly mutating amino acid positions 9-11, 13-14, 17-18, 24-25, 27-28, 32, and 35 specified in the SPA-Z sequence, we screened out monoclonal strains containing human AXL protein-binding peptides from this library.
[0105] After coating purified human AXL protein-binding peptides into immunotubes and blocking them, rescue phage infection libraries (primary libraries or primary and secondary libraries obtained from subsequent panning rounds) were added and incubated at 37°C. After centrifugation, the phage supernatant was added to immunotubes for specific binding. Non-specific binding was eluted with PBST before empty tubes were added. E. coliTG1 was incubated at 37℃ to harvest specific phages. 100 μL of each phage was serially diluted 10-fold with 2*YT medium, and 100 μL of each dilution was evenly spread onto SOB-AG plates and incubated overnight at 37℃. The library capacity of each peptide library was determined by the presence or absence of colony formation. 10, 20, and 19 single-clone strains were randomly selected from the primary, secondary, and tertiary libraries, respectively, for sequencing. The accuracy was calculated based on completely correct sequences (i.e., no mutations or premature termination in the affibody backbone region), and the diversity was calculated based on the presence or absence of repetitions in the sequences of each peptide library.
[0106] Results: The capacities of the primary, secondary, and tertiary peptide libraries obtained from the washing process were 10, respectively. 8 10 9 and 10 7 The accuracy rates were 50%, 55%, and 47.4%, respectively, with 100% diversity in all cases. Figure 2 ).
[0107] Example 3: Screening of human AXL protein-binding peptides
[0108] 1. Phage ELISA screening for peptides with high AXL binding affinity.
[0109] Forty-eighty monoclonal colonies were randomly selected from the grade III AXL binding affinity peptide library obtained by washing, and numbered Z. AXL:N Human AXL recombinant protein was coated at 1 μg / well onto 96-well microplates and incubated overnight at 4 °C. The plates were washed with PBST and blocked with 5% skim milk. After washing, phage was added to selected monoclonal strains and co-cultured for 12 h. The supernatant was collected after centrifugation and added to 96-well plates at 100 μL / well, incubated at 37 °C for 2 h. After washing, HRP / anti-M13 enzyme-labeled secondary antibody (rabbit anti-M13, Abcam # ab6188) diluted 1:5000 and TMB chromogenic solution were added, and the plates were incubated at 37 °C for 15 min. The reaction was terminated with 50 μL / well of 2 M H2SO4. The OD450 value was read using a microplate reader (ELx800TM, BIO-TEK, USA).
[0110] 2. Sequence detection and screening of human AXL protein binding affinity molecules
[0111] Using an ELISA value higher than 0.5 for OD450, phages encoding the human AXL protein-binding peptide were identified. One hundred clones with OD450 values higher than this ELISA signal were selected for sequencing. The sequencing primers were CATATGGTTGACAACAAATTCAACAAAGAA (SEQ ID NO: 5). The sequencing results were analyzed using Chromas software to further analyze the randomness and diversity of the three helical regions of the standard sequences SPA-Z and SPA-N. The clone with the highest OD value was designated as Z. AXL:4 Z AXL:239 Z AXL:256 Z AXL:361 This will be used for the next step of molecular cloning, expression, and functional detection of the human AXL recombinant protein binding affinity variant. Among them, Z... AXL:239 The amino acid sequence is SEQ ID NO: 3, and its coding sequence is SEQ ID NO: 4.
[0112] Example 4: Construction of recombinant plasmid of human AXL protein binding affinity molecule and expression and purification of prokaryotic protein
[0113] As previously selected, four clones (Z) with higher ELISA readings were chosen. AXL:4 Z AXL:239 Z AXL:256 Z AXL:361 Zwt was used as a negative control for human AXL protein-binding peptides. To assess the function of the screened affibody molecules, recombinant plasmids were constructed, prokaryotic proteins were expressed and identified, and purified proteins were prepared.
[0114] 1. pET21a(+) / Z AXL:N Construction and identification of recombinant plasmids
[0115] pCANTB5E / Z AXL:N Using the recombinant plasmid as a template, universal seamless cloning primers for Affibody were designed: Forward primer: 5'TTTAAGAAGGAGATATACATATGTACCCATACGACGTCCCAGACTACGCTGTTGACAACAAATT3' (SEQ ID NO: 6),
[0116] Reverse primer: 5'ACTAGTCTCGAGTTACTGCTGGGATGCACAC3' (SEQ ID NO: 7). Single clone Z from the correctly sequenced tertiary library was selected. AXL:NUsing the bacterial strain as a template, the affibody target gene was amplified by PCR, and an HA tag sequence was added to its N-terminus. Simultaneously, the full-length Zwt sequence (SEQ ID NO: 2) after prokaryotic codon optimization was synthesized as a negative control. The PCR-amplified target gene was then subjected to… Nde I and Xho I. The restriction enzyme sites were cloned into the pET21a(+) vector, and pET21a(+) / Z was constructed. AXL:N Recombinant plasmids ( Figure 4 A).
[0117] 2. Z AXL:N Prokaryotic protein preparation
[0118] Transform the recombinant plasmid into E. coli ( E. coli In BL21 (DE3), the culture was carried out at 37°C for 16 h. After a second activation and expansion culture of 4 h, isopropyl β-D-thiogalactopyranoside (IPTG) (Merck, Germany) was added to a final concentration of 0.8 mM. The culture was induced for 6 h to express Z-type expression with a His tag. AXL:N Affibody and Zwt affibody proteins. The recombinant proteins expressed after induction were purified by nickel chelate affinity chromatography (Ni-NTA agarose) (QIAGEN, USA) and identified by SDS-PAGE and Western blotting. The primary antibody used for Western blotting was mouse anti-HA tag mAb (Biosharp, China), and the secondary antibody was HRP-labeled goat anti-mouse monoclonal antibody (Beyotime, China).
[0119] As a result, pET21a(+) / Z was successfully constructed using molecular biology techniques. AXL:N Recombinant plasmids were used, and purified Z was prepared using a prokaryotic expression system. AXL:4 Z AXL:239 Z AXL:256 Z AXL:361 The Zwt affibody recombinant fusion protein was analyzed by SDS-PAGE electrophoresis. Figure 4 B) and Western Blot ( Figure 4 C) Confirmed that the band with a molecular mass of approximately 7.5 kDa appeared, consistent with the expected Z. AXL:N Affibody peptides have a uniform molecular weight. This invention selects the pET21a(+) vector, utilizing its multiple cloning site as the initiation enzyme site in the design. NdeI (CATATG), where the codon ATG is the start codon for the amino acid (M) of the target protein translation. Thus, the protein expressed using the prokaryotic expression system is the full-length target protein Z. AXL:N By eliminating the carrier protein fragment, the interference of the carrier protein on the experimental results is avoided.
[0120] Example 5, Z AXL:N Binding of affibody peptides to AXL recombinant protein
[0121] To identify Z AXL:N The specificity of binding between affibody peptides and recombinant AXL protein was analyzed using ELISA and surface plasmon resonance (SPR) techniques. AXL:4 Z AXL:239 Z AXL:256 Z AXL:361 The affinity and specificity of the Zwt affibody and its control Zwt affibody for binding to the target protein AXL recombinant protein were compared.
[0122] 1. ELISA detection and identification of Z AXL:N Binding affinity of affibody peptides to AXL recombinant protein
[0123] Dilute AXL recombinant protein to a final concentration of 10 μg / mL with antigen coating buffer. Add 100 μL / well to an ELISA plate, incubate overnight at 4°C, discard the liquid, wash three times with 1×PBST, and block at 37°C for 2 hours with 200 μL of 5% skim milk per well. Then, add purified Z... AXL:4 Z AXL:239 Z AXL:256 Z AXL:361 Zwt affibody and its control were serially diluted with 1×PBS to final concentrations of 200 ng / μL and 50 ng / μL, respectively. 100 μL of each was added to each well of the ELISA plate. Rabbit anti-AXL polyclonal serum antibody (Abcam) diluted 1:5000 was used as a positive control. The reaction was incubated overnight at 4°C. Mouse anti-HA tag antibody diluted 1:5000 was added to the polypeptide wells as the primary antibody; no antibody was added to the positive control wells. Then, HRP-labeled goat anti-mouse IgG (H+L) secondary antibody (Beyotime, China) diluted 1:5000 was added to the polypeptide wells, and HRP-labeled goat anti-mouse IgG (H+L) secondary antibody (Beyotime, China) was added to the positive control wells. The plates were incubated at 37°C for 2 hours, then the liquid was discarded. After washing with PBST, TMB chromogenic solution was added under light-protected conditions. Once the liquid in the plate changed color, ELISA stop solution was added under light-protected conditions, and the absorbance was read at 450 nm using a microplate reader.
[0124] 2. SPR testing and identification of Z AXL:239Binding affinity of affibody peptides to AXL recombinant protein
[0125] Z-testing was conducted using the Biacore X100 system instrument (GE, USA). AXL:239 Affinity analysis of the binding affinity interaction between affibody peptides and AXL recombinant proteins, specifically using surface plasmon resonance (SPR) technology to analyze Z... AXL:239 The interaction between affibody molecules and the AXL recombinant protein was studied, using the Zwt control. Following the instruction manual, the AXL recombinant protein was immobilized on the CM5 chip surface after activation of the second lane via EDC and NHS. Affinity assays were performed between the protein and the screening peptides. The first lane served as a blank control for injection. Affibody molecules were diluted at five different concentrations to bind to the AXL recombinant protein, i.e., Zwt... AXL:239 The molecular concentrations of affibody peptide and Zwt affibody peptide were 12 μM, 6 μM, 3 μM, 1.5 μM, and 0.75 μM, respectively. The reaction time and dissociation time were set to 200 s. All analyses were performed at 25 °C at a flow rate of 30 μL / min. Zwt affibody peptide was injected during the reaction. AXL:239 Affibody peptides and Zwt affibody peptides were injected into the instrument's phosphate-buffered saline (PBS) during dissociation. Sample volumes were 150 μL, injected randomly at a flow rate of 15 μL / min. The samples were then washed with Gly-HCl at pH 2.5 for 1 min (regeneration). Binding curves were analyzed and fitted using the 1:1 binding mode of the BIACORE X100 analysis software (sensing curve).
[0126] Result: With Z AXL:239 Increased concentration of affibody peptide molecules enhances their ability to interact with the target protein AXL recombinant protein. Figure 5 B) Based on the instrument's built-in software analysis, the affinity equilibrium dissociation constant KD value, Z AXL:239 The affibody peptide and Zwt were 3.196 × 10⁻⁶. -6 mol / L and 7.96×10 -2 mol / L. Z AXL:239 The dissociation constant KD of affibody peptides differs from that of Zwt molecules by 10. 4 The Z-number obtained after expression purification is [number]. AXL:239 Affibody can bind to AXL recombinant protein with an affinity reaching the nmol / L level, while wild-type Zwt affibody molecules show almost no binding affinity to AXL recombinant protein. This indicates that the prepared Zwt affibody...AXL:239 Affibody peptide molecules exhibit high specific affinity for AXL recombinant protein, which also indicates that prokaryotically induced Z AXL:239 Both affibody polypeptide molecules and AXL recombinant proteins possess biological activity.
[0127] Therefore, the Z of the present invention AXL:239 Affibody peptide molecules exhibit mutual binding and recognition capabilities with AXL recombinant protein target proteins. This was validated at the protein level. AXL:239 The affinity between affibody peptide molecules and the target protein of AXL recombinant protein.
[0128] Example 6: Identification of AXL protein expression levels in different tumor cell lines
[0129] To verify the expression levels of native AXL protein in different tumor cell lines and to use them in subsequent studies, gastric cancer cell lines BGC-823, HGC-27, and MKN-45, and nasopharyngeal cancer cell lines C666-1, B95-8, and NPC / HK-1 were selected for protein extraction and Western blotting to identify their native AXL protein expression levels.
[0130] Cell culture: BGC-823, HGC-27, MKN-45, B95-8, and C666-1 cells were cultured in RPMI 1640 medium (10% fetal bovine serum, 2.05 mM L-glutamine, 100 IU / mL penicillin, and 100 μg / mL streptomycin). NPC / HK-1 cells were cultured in DMEM medium (10% fetal bovine serum, 2.05 mM L-glutamine, 100 IU / mL penicillin, and 100 μg / mL streptomycin). Cells were cultured at 37 °C in an incubator containing 5% CO2 until the logarithmic growth phase for protein extraction.
[0131] Western Blot identification: Cells were cultured to the logarithmic growth phase and seeded in 6-well plates, with a plate size of 2 × 10⁶ cells / well. 4Cells were cultured for 24 h in a constant temperature incubator, then removed and washed once with pre-cooled 1×PBS buffer. The cells were then aspirated and placed on ice. 2 μL of PMSF protease inhibitor and 100 μL of RIPA lysis buffer were added to each well. The plates were incubated at 4°C and 50 rpm for 15 min on a horizontal shaker. Cells were then gently scraped along the bottom of the 6-well plate with a cell scraper and transferred to 1.5 mL Eppendorf tubes. The plates were incubated on ice for 15 min. After centrifugation at 4°C and 12000 rpm for 15 min, 40 μL of the supernatant was collected. After determining the protein concentration, 40 μL of protein was added to each well, followed by 10 μL of 5×Loading Buffer. The mixture was then boiled for 10 min. After SDS-PAGE electrophoresis, the membrane was transferred and incubated with rabbit anti-AXL polyclonal antibody (1:5000, Abcam) and rabbit anti-GAPDH antibody (1:5000, Beyotime) as the primary antibody. The secondary antibody was HRP-labeled goat anti-rabbit monoclonal antibody IgG (H+L). The membrane was then developed with ECL luminescent solution (Biorad) and exposed in a chemiluminescence imaging system (Qingxiang, Shanghai).
[0132] Results: AXL expression was positive in gastric cancer cell lines BGC-823 and HGC-27, with slightly different expression levels, while AXL expression was negative in MNK-45 cells. Figure 6 A). AXL expression was positive in nasopharyngeal carcinoma cell lines B95-8, C666-1, and NPC / HK-1. Figure 6 B).
[0133] Example 7, Z AXL:239 Binding of affibody peptides to cells expressing AXL protein
[0134] To further verify Z AXL:239 The affinity of affibody peptides for AXL target proteins was investigated using gastric and nasopharyngeal carcinoma cells expressing AXL protein as research subjects, namely BGC-823, HGC-27, B95-8, C666-1, NPC / HK-1 (as positive controls), and MNK-45 (as negative controls), to further validate Z. AXL:239 The binding between affibody peptides and AXL protein molecules.
[0135] Immunofluorescence assay: Sterile coverslips were placed in six-well plates, and the number of BGC-823, HGC-27, B95-8, C666-1, NPC / HK-1, and MNK-45 cells was adjusted to 1×10⁻⁶. 5 / well, cultured in 5% CO2 at 37℃ for 24 h until a monolayer of cells was formed. Add Z to each well to a final concentration of 50 μg / mL. AXL:239Affibody and its control Zwt affibody peptide were cultured in the above-mentioned medium containing 10% FBS at 37 ℃ for 6 h in 5% CO2. The culture medium was aspirated and washed with pre-cooled PBS. Monolayer cells were fixed with 4% paraformaldehyde for 10 min, washed three times with PBST, and punched with 0.3% Triton X-100 for 10 min. After washing, cells were blocked in 10% FBS + 1640 medium at 37 ℃ for 1 h and washed again. Mouse anti-His monoclonal antibody (Solepro, Beijing, 1:2000) was added and incubated at 37 ℃ for 2 h. After washing, FITC-goat anti-mouse IgG secondary antibody (Solepro, Beijing, 1:2000) was added in the dark and incubated at 37 ℃ for 2 h. The liquid was discarded and Hoechst 33258 (Solepro, Beijing) 10 μL / well was added to stain nuclei for 10 h. After 1 minute, wash in the dark, cover with a coverslip and seal with a special mounting medium, observe and photograph with a fluorescence microscope (Nikon, Japan) (400×).
[0136] The results showed that Z AXL:239 Multiple strong green dot-like or clump-like fluorescent proteins were visible on the cell membranes of BGC-823, HGC-27, B95-8, C666-1, and NPC / HK-1 cell lines incubated with affibody protein. Figure 7 AB), while no obvious fluorescent clumps were observed in the MNK-45 cell line (AB). Figure 7 A); meanwhile, no obvious fluorescent clumps were observed in the cytoplasm of BGC-823, HGC-27, MKN-45, B95-8, C666-1, and NPC / HK-1 cell lines incubated with the Zwt control peptide. Figure 7 AB). This indicates that Z AXL:239 The recombinant affibody protein can specifically recognize the AXL protein naturally expressed in the cell line. The Z-type protein prepared in this invention... AXL:239 Recombinant affibody protein has a strong specific binding ability to AXL protein expressed in live cells.
[0137] The above results further validated Z at the cellular level. AXL:239 Recombinant affibody proteins exhibit strong affinity and binding specificity to AXL proteins.
[0138] Example 8, Z AXL:239 Biodistribution and tumor-targeting properties of affibody peptides in tumor-bearing nude mice
[0139] In the experiment of this embodiment, the near-infrared fluorescent dye DyLight755 NHS Ester (Thermo Fisher Scientific, USA, catalog number 62278) was used to label Z. AXL:239The affibody and its control Zwt affibody polypeptides were injected into mice bearing transplanted tumors of C666-1 cells to conduct the biodistribution study and imaging localization of the Z AXL:239 affibody polypeptide, in order to study the biodistribution and tumor targeting characteristics of the labeled polypeptide.
[0140] 1. Preparation of animal tumor model
[0141] BALB / c-nu nude mice aged 6-7 weeks (purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd., certificate number SYXK(Zhe)2019-0003), with a body weight of 15-18 g, were raised in a SPF-class animal laboratory. C666-1 cells cultured to the logarithmic growth phase with good growth status were digested with EDTA (trypsin), then blown and collected with cell culture medium containing 10% fetal bovine serum, centrifuged at 1000 rpm for 3 min at room temperature. The centrifuged cells were resuspended with serum-free culture medium and counted, and prepared into 1×10 6 / mL. Take 0.2 mL and inject it subcutaneously into the back of the nude mice near the right forearm. Observe the mental state, activity, reaction, diet, body weight, and the appearance and touch of the subcutaneous inoculation area of the mice every 3 days, and measure the diameter of the tumor mass with an electronic vernier caliper. After 2 weeks, when the maximum diameter of the tumor reached about 300-500 mm 3 the experiment was started.
[0142] 2. Labeling with near-infrared fluorescent dye Dylight755
[0143] Label and identify Z AXL:239 affibody and its control Zwt affibody with Dylight755 according to the steps in the instruction manual. That is, dissolve 1 mg of DyLight 755 NHS-Ester dye (Dy755) into 1 mL of DMF organic solvent, and take 100 μL respectively and add them into the Z AXL:239 affibody (concentration: 500 μg / mL, total 1 mL) and Zwt (concentration: 500 μg / mL, total 1 mL) solutions for coupling. The coupling conditions were dark, 4°C, 12-16 h. Dialyze the reaction solution in the dark, change the dialysis solution (phosphate buffer, pH 7.2-7.4) every half hour. After 2 h, collect the fluorescent proteins labeled with Dy755 (Dy755-Z AXL:239 and Dy755-Zwt) respectively, measure the protein concentration, and aliquot them into brown centrifuge tubes and store them at -20°C for later use.
[0144] 3. Biodistribution of Z LMP2A -Naffibody polypeptide in normal nude mice
[0145] To analyze Dy755-Z LMP2A The metabolism of -N affibody in normal nude mice was investigated. Anesthesia was induced by 3% isoflurane and maintained by 1% isoflurane. After the mice were deeply anesthetized, 50 μg of Dy755-Z was injected via the tail vein. AXL:239 Affibody and Dy755-Zwt were used in the IVIS Spectrum small animal in vivo optical imaging system, with a 680 nm excitation filter and a 790 nm emission filter selected. Dy755-Zwt was injected with... AXL:239 Images were taken at 0h, 4h, and 24h after affibody and Dy755-Zwt assays, and the image information was analyzed using Living Image software to observe the targeting effect of fluorescently labeled proteins on tumors in tumor-bearing mice.
[0146] As a result, no fluorescent signal was detected in C666-1 tumor-bearing nude mice at 0 h without fluorescent protein injection. However, after tail vein injection of 50 μg Dy755-Z... AXL:239 Four hours after affibody fluorescent protein administration, obvious fluorescent signals appeared at the tumor sites and kidneys in the right upper limbs of nude mice. Fluorescent signals were still visible at 24 hours, although the fluorescence intensity was lower than that detected at 4 hours. Figure 8 (But Dy755-Z) wt Following injection of affibody fluorescent protein, no significant fluorescent signal was observed at the tumor site in the right upper limb of nude mice, with fluorescence only detected in the kidney. At 24 hours, no fluorescent signal was still detected at the tumor site in the right upper limb, while fluorescence was still present in the kidney, and the fluorescence intensity was also lower than that detected at 4 hours. Figure 8 ).
[0147] Therefore, the Z of the present invention AXL:239 Affibody peptides have the property of targeting and binding to tumors that express AXL protein positively in vivo.
[0148] The above description discloses only preferred embodiments of the present invention and should not be construed as limiting the scope of the present invention. Therefore, equivalent variations made in accordance with the claims of the present invention are still within the scope of the present invention.
Claims
1. A polypeptide with binding affinity for AXL protein, characterized in that: This polypeptide was obtained by modifying 14 amino acids using the amino acid sequence of the Z segment of Staphylococcus A protein as the backbone. Its amino acid sequence is shown in SEQ ID NO:
3.
2. A targeting molecule that targets the AXL protein, characterized in that: The targeting molecule consists of the polypeptide as described in claim 1 and a conjugate linked to the polypeptide; the conjugate is a polypeptide tag or a detectable marker.
3. A polynucleotide encoding the polypeptide as described in claim 1.
4. A recombinant vector, characterized in that: It contains the polynucleotide as described in claim 3.
5. A host cell, characterized in that: It contains the polynucleotide as described in claim 3.
6. A host cell as described in claim 5, characterized in that: Its genome integrates the polynucleotides as described in claim 3, or contains the recombinant vector as described in claim 4.
7. The application of the polypeptide of claim 1 or the targeting molecule of claim 2 in the detection of AXL protein, wherein the application is not for disease diagnosis or treatment purposes.
8. The use of the polypeptide of claim 1 or the targeting molecule of claim 2 in the preparation of a detection reagent or kit for detecting AXL protein.
9. The use of the polypeptide of claim 1 or the targeting molecule of claim 2 in the preparation of a pharmaceutical composition; wherein the pharmaceutical composition is a pharmaceutical composition for the diagnosis or adjunctive diagnosis of gastric cancer or nasopharyngeal carcinoma.